ID: 1083610221

View in Genome Browser
Species Human (GRCh38)
Location 11:64000780-64000802
Sequence TCGCACCGACGCTGAGGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 77}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083610221_1083610238 20 Left 1083610221 11:64000780-64000802 CCCGGGCCTCAGCGTCGGTGCGA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1083610238 11:64000823-64000845 GGCGGCGCCCCATCACGGGGCGG 0: 1
1: 0
2: 1
3: 5
4: 81
1083610221_1083610225 -1 Left 1083610221 11:64000780-64000802 CCCGGGCCTCAGCGTCGGTGCGA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1083610225 11:64000802-64000824 ATCCCAAGGCCCACCTCCCCAGG 0: 1
1: 0
2: 1
3: 29
4: 315
1083610221_1083610228 2 Left 1083610221 11:64000780-64000802 CCCGGGCCTCAGCGTCGGTGCGA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1083610228 11:64000805-64000827 CCAAGGCCCACCTCCCCAGGCGG 0: 1
1: 0
2: 3
3: 27
4: 329
1083610221_1083610239 23 Left 1083610221 11:64000780-64000802 CCCGGGCCTCAGCGTCGGTGCGA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1083610239 11:64000826-64000848 GGCGCCCCATCACGGGGCGGCGG 0: 1
1: 0
2: 1
3: 10
4: 97
1083610221_1083610235 16 Left 1083610221 11:64000780-64000802 CCCGGGCCTCAGCGTCGGTGCGA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1083610235 11:64000819-64000841 CCCAGGCGGCGCCCCATCACGGG 0: 1
1: 0
2: 0
3: 8
4: 124
1083610221_1083610233 15 Left 1083610221 11:64000780-64000802 CCCGGGCCTCAGCGTCGGTGCGA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1083610233 11:64000818-64000840 CCCCAGGCGGCGCCCCATCACGG 0: 1
1: 0
2: 1
3: 6
4: 127
1083610221_1083610237 17 Left 1083610221 11:64000780-64000802 CCCGGGCCTCAGCGTCGGTGCGA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1083610237 11:64000820-64000842 CCAGGCGGCGCCCCATCACGGGG 0: 1
1: 0
2: 0
3: 3
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083610221 Original CRISPR TCGCACCGACGCTGAGGCCC GGG (reversed) Intronic
901625750 1:10623991-10624013 TCACAAGGACACTGAGGCCCAGG + Intronic
902348632 1:15837018-15837040 ACGCACCGAGGCCGAGGCCAGGG - Intergenic
908231993 1:62114220-62114242 TCCCAACGATGCTCAGGCCCAGG - Exonic
909957918 1:81801684-81801706 TCGCGCCGACCCTGCGGCCTGGG - Intronic
914900543 1:151709036-151709058 CCAGACCCACGCTGAGGCCCAGG - Exonic
918299076 1:183186012-183186034 TGGCACAGAGGCTGCGGCCCGGG - Intergenic
920139369 1:203796395-203796417 TGACTCCGACGCTGAGGGCCAGG - Exonic
923092018 1:230747955-230747977 TCCCACCGAGGCTGAGGACCTGG + Intronic
1062898774 10:1125953-1125975 CCGCACAGATGCAGAGGCCCAGG + Intronic
1064371042 10:14751826-14751848 ACGCACCGAGACTGAAGCCCAGG + Intronic
1072692422 10:97580777-97580799 TCCCACCCAAGCTGAGGCCCAGG - Intronic
1077177759 11:1198352-1198374 TCCCACTGACCCTGAGGCCCAGG + Intronic
1079035004 11:17013776-17013798 CCGCACCTACGCTGGGGACCTGG - Intronic
1079168065 11:18065640-18065662 TCCAAACGACGCTGAGGGCCTGG + Intergenic
1083610221 11:64000780-64000802 TCGCACCGACGCTGAGGCCCGGG - Intronic
1083662969 11:64260332-64260354 TCACACCCACACTGAGCCCCAGG - Intronic
1085448188 11:76615163-76615185 CCGCAAGGACACTGAGGCCCAGG - Intergenic
1118159734 14:63276192-63276214 CCCCACCGAAGCTGAGGCACTGG - Intronic
1119483382 14:74973644-74973666 TCGCTCTGCCGCAGAGGCCCTGG - Intergenic
1125200778 15:37099270-37099292 TCGCACACACGCAGAGGCACGGG + Intronic
1127995484 15:64151383-64151405 CAGGACCGGCGCTGAGGCCCGGG + Intergenic
1131097181 15:89663532-89663554 TGGCACTGACTCTGTGGCCCTGG - Intergenic
1131097185 15:89663552-89663574 TGGCACTGACTCTGTGGCCCTGG - Intergenic
1131097193 15:89663592-89663614 TGGCACTGACTCTGTGGCCCTGG - Intergenic
1131097201 15:89663632-89663654 TGGCACTGACTCTGTGGCCCTGG - Intergenic
1131097209 15:89663672-89663694 TGGCACTGACTCTGTGGCCCTGG - Intergenic
1131097217 15:89663712-89663734 TGGCACTGACTCTGTGGCCCTGG - Intergenic
1131097261 15:89663932-89663954 TGGCACTGACTCTGTGGCCCTGG - Intergenic
1131097269 15:89663972-89663994 TGGCACTGACTCTGTGGCCCTGG - Intergenic
1131174382 15:90201091-90201113 TCCCACCGCCGCCCAGGCCCTGG - Intronic
1131344809 15:91636808-91636830 TCCCACTGAATCTGAGGCCCTGG - Intergenic
1132748015 16:1445039-1445061 CGGCGCCGACTCTGAGGCCCGGG + Exonic
1133317686 16:4894480-4894502 CCCCACAGACCCTGAGGCCCTGG - Exonic
1152084261 17:78207947-78207969 TGGCCCCAACGCTGAGACCCCGG - Intergenic
1152892301 17:82889384-82889406 CAGCACCCACGCGGAGGCCCCGG - Intronic
1157522325 18:48353856-48353878 TAGCACCAAGACTGAGGCCCAGG + Intronic
1164479117 19:28597983-28598005 TCACACCAACCCTGAGCCCCAGG - Intergenic
1165328247 19:35126458-35126480 GGACACGGACGCTGAGGCCCTGG - Exonic
1167218646 19:48182746-48182768 CCGCACCGACCCCGAGGCCAAGG + Exonic
1168309219 19:55452225-55452247 GCGCTCCGACGCTGGGGGCCAGG + Intergenic
925180328 2:1813327-1813349 TGGGACCCAGGCTGAGGCCCAGG - Intronic
935619815 2:105119180-105119202 TCCCACGGACGCGGAGGGCCAGG - Intergenic
938115786 2:128602250-128602272 CAGCAGCGAGGCTGAGGCCCAGG + Intergenic
938322129 2:130372603-130372625 ACGCCCCGACGCTGATGTCCAGG + Intronic
946403986 2:219483322-219483344 TCCCACTGAGGATGAGGCCCTGG + Exonic
948790041 2:240372350-240372372 GCGCACCCACCCTGAGGCCTGGG + Intergenic
1172278202 20:33692379-33692401 TCCCACCTTCGCTGTGGCCCTGG - Intergenic
1175495770 20:59413204-59413226 TCCCACCCTCCCTGAGGCCCTGG + Intergenic
1176034325 20:63028973-63028995 ACACACAGACGCGGAGGCCCGGG - Intergenic
1176034411 20:63029221-63029243 ACACACAGACGCGGAGGCCCGGG - Intergenic
1176547725 21:8208785-8208807 TCTCCCCGACGCCGACGCCCGGG - Intergenic
1176555622 21:8252991-8253013 TCTCCCCGACGCCGACGCCCGGG - Intergenic
1176566670 21:8391828-8391850 TCTCCCCGACGCCGACGCCCGGG - Intergenic
1176574552 21:8436019-8436041 TCTCCCCGACGCCGACGCCCGGG - Intergenic
1176611164 21:8987311-8987333 TCTCCCCGACGCCGACGCCCGGG - Intergenic
1180163007 21:46006464-46006486 TCGCACTGCAGCTGCGGCCCTGG + Intergenic
1180866500 22:19122665-19122687 TGGCCCCGCCGCTCAGGCCCCGG - Intergenic
1181056930 22:20264764-20264786 TCCCGCAGACCCTGAGGCCCAGG + Intronic
1181108082 22:20586390-20586412 TCTCACTGACGATGAGGCTCTGG + Intronic
1181116474 22:20635181-20635203 TCACAGTGACCCTGAGGCCCAGG + Intergenic
1203252599 22_KI270733v1_random:125070-125092 TCTCCCCGACGCCGACGCCCGGG - Intergenic
1203260655 22_KI270733v1_random:170156-170178 TCTCCCCGACGCCGACGCCCGGG - Intergenic
953679492 3:45028874-45028896 TCTCACCCACCCTGAGGGCCAGG - Intronic
961440865 3:126952483-126952505 TCGCACACAGGCAGAGGCCCAGG + Intronic
968612037 4:1561697-1561719 TGGCCCAGACCCTGAGGCCCAGG - Intergenic
997795152 5:136802276-136802298 TCTCACCTACGCTGTGACCCTGG - Intergenic
999421431 5:151447863-151447885 TCGTACCGCAGCTGCGGCCCGGG - Intronic
1002068244 5:176663197-176663219 TCCCCCGGACGGTGAGGCCCTGG - Intergenic
1017978227 6:159376162-159376184 TCCCACCCATGCTGAGACCCCGG + Intergenic
1019449326 7:1088669-1088691 TCTCACCAACCCTGAAGCCCTGG + Intronic
1030614862 7:111728790-111728812 ACGCCCCGACGCGGAGGCCCCGG + Intronic
1034981979 7:155484875-155484897 TGGCTCCGTCGCGGAGGCCCGGG + Intronic
1040423485 8:47261204-47261226 CCGTACCGCCGCTGAGGGCCCGG - Intronic
1040501439 8:48008623-48008645 TGGGACCGGCGCCGAGGCCCCGG + Intronic
1040850900 8:51899327-51899349 TCGCACCGGCGCTGGGGTGCAGG + Intergenic
1046267260 8:111846773-111846795 TATCACAGACCCTGAGGCCCTGG - Intergenic
1055541079 9:77305728-77305750 TGGCACAGAAGATGAGGCCCAGG - Intronic
1056170484 9:83980277-83980299 TCGCACCATCGCTGAAGCCCTGG - Intronic
1061026114 9:128050878-128050900 TCCCACTGAGGCTGAGGCCAAGG - Intergenic
1061330363 9:129888685-129888707 GCGCAGAGACGCTGAGGCCCAGG - Exonic
1062546282 9:137065036-137065058 CCACACCCACGCTGGGGCCCAGG - Intronic
1203783898 EBV:116464-116486 TCCAGCCGGCGCTGAGGCCCTGG - Intergenic
1203469003 Un_GL000220v1:108221-108243 TCTCCCCGACGCCGACGCCCGGG - Intergenic
1203476824 Un_GL000220v1:152193-152215 TCTCCCCGACGCCGACGCCCGGG - Intergenic