ID: 1083608229

View in Genome Browser
Species Human (GRCh38)
Location 11:63991856-63991878
Sequence GATAAGCCAAAGAGGGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 154}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083608221_1083608229 13 Left 1083608221 11:63991820-63991842 CCCTCACAAAACTTACAGTTCAG 0: 1
1: 1
2: 8
3: 45
4: 439
Right 1083608229 11:63991856-63991878 GATAAGCCAAAGAGGGCTCTGGG 0: 1
1: 0
2: 0
3: 11
4: 154
1083608220_1083608229 17 Left 1083608220 11:63991816-63991838 CCTGCCCTCACAAAACTTACAGT 0: 1
1: 2
2: 30
3: 226
4: 932
Right 1083608229 11:63991856-63991878 GATAAGCCAAAGAGGGCTCTGGG 0: 1
1: 0
2: 0
3: 11
4: 154
1083608222_1083608229 12 Left 1083608222 11:63991821-63991843 CCTCACAAAACTTACAGTTCAGG 0: 1
1: 0
2: 2
3: 38
4: 457
Right 1083608229 11:63991856-63991878 GATAAGCCAAAGAGGGCTCTGGG 0: 1
1: 0
2: 0
3: 11
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083608229 Original CRISPR GATAAGCCAAAGAGGGCTCT GGG Intronic
900139923 1:1135307-1135329 GGGATCCCAAAGAGGGCTCTTGG + Intergenic
905901687 1:41585593-41585615 CAGAAGGCAAAGTGGGCTCTGGG + Intronic
908044594 1:60154994-60155016 GATAAGCCAACGCGGTCTGTTGG + Intergenic
908297526 1:62727932-62727954 GCTTAGCCAGAGAGGGTTCTTGG + Intergenic
908405677 1:63811920-63811942 AATAAGCTAAAGAAGGCTTTCGG + Intronic
919576423 1:199315731-199315753 TAGAAGCCAAACATGGCTCTTGG - Intergenic
920783076 1:209013328-209013350 GATAAGCCAATAAAGGCTCTGGG - Intergenic
921300085 1:213743840-213743862 GATAGGCCAAAGAGTGCTTGAGG + Intergenic
922216574 1:223524915-223524937 GCTTAGCCCAGGAGGGCTCTTGG + Intergenic
922822797 1:228495403-228495425 GAAAGGGCAAAGAGGGCCCTAGG + Exonic
1063831014 10:9953093-9953115 GATAAGCCAAAAATGAATCTAGG - Intergenic
1068572641 10:58647662-58647684 GAGCAGCCAAAGAGGGTTCTGGG - Intronic
1071365065 10:84891125-84891147 GAGCAGCCACAGATGGCTCTGGG - Intergenic
1074521920 10:114233815-114233837 GATCAGCCAAAGAGGACACCTGG + Intergenic
1075486759 10:122828951-122828973 GAGAAGGCAAAGCGGGCACTGGG + Intergenic
1077014291 11:393080-393102 GATAAGCCTAGGAGGGCTGGGGG - Intronic
1078145108 11:8717149-8717171 GAAAAGCCAAAGGAAGCTCTTGG - Intronic
1080769572 11:35328053-35328075 GAAAAGGCAAAGTGAGCTCTGGG + Intronic
1081595958 11:44459672-44459694 ATAAAGCCAGAGAGGGCTCTGGG - Intergenic
1083608229 11:63991856-63991878 GATAAGCCAAAGAGGGCTCTGGG + Intronic
1084444173 11:69193871-69193893 GATAAACCCATGAGGCCTCTAGG - Intergenic
1084731858 11:71078977-71078999 GCTTAGCCCAGGAGGGCTCTTGG - Intronic
1084900328 11:72305254-72305276 GATAAGCCTAAGAATGCTGTAGG + Intronic
1085171350 11:74452449-74452471 GGTAAGCAAAGGAGTGCTCTTGG - Intergenic
1085353374 11:75815159-75815181 GCTAAGCCAATGAGCGCTCCGGG + Exonic
1086553934 11:88087447-88087469 GCTTAGCCAAGGAGGGTTCTTGG + Intergenic
1089528747 11:119113248-119113270 GAAATGCCACAGAGGCCTCTGGG - Intronic
1090878456 11:130812568-130812590 GAGAAGCCAAATAGGGGTCAAGG + Intergenic
1091190944 11:133694905-133694927 GAAAGCTCAAAGAGGGCTCTCGG + Intergenic
1093332808 12:17863763-17863785 AATAAGACAAAGAAAGCTCTTGG - Intergenic
1094709820 12:32950291-32950313 GCTTAGCCCATGAGGGCTCTTGG - Intergenic
1099452493 12:82824305-82824327 CATCAGCCAAAGAGGGCTGATGG - Intronic
1103262518 12:119600340-119600362 GAGAAGCAAAACAGAGCTCTTGG + Intronic
1106061427 13:26296525-26296547 GATGGGCCAAAATGGGCTCTGGG + Intronic
1106639169 13:31564931-31564953 GAGGATCCAAAGATGGCTCTGGG + Intergenic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1107196181 13:37654672-37654694 GATAACCCAGAGAGGAGTCTGGG - Intronic
1112177350 13:97039594-97039616 GATATGTCATAGAGGGCTCATGG - Intergenic
1115347916 14:32363000-32363022 CATAAGCCAAAGATGACTTTGGG + Intronic
1119524471 14:75311108-75311130 GAACAGGCAAAGAGGCCTCTGGG + Intergenic
1122498981 14:102182217-102182239 GATTTCCCAAAGAGGACTCTGGG + Intronic
1122977051 14:105175059-105175081 GGGGAGCCAAGGAGGGCTCTGGG - Intronic
1123776809 15:23588722-23588744 ATTAAGTCTAAGAGGGCTCTTGG - Intronic
1124110794 15:26784246-26784268 GATAAGACAAAGCTGGCTCCAGG - Intronic
1124598967 15:31115722-31115744 GGCAAGCAGAAGAGGGCTCTGGG - Intronic
1127503970 15:59580540-59580562 GAGCAGACAAAGAGGACTCTAGG - Intergenic
1128552222 15:68605688-68605710 GAGGAGTCACAGAGGGCTCTTGG + Intronic
1129461711 15:75703081-75703103 GAGAAGGCAGAGAGGGCCCTGGG + Intronic
1129723141 15:77888765-77888787 GAGAAGGCAGAGAGGGCCCTGGG - Intergenic
1129861899 15:78869709-78869731 AATAACACAAAGAGGGTTCTAGG + Intronic
1130968066 15:88711610-88711632 TATGAGCCCAAGAGGGCCCTGGG - Intergenic
1131912980 15:97228778-97228800 GTTAATCAAAAGAGAGCTCTTGG - Intergenic
1133447853 16:5877546-5877568 GCTTAGCCGAAGAGGGTTCTTGG + Intergenic
1134776862 16:16860772-16860794 GATAACGCACAGAGTGCTCTTGG + Intergenic
1134856589 16:17525131-17525153 GCTTGGCCAAAGAGGGCACTGGG - Intergenic
1136375016 16:29860315-29860337 GATAAGCCAGAGAGGTCTGCAGG - Intronic
1137674584 16:50298014-50298036 GATGAACCTCAGAGGGCTCTCGG + Intronic
1137845577 16:51684660-51684682 GATGAGTCAAGGAAGGCTCTTGG + Intergenic
1138502798 16:57458496-57458518 AAGAAGCCAAAGTGGGATCTAGG + Intronic
1138768899 16:59638128-59638150 GATAAGGCAAAGAGGGGCCTGGG + Intergenic
1140133648 16:72185879-72185901 GAGAAGCCAAAGAGAGTTTTGGG + Intergenic
1140859037 16:79003399-79003421 GATAAGCGGAAGAGGCCTCACGG - Intronic
1146263314 17:31435639-31435661 CATCAGCCAAAGTGGCCTCTGGG - Intronic
1146546950 17:33748248-33748270 GAGAAGCCCAAGAGTGCTCAGGG - Intronic
1147532774 17:41295362-41295384 GATAAGTCAAAGAGGCTTCTAGG + Intergenic
1148330444 17:46810934-46810956 GAGATGCCAGAGCGGGCTCTGGG - Intronic
1149024700 17:52013483-52013505 GATTAGCTAAAGAGGGCATTAGG + Intronic
1152289046 17:79428450-79428472 GACCAGCCTAAGAGGGCTCTAGG - Intronic
1155145199 18:23077761-23077783 GTTCTGCCAAGGAGGGCTCTGGG + Intergenic
1156177645 18:34565599-34565621 CACAAGCCAAAGAATGCTCTGGG - Intronic
1156838853 18:41587550-41587572 GATAAAGTAAAAAGGGCTCTTGG - Intergenic
1158214351 18:55083931-55083953 CATAAGCCAAAGAAAACTCTAGG + Intergenic
1159262954 18:66039561-66039583 GCTTAGCCCAAGAGGGTTCTTGG - Intergenic
1160111228 18:76033719-76033741 GAGAAGCCAAAGGGGACTGTAGG - Intergenic
1163589564 19:18184634-18184656 GCTTAGCCCAGGAGGGCTCTTGG + Intergenic
1167677873 19:50899508-50899530 GTTTAGCCAAGGAGGGTTCTTGG + Intergenic
925311996 2:2891194-2891216 GATAAGTCAGGAAGGGCTCTAGG + Intergenic
925441012 2:3885183-3885205 GATAAGCTAAAGATGTTTCTGGG + Intergenic
925761842 2:7192381-7192403 GATAAGCCAAAGTGGGATAAGGG - Intergenic
927213134 2:20650899-20650921 GATAAGCCACCGAGGGCGCTGGG + Intronic
928039034 2:27855120-27855142 GCTTAGCCAAGGAGGGTTCTTGG - Intronic
928520867 2:32087259-32087281 GATAAGCAAAATAGGACTCACGG + Intronic
928788166 2:34915724-34915746 GCTTAGCCCAAGAGGGTTCTTGG - Intergenic
929828361 2:45328152-45328174 GCTTAGCCCAAGAGGGATCTTGG + Intergenic
929849683 2:45574074-45574096 CATAAGCCCAAGAAGGCTCTAGG + Intronic
932434741 2:71696428-71696450 GATGAGCCACAGAGGGCTGAAGG - Intergenic
932997502 2:76873316-76873338 GTTGTGCCAAAGAGGGCTCTGGG - Intronic
934159584 2:89235683-89235705 GAAAAGCAAAACAGAGCTCTAGG + Intergenic
934207694 2:89946748-89946770 GAAAAGCAAAACAGAGCTCTAGG - Intergenic
935470169 2:103450096-103450118 GATCAGCCGAAAGGGGCTCTGGG - Intergenic
936254084 2:110894565-110894587 TAAAAGCCAAACAGGGATCTGGG + Intronic
936501910 2:113073325-113073347 GAAAAATCAAAGAGGACTCTGGG + Intronic
936855993 2:116957910-116957932 GAAAAGACAAAGGGGGCTTTGGG + Intergenic
937868681 2:126772275-126772297 AAGAAGCCAATGAGTGCTCTGGG + Intergenic
938420390 2:131141114-131141136 GAGAAGTCAAGGAGGCCTCTGGG + Intronic
940079453 2:149783839-149783861 GATAAGTCAAAGACGACGCTAGG - Intergenic
943772219 2:191730837-191730859 GCAAAGTCAAAGAGGACTCTAGG + Intergenic
947512343 2:230767865-230767887 GGTAAGCCAAATAGAGCACTAGG - Intronic
948004078 2:234592840-234592862 CCTAAGCCAGAGAGGGCTCCTGG + Intergenic
1169902748 20:10570066-10570088 GGTAAGCCAGAGACAGCTCTGGG + Intronic
1171170990 20:23015206-23015228 GCTTAGCCTGAGAGGGCTCTTGG + Intergenic
1173130728 20:40390776-40390798 GAGAAGCTAAAGAGGGATCCAGG + Intergenic
1174707420 20:52670617-52670639 GATTAGCCCATGAGGGTTCTTGG - Intergenic
1175750420 20:61493322-61493344 GAGAAGCCAAACAGATCTCTAGG - Intronic
1176841841 21:13848660-13848682 GATAAGCCACAGGGGTCCCTGGG + Intergenic
1182723215 22:32421393-32421415 GATACGAAAAAGAGAGCTCTGGG - Intronic
950155573 3:10719117-10719139 GGTCAGCCAGAGAGGCCTCTGGG + Intergenic
950259823 3:11535778-11535800 GAAATGCCCCAGAGGGCTCTTGG - Intronic
952039756 3:29248023-29248045 GAGAAGCCAAACAGGGCACTGGG + Intergenic
952183282 3:30941867-30941889 GATAAAGCAAGCAGGGCTCTCGG + Intergenic
953159244 3:40403163-40403185 GATTAGCCAAAGAAGACTCTTGG - Intronic
955634192 3:61008079-61008101 GATTAGTAAGAGAGGGCTCTTGG - Intronic
959628110 3:108476260-108476282 AATAAGCAAAAAAGAGCTCTTGG - Intronic
961358940 3:126355843-126355865 GACAACCCAGAAAGGGCTCTGGG + Intronic
964133520 3:153317701-153317723 GAAAAGGTAAAGAAGGCTCTTGG - Intergenic
965517523 3:169637461-169637483 GAAATGCCAAAGATGACTCTGGG + Intronic
967998992 3:195188642-195188664 GCTTAGCCCAAGAGGGTTCTTGG - Intronic
968067416 3:195766395-195766417 AACCAGCCCAAGAGGGCTCTCGG - Intronic
969265195 4:6059845-6059867 GGGGAGCCAGAGAGGGCTCTGGG - Intronic
969690220 4:8700027-8700049 GAAAAGCCAAAGAGGGGCTTAGG - Intergenic
969901071 4:10349868-10349890 GCTAAGCCTAAGAGGCCACTAGG - Intergenic
970631793 4:17954766-17954788 GAGAAACCAAAGAAGGCTCCTGG + Intronic
970734493 4:19150108-19150130 GTTCAGCCCAAGAGGGTTCTTGG - Intergenic
971134117 4:23848411-23848433 GCTCAGGCAAAGAGGACTCTGGG - Intronic
977565266 4:98574440-98574462 CATAAGGTAAAGAGGTCTCTAGG - Intronic
982492954 4:156052374-156052396 GATAGGCGAAAGAGGATTCTTGG - Intergenic
983461835 4:168034813-168034835 TATAAGCCAAAGTGAACTCTAGG - Intergenic
985388273 4:189467548-189467570 GATACCCCAAAGAGTTCTCTTGG + Intergenic
988813426 5:34807252-34807274 GATGAGCCAAGCAGGGCTCTAGG + Intronic
989663029 5:43820224-43820246 GATAAACCAAAGAGGTCACCTGG - Intergenic
994577252 5:101594521-101594543 AATAGGCCAGAGAGGGCTCAAGG + Intergenic
995452386 5:112316428-112316450 GATAAGGCAAAGTGGGCGCACGG + Intronic
997784451 5:136696127-136696149 GATAATCTAAAGAAGGCTGTGGG + Intergenic
997898664 5:137743028-137743050 GACTAGCCAAAGAATGCTCTTGG + Intergenic
999034582 5:148333302-148333324 GCTTAGCCAAGGAGGGTTCTTGG + Intronic
1001588926 5:172852349-172852371 GTTAAGTCAAAGAGGTCTCCTGG + Intronic
1004027184 6:11830707-11830729 GCAAATCCAAAGAAGGCTCTGGG - Intergenic
1018311996 6:162519396-162519418 TATTAGCCTATGAGGGCTCTTGG + Intronic
1018551077 6:164999533-164999555 GAGAAGACAGAGATGGCTCTGGG + Intergenic
1020551119 7:9605871-9605893 TATAAGCCAATGAGGGCCCAAGG + Intergenic
1021229742 7:18071823-18071845 GATAAATCAGAGTGGGCTCTTGG + Intergenic
1022809347 7:33853592-33853614 GATAAGATACAGAAGGCTCTGGG - Intergenic
1023966329 7:44964884-44964906 GGGCTGCCAAAGAGGGCTCTCGG - Intronic
1024719651 7:52121057-52121079 GAAAAGACAAGGAGGGCTATAGG - Intergenic
1026428944 7:70324938-70324960 GGTAAGCCAGAGTGGGCTTTTGG - Intronic
1034394240 7:150808235-150808257 GTTAAGCCACACAGGGCTCAGGG - Intergenic
1036220334 8:6915878-6915900 GAGAACCCAAGGAAGGCTCTGGG + Intergenic
1040981345 8:53249241-53249263 GTTAAGCAAAAGAAAGCTCTAGG - Intronic
1042947283 8:74167909-74167931 GATGAGCCATAGAGGTATCTAGG + Intergenic
1045986681 8:108257259-108257281 TATAAGCCAAAGAGAGGCCTCGG + Intronic
1046174194 8:110553464-110553486 AATAAGCCCATCAGGGCTCTAGG - Intergenic
1050581787 9:7065418-7065440 TATAAGCAACAGATGGCTCTAGG - Intronic
1053151077 9:35743491-35743513 GATGAGGCAGAGAGGGATCTTGG + Intronic
1056279607 9:85028453-85028475 GGGAAGCAAGAGAGGGCTCTGGG - Intergenic
1057746230 9:97753833-97753855 GCTTAGCCCAAGAGGGTTCTTGG + Intergenic
1061347786 9:130041469-130041491 GATAAGCTAAAGAGAGCTAAAGG + Intronic
1187743839 X:22386827-22386849 GATACACCAAAGAGGATTCTTGG - Intergenic
1189921092 X:45903941-45903963 GAGAAGCCAAACAGGCCACTTGG + Intergenic
1189942338 X:46137712-46137734 GATGAGTTAAAGAGGCCTCTGGG + Intergenic
1190364266 X:49676788-49676810 GATAACCCAAAGTGAGGTCTAGG - Intergenic
1190953340 X:55167662-55167684 GCTTAGCCTGAGAGGGCTCTTGG - Intronic
1194273076 X:91844334-91844356 GATAAGCCAAAGAGGGTAAGTGG - Intronic
1197252688 X:124231868-124231890 GATAAGCCAAAAAAGACTTTAGG - Intronic
1198684568 X:139213925-139213947 TAGAAACCACAGAGGGCTCTGGG + Intronic
1200590319 Y:5065732-5065754 GATAAGCCAAAGAGGGTAAGTGG - Intronic
1200796551 Y:7346192-7346214 GAGGAGCCCCAGAGGGCTCTGGG - Intergenic