ID: 1083609070

View in Genome Browser
Species Human (GRCh38)
Location 11:63996606-63996628
Sequence ATCCAGCAGTGCCTCCAAGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 141}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083609070_1083609074 6 Left 1083609070 11:63996606-63996628 CCCACTTGGAGGCACTGCTGGAT 0: 1
1: 0
2: 0
3: 8
4: 141
Right 1083609074 11:63996635-63996657 AAGGAGTTGCAGCGGTGAGAAGG 0: 1
1: 0
2: 2
3: 15
4: 170
1083609070_1083609075 7 Left 1083609070 11:63996606-63996628 CCCACTTGGAGGCACTGCTGGAT 0: 1
1: 0
2: 0
3: 8
4: 141
Right 1083609075 11:63996636-63996658 AGGAGTTGCAGCGGTGAGAAGGG 0: 1
1: 0
2: 2
3: 17
4: 199
1083609070_1083609080 26 Left 1083609070 11:63996606-63996628 CCCACTTGGAGGCACTGCTGGAT 0: 1
1: 0
2: 0
3: 8
4: 141
Right 1083609080 11:63996655-63996677 AGGGTGGGCACTGGGCACCGAGG 0: 1
1: 1
2: 10
3: 30
4: 398
1083609070_1083609076 10 Left 1083609070 11:63996606-63996628 CCCACTTGGAGGCACTGCTGGAT 0: 1
1: 0
2: 0
3: 8
4: 141
Right 1083609076 11:63996639-63996661 AGTTGCAGCGGTGAGAAGGGTGG 0: 1
1: 0
2: 1
3: 21
4: 218
1083609070_1083609081 30 Left 1083609070 11:63996606-63996628 CCCACTTGGAGGCACTGCTGGAT 0: 1
1: 0
2: 0
3: 8
4: 141
Right 1083609081 11:63996659-63996681 TGGGCACTGGGCACCGAGGCAGG 0: 1
1: 0
2: 2
3: 28
4: 334
1083609070_1083609073 -2 Left 1083609070 11:63996606-63996628 CCCACTTGGAGGCACTGCTGGAT 0: 1
1: 0
2: 0
3: 8
4: 141
Right 1083609073 11:63996627-63996649 ATGACAGCAAGGAGTTGCAGCGG 0: 1
1: 0
2: 1
3: 12
4: 198
1083609070_1083609078 17 Left 1083609070 11:63996606-63996628 CCCACTTGGAGGCACTGCTGGAT 0: 1
1: 0
2: 0
3: 8
4: 141
Right 1083609078 11:63996646-63996668 GCGGTGAGAAGGGTGGGCACTGG 0: 1
1: 0
2: 6
3: 28
4: 305
1083609070_1083609079 18 Left 1083609070 11:63996606-63996628 CCCACTTGGAGGCACTGCTGGAT 0: 1
1: 0
2: 0
3: 8
4: 141
Right 1083609079 11:63996647-63996669 CGGTGAGAAGGGTGGGCACTGGG 0: 1
1: 0
2: 0
3: 15
4: 217
1083609070_1083609077 11 Left 1083609070 11:63996606-63996628 CCCACTTGGAGGCACTGCTGGAT 0: 1
1: 0
2: 0
3: 8
4: 141
Right 1083609077 11:63996640-63996662 GTTGCAGCGGTGAGAAGGGTGGG 0: 1
1: 0
2: 1
3: 10
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083609070 Original CRISPR ATCCAGCAGTGCCTCCAAGT GGG (reversed) Exonic
900326073 1:2109299-2109321 GTCCGGCAGTGCCTCCATCTGGG - Intronic
900922318 1:5681049-5681071 CTCCAGCAAGGCCTCCAAGCAGG - Intergenic
903577635 1:24348589-24348611 CTCCAGCAGCGCTTCCAAGCTGG + Intronic
906291364 1:44621591-44621613 ATGCAGCAGTGACTCTCAGTGGG - Intronic
906358918 1:45135836-45135858 ATTGAGAAGTCCCTCCAAGTTGG - Intronic
907410851 1:54282347-54282369 CTCCAGCAGTGTTTCCCAGTTGG - Intronic
908296255 1:62716436-62716458 ATCCAGCACTGCCTGCAACTGGG - Intergenic
909486135 1:76176235-76176257 ATCTAGCAGTGGCTGCAAGAGGG - Intronic
909705793 1:78582312-78582334 ATCCAGCATTGCATCAAAATGGG - Intergenic
912685124 1:111756109-111756131 AAGCAGCAGTGACTCGAAGTCGG - Exonic
914806429 1:150995390-150995412 GACCAGCTGGGCCTCCAAGTAGG + Exonic
914860732 1:151383751-151383773 CTTCAGCAGTGGCTCCAACTGGG - Intergenic
915541706 1:156571523-156571545 AGCCATCAGTTCCTCCAAGGGGG + Intronic
915673497 1:157509953-157509975 GTCCACCTGTGTCTCCAAGTGGG - Intergenic
922222298 1:223617991-223618013 ACCCAGCACTGCATCCAGGTGGG + Intronic
923836264 1:237614552-237614574 ATTCAGTAGTCCCTCCAACTGGG - Exonic
1066318456 10:34274006-34274028 ATCCAGCAGTGTCCCCAATGGGG + Intronic
1067783739 10:49227679-49227701 ACCCAGCAGTGCCCCCAAGAGGG - Intergenic
1068122364 10:52795751-52795773 ATCCAGCAGTCCCCACAACTGGG - Intergenic
1069574362 10:69516411-69516433 CCCCAGCAGTGCCTCCACCTGGG + Intergenic
1069914263 10:71777744-71777766 ATCCAGCAGCACCTCATAGTGGG - Intronic
1076427103 10:130374734-130374756 GACCAGCTGTGCCTCCAAGGTGG - Intergenic
1080761725 11:35256928-35256950 ATGCAGCAGTAAATCCAAGTAGG - Exonic
1083398807 11:62409991-62410013 ACCCAGGAGTGGCTCCAAGGTGG + Intronic
1083609070 11:63996606-63996628 ATCCAGCAGTGCCTCCAAGTGGG - Exonic
1083853940 11:65382893-65382915 AGCCAGCAGTGCCTCCGGCTGGG - Intronic
1085545325 11:77312738-77312760 AGACAGCAGTGCCTTCAGGTTGG + Intergenic
1086014372 11:82148937-82148959 ATCCAGCTTTGACACCAAGTAGG - Intergenic
1087678616 11:101191919-101191941 ATCCAGCAGTGCTTCTAGGATGG - Intergenic
1089442270 11:118527548-118527570 ATCCAACAATGTCTCCAAATGGG - Exonic
1090363948 11:126190969-126190991 ATCCCGCAGTGCTTCCACGAAGG - Intergenic
1091447272 12:551218-551240 GTCCAGCAGAGCCTGCACGTGGG + Intronic
1098101142 12:67018301-67018323 ATGGAGGAGCGCCTCCAAGTGGG + Intergenic
1098386807 12:69928405-69928427 ATCCAGCAGTGGCCCAAAGGTGG + Intronic
1102451692 12:113046700-113046722 ATGCATCACTGGCTCCAAGTTGG - Intergenic
1103209237 12:119154577-119154599 AACCAGCAGGGCCTGCAAGAAGG + Intronic
1103910287 12:124348404-124348426 AGCCAGCAGTGCTTCCATGCTGG + Intronic
1104216754 12:126741448-126741470 TTGCACCAGTGCCTCCAAATTGG + Intergenic
1114582513 14:23775445-23775467 AAGCAGCAGGGCCTCCAAGCTGG + Intergenic
1117752855 14:58941458-58941480 TGTCAGCAGTGCCTCCACGTGGG - Intergenic
1119280787 14:73405742-73405764 GTGGAGCCGTGCCTCCAAGTGGG + Intronic
1122601529 14:102924071-102924093 GTCCTGCAGTGCCTCCATGCCGG - Intronic
1123724520 15:23088698-23088720 ATCCAGCCGGGTCTCCATGTTGG - Intergenic
1124374387 15:29121172-29121194 CCCCAGCAGTGCCTCCCTGTAGG - Exonic
1125682061 15:41537160-41537182 CTCCAGCAGTGTCTCCGTGTGGG + Exonic
1128470113 15:67944626-67944648 ATCCAGCAGTGCCTTGGAGCAGG - Intergenic
1131276262 15:90984129-90984151 ATCCAGGAGTTCCTACAAGAGGG + Exonic
1132857723 16:2054420-2054442 ACCCAGCTCTTCCTCCAAGTAGG - Exonic
1133797423 16:9057456-9057478 ATGCTGCAGTGCCTCCTAGCTGG + Intergenic
1134833284 16:17340817-17340839 ATCCATCATTTCCTCCAAGGAGG + Intronic
1135683937 16:24482531-24482553 ATCCAAAAGACCCTCCAAGTAGG - Intergenic
1137776748 16:51061306-51061328 ACCAAGCAGTGCTTCCATGTGGG + Intergenic
1142666108 17:1464767-1464789 CTCCAGCACTGCCTCAAACTGGG + Exonic
1146288098 17:31588179-31588201 ATGCAACAGTGATTCCAAGTCGG - Intergenic
1150584441 17:66504846-66504868 ATCCAGCAGTGCCTACACTCAGG + Intronic
1151424100 17:74018597-74018619 ATCCTGTAGTGCCTCAAACTGGG + Intergenic
1151911715 17:77087944-77087966 ACCTAGCAATGCATCCAAGTAGG + Intronic
1152751305 17:82063654-82063676 AACCAGCAGTGTCTCCAGTTGGG + Intronic
1156859773 18:41822289-41822311 ACCCAGCAGTCCATCCAGGTGGG - Intergenic
1157976730 18:52336278-52336300 TCCCAGCAGTGCCTCCATGAGGG + Intergenic
1159344159 18:67176817-67176839 ATACAGAAGTGCCACCAAGAGGG + Intergenic
1161316287 19:3619089-3619111 CTCCAGCAGGTCCTCCATGTCGG + Exonic
1161582969 19:5090808-5090830 ATCGGCCTGTGCCTCCAAGTGGG - Intronic
1163511958 19:17740859-17740881 ACCCAGCAGTGCTGCCAAGCTGG - Intergenic
1165153581 19:33774528-33774550 ATCCAGCAGTTCCTCCACCTGGG - Intergenic
1165153586 19:33774552-33774574 ATCCAGCAGTTCCTCTATCTGGG - Intergenic
1165153596 19:33774600-33774622 ATCCAGCATTTCCTCCATCTGGG - Intergenic
1165153608 19:33774647-33774669 ATCCAGCAGCTCCTCCACCTGGG - Intergenic
1166960740 19:46494575-46494597 AGCCAGCAGGGCCACTAAGTCGG + Exonic
925143229 2:1564209-1564231 ACCCAGCAGTGGTTCGAAGTTGG - Intergenic
925419990 2:3703873-3703895 CTCCAGCAGCGCCTCGAAGGTGG - Exonic
925741983 2:7013806-7013828 TTTAAGCAGTGCCCCCAAGTAGG + Intronic
927083628 2:19653891-19653913 TTCCAGTAGGGCCTCCAAGAAGG - Intergenic
928304482 2:30155867-30155889 ATCCTACACTGCCTCCAAGATGG - Exonic
931855850 2:66301311-66301333 ATACAGCAGCGACTCCGAGTCGG + Intergenic
937156209 2:119721193-119721215 AACCAGCCCTGCCTCCAAGGAGG + Intergenic
937249183 2:120512496-120512518 ATCAAGCAGTGCCACCCAGAGGG - Intergenic
941115658 2:161469149-161469171 GTCCAGCAGTGCCACTGAGTTGG - Intronic
945304670 2:208247735-208247757 CTCAAGCAGTGCTTCCAAATTGG + Intronic
1168769105 20:402931-402953 ATGCTGCTGGGCCTCCAAGTTGG + Intergenic
1170510860 20:17075375-17075397 AGCCAGAAGTGCCACAAAGTTGG - Intergenic
1170984053 20:21242279-21242301 CCCAAGCAGTGCCTCCAAGGTGG - Intronic
1171979564 20:31618039-31618061 ATCAAGCAGTCCTTCCAAGTAGG + Intergenic
1173878087 20:46389158-46389180 ATCCAGCCGGGTCTCCATGTTGG + Exonic
1173924499 20:46770773-46770795 ATAAAGCAGTGCTTCCAGGTGGG + Intergenic
1174442795 20:50569380-50569402 GTCCAGGGGTGCCTGCAAGTGGG - Intronic
1183199349 22:36375117-36375139 ATTCAGCAGTGACTCCTACTAGG - Intronic
1184456705 22:44614972-44614994 ATCCACCAGCCCCTCGAAGTTGG + Intergenic
1184456836 22:44615796-44615818 ATCCACCAGTCCCTCGAAGTTGG + Intergenic
949133718 3:536608-536630 ATCCAGCAGTGCATACCACTGGG - Intergenic
949478798 3:4473634-4473656 ATCCAGGAGGGCCTGCAAGATGG + Intergenic
952280277 3:31916118-31916140 ATCCAGCACTGTCTCCAGGAGGG + Intronic
952908131 3:38157312-38157334 ATCCAGCAAAGACTCCAAGAAGG + Intergenic
953461799 3:43087446-43087468 CTGCAGCACTGCCTCCCAGTGGG + Intronic
954139138 3:48595964-48595986 ATCCAGCTGTGCCTGCAGGGAGG + Intergenic
954579392 3:51695036-51695058 ACACAGCAGTCCCTGCAAGTGGG - Intronic
959520137 3:107316276-107316298 TTCCTGTACTGCCTCCAAGTTGG - Intergenic
962178845 3:133183907-133183929 TTCCTGCAATGCCCCCAAGTAGG - Intronic
963953811 3:151231025-151231047 ATCTAGGAGTGCCCTCAAGTCGG - Intronic
964555023 3:157927541-157927563 AGCCAGCAGTGCAACCCAGTCGG - Intergenic
964836933 3:160949411-160949433 AACCAGCAGTCCTTGCAAGTGGG + Intronic
968199367 3:196739635-196739657 ATTCAGCATTGTCTCCAAGCAGG - Intergenic
968966303 4:3770673-3770695 ATCATGCTGTGCCTCCACGTGGG - Intergenic
972530846 4:39959965-39959987 AACCAGCAGTCCCACCAACTTGG + Intronic
979897345 4:126176221-126176243 ATGGAGCGGTGCCTCAAAGTGGG - Intergenic
980569382 4:134593813-134593835 ATCCAGTAGTGTTTTCAAGTGGG - Intergenic
987837391 5:23179046-23179068 ATCAGGCAGGGCCTCCCAGTGGG - Intergenic
991119656 5:62997041-62997063 ATCCACCAGTGCCTTGATGTTGG - Intergenic
993860278 5:93127690-93127712 ATCCAGCAGTAGCTCCTAGCGGG - Intergenic
993901291 5:93585450-93585472 CTCAAGAAGTGCCTCAAAGTGGG + Exonic
996366587 5:122707880-122707902 CTCCAGCAGTCCTCCCAAGTTGG + Intergenic
996907322 5:128615739-128615761 ACCCAGGAGTGCAGCCAAGTTGG + Intronic
997111340 5:131078272-131078294 ATCCATTAGTGCCTCAAATTAGG - Intergenic
997243364 5:132324943-132324965 CACCAGCAGTGCCTCTATGTAGG - Intronic
997444797 5:133933294-133933316 ATCCAGCAATGTGTACAAGTGGG + Intergenic
998474333 5:142407948-142407970 TCCCAGCAGAGCCTCCAGGTGGG + Intergenic
1002538981 5:179893746-179893768 ACCCAGCAGCTCCCCCAAGTGGG + Intronic
1002930700 6:1632906-1632928 CTCCAGCAATGCCGCCATGTTGG - Intronic
1004315602 6:14584657-14584679 ATCCAGCAGTGTCCACAAGATGG - Intergenic
1006723061 6:36172695-36172717 AGCCAGCTGTGCCTCCAATTGGG + Intergenic
1012565060 6:100638666-100638688 ATCCAGTAGGTGCTCCAAGTAGG + Exonic
1015658492 6:135546693-135546715 ATCCAGCAGGGAATCCAGGTGGG - Intergenic
1015862830 6:137698543-137698565 ATCCAGCACGGCCTTCAAGCAGG + Intergenic
1017488637 6:154925058-154925080 AGCCTGCCGCGCCTCCAAGTCGG + Intronic
1021881781 7:25102003-25102025 GTCCAGCACTGCCTGCAAGTGGG + Intergenic
1022044090 7:26609672-26609694 ATCCTGCTGTGCCTCCAGGGCGG - Intergenic
1022150280 7:27596163-27596185 TTCCAGCTCTGCCTCCAAGAAGG + Intronic
1030153769 7:106431317-106431339 ATCCACCAAGGCCTCCTAGTTGG + Intergenic
1034445306 7:151111065-151111087 GTCCAGCAGGCTCTCCAAGTTGG - Intronic
1035732382 8:1862175-1862197 AGCCAGCAGTGCCACCAGGCAGG - Intronic
1036721447 8:11179428-11179450 AGCCACCAGTCCCTCCAGGTTGG + Intronic
1038790240 8:30662067-30662089 AGTCATCTGTGCCTCCAAGTTGG - Intergenic
1039004997 8:33026222-33026244 ATTCAGCAATGCCACTAAGTGGG - Intergenic
1039951384 8:42175523-42175545 GCCCAGCAGGGCCTCAAAGTTGG - Exonic
1040651523 8:49454497-49454519 ATACAGCTGTGACTCCAACTAGG + Intergenic
1043932142 8:86103541-86103563 CTCCAGCAGTGTCTTCAGGTAGG + Intronic
1045411940 8:101929004-101929026 ATCCAGAAGGCCTTCCAAGTGGG + Intronic
1046567595 8:115920640-115920662 ATCTACCAGTGCCTCCACTTTGG - Intergenic
1051823542 9:21193960-21193982 TTCCTTCAATGCCTCCAAGTCGG + Intergenic
1057363329 9:94395610-94395632 ACACAGCAGTGCCCCCAAATTGG + Intronic
1057522355 9:95770092-95770114 ATCCAGCTGTGCCTGAAGGTAGG + Intergenic
1057660008 9:96992489-96992511 ACACAGCAGTGCCCCCAAATTGG - Intronic
1058264440 9:102881015-102881037 TTCCAGCAATGAATCCAAGTTGG + Intergenic
1059348293 9:113647092-113647114 ATCCACCAGTGCCACCAAATCGG - Intergenic
1060862371 9:126965319-126965341 TTCCTGCAGTGACTTCAAGTAGG + Intronic
1062400046 9:136368390-136368412 ATCCAGCTGTGCCCCCATGGGGG - Intronic
1186642680 X:11472887-11472909 ATCCACCCCTGCCTCCAACTAGG + Intronic
1189398115 X:40641741-40641763 ATGCAGCAGAGCCTCCCTGTTGG - Intronic
1199015785 X:142813499-142813521 ATCCAGCATTGCCTTCATTTTGG - Intergenic
1199685466 X:150261192-150261214 AAACAGCAGTGCCCCCAATTTGG - Intergenic