ID: 1083610867

View in Genome Browser
Species Human (GRCh38)
Location 11:64003711-64003733
Sequence GGTTGGGCTCCCAACCTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 139}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083610866_1083610867 -9 Left 1083610866 11:64003697-64003719 CCACACGGCTGGAAGGTTGGGCT 0: 1
1: 0
2: 1
3: 8
4: 105
Right 1083610867 11:64003711-64003733 GGTTGGGCTCCCAACCTCAGTGG 0: 1
1: 0
2: 0
3: 2
4: 139
1083610865_1083610867 -8 Left 1083610865 11:64003696-64003718 CCCACACGGCTGGAAGGTTGGGC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1083610867 11:64003711-64003733 GGTTGGGCTCCCAACCTCAGTGG 0: 1
1: 0
2: 0
3: 2
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083610867 Original CRISPR GGTTGGGCTCCCAACCTCAG TGG Intronic
900078632 1:837934-837956 GATGGGGCTCCCACCCTCTGAGG - Intergenic
901527152 1:9830811-9830833 TCTTGAACTCCCAACCTCAGGGG + Intergenic
901629245 1:10640298-10640320 GGTTGGGCTGCCACCCCCCGGGG - Intronic
902236892 1:15063429-15063451 GGGTGGGCTCCCCACTGCAGAGG + Intronic
903102166 1:21040160-21040182 AGTCGGACCCCCAACCTCAGGGG + Intronic
903545557 1:24121441-24121463 GGATGGGGGCCCGACCTCAGGGG + Exonic
903673852 1:25052320-25052342 GTTGGGGCTCCCAGGCTCAGGGG - Intergenic
903835745 1:26202319-26202341 CCCTGGGCTCCCAAACTCAGAGG + Intronic
904287734 1:29462790-29462812 TCTTGGGGTCCCAACCTGAGAGG - Intergenic
904347564 1:29883178-29883200 GGTTCAGCTGCCAACCCCAGTGG - Intergenic
906126828 1:43432046-43432068 AGTTGGGCTGCCAAGCACAGGGG - Intronic
919743010 1:200991871-200991893 GGTTGAGCTCCCCTCCCCAGAGG + Intronic
920004930 1:202826106-202826128 AGCTGGGCTACCAACCTGAGGGG + Exonic
923564921 1:235069573-235069595 TTTTGGGCTCCCCTCCTCAGGGG - Intergenic
1064277056 10:13915859-13915881 GGTTGGCCTCCTGACCTCTGAGG + Intronic
1064578023 10:16765818-16765840 GGTTGGTCTCCCAGCCTCCTGGG - Intronic
1065902969 10:30224557-30224579 GGTGGGGCTCCTGCCCTCAGAGG - Intergenic
1071307541 10:84312522-84312544 TCTTGAACTCCCAACCTCAGGGG - Intergenic
1074313345 10:112341244-112341266 GGCTGGGCTCCTAACCACTGGGG + Intergenic
1074656614 10:115596322-115596344 TCTTGAGCTCCCAACCTCAAGGG + Intronic
1075565473 10:123500556-123500578 GGTTGGGCTCTCAACATGAAAGG - Intergenic
1075630114 10:123995593-123995615 GGTTGGGCTCCCGGCCGCGGAGG - Intergenic
1083610867 11:64003711-64003733 GGTTGGGCTCCCAACCTCAGTGG + Intronic
1083767513 11:64848932-64848954 GTCTGGGCTCCCAGCCACAGAGG - Intergenic
1083887012 11:65577810-65577832 TGTTTGGCTCCAAACCTCTGTGG + Intronic
1085198127 11:74684309-74684331 TGTAAGGATCCCAACCTCAGTGG - Intergenic
1088814231 11:113410486-113410508 GGCTGGGCCCCCCAGCTCAGGGG - Exonic
1089257493 11:117201581-117201603 GGTTATGTTACCAACCTCAGAGG - Intronic
1089665220 11:120013870-120013892 GGCTGGGCTGCCCCCCTCAGTGG - Intergenic
1091008272 11:131973933-131973955 AGTTGGTCTTCCAGCCTCAGGGG - Intronic
1093596896 12:20972911-20972933 GGTTGGGCTCCCAAGGACGGTGG - Intergenic
1101482116 12:105108029-105108051 GGTTGGGGTCCCAGCCACGGCGG + Intronic
1102351835 12:112198377-112198399 GGAGGGGCTGCCAAGCTCAGAGG + Intronic
1102877400 12:116458852-116458874 CCTTGGGCTCCCCACCTCCGGGG + Intergenic
1103970107 12:124665317-124665339 GATTCGACTCCCAATCTCAGGGG + Intergenic
1108392382 13:49958946-49958968 GGTTTTGCTCCCAACCTCTCTGG - Intergenic
1111283872 13:86063433-86063455 AGTTAGGCTCCCAAGCTCACAGG - Intergenic
1112722478 13:102260308-102260330 GGTTGGGTTTCCAAGATCAGTGG - Intronic
1112879855 13:104093698-104093720 GGATAGACTCCCAACCTGAGAGG + Intergenic
1114160176 14:20156972-20156994 GGTTGAGCTCCAACTCTCAGTGG - Intergenic
1117340666 14:54788813-54788835 GGTGGGCCTCCCAGCCTCTGAGG - Intronic
1118576032 14:67241709-67241731 GGTTGGGCTCACACCCTCCACGG - Intronic
1119859493 14:77925954-77925976 GGAGGGGCCCCCTACCTCAGTGG - Exonic
1121180714 14:91926422-91926444 CGTTGGGCTGCCATCCTCTGTGG - Intronic
1121232296 14:92366621-92366643 TTCTGGGCTCCAAACCTCAGCGG - Intronic
1122144182 14:99679337-99679359 GGCTGTGCCCCCATCCTCAGAGG - Exonic
1122803517 14:104244968-104244990 TGTTGGGCTCCCAGCCTCTTGGG + Intergenic
1129456146 15:75677061-75677083 GGCTGGACCCCAAACCTCAGAGG - Exonic
1136307503 16:29382252-29382274 GGTTCCGCTTCCACCCTCAGCGG - Exonic
1136581773 16:31156315-31156337 TCTTGAACTCCCAACCTCAGGGG - Intergenic
1138448834 16:57081069-57081091 GGTAGGGGTCCCAAAGTCAGCGG - Intronic
1140462182 16:75148717-75148739 GTTTGGGCTCCCACCCTGCGCGG - Intronic
1147777180 17:42910620-42910642 GGGTGAGCTCCCTACCTCTGAGG + Intronic
1148461700 17:47842718-47842740 TCTTGAACTCCCAACCTCAGGGG - Intergenic
1152181102 17:78822388-78822410 GGGTGGGCGCCCTAGCTCAGGGG - Intronic
1152792406 17:82288620-82288642 GGTTAGGCTCCCCTCCTTAGGGG - Intergenic
1153971779 18:10233809-10233831 GGATTGGCTGCAAACCTCAGTGG + Intergenic
1157424208 18:47570999-47571021 GTCTGGCCTCCCTACCTCAGTGG - Intergenic
1158129791 18:54139924-54139946 GGGTGGGCTCCCAAGGTCTGGGG - Intergenic
1158759636 18:60369279-60369301 GGTGGGGCTCCAAATCTCACTGG + Intergenic
1160505128 18:79422696-79422718 CGTTGGGAACCCAAGCTCAGTGG - Intronic
1160872337 19:1282996-1283018 GGTGGGGCTCCCGCCCTGAGTGG + Intergenic
1161687805 19:5712034-5712056 GGTCCAGCTCCCAGCCTCAGCGG - Intronic
1163693262 19:18749203-18749225 GGTTGGCTTCCCAACCACGGGGG + Intronic
1163767537 19:19171836-19171858 GGCTGGTCCCCCAAACTCAGGGG + Intronic
1164144490 19:22503559-22503581 TGTTGGCCTCCCAAGCCCAGGGG - Intronic
1164189347 19:22900743-22900765 GGATCCGCTCCCAACTTCAGTGG + Intergenic
1164939687 19:32243123-32243145 CCTTGGTCTCCCAGCCTCAGAGG - Intergenic
1167037782 19:47004207-47004229 GGGTGGGCTCCCTCCCTCGGAGG + Exonic
1168141145 19:54388179-54388201 GGCTGGGCTCCCATCCTCGCAGG + Intergenic
925969826 2:9098552-9098574 GGTTTGGGGCCCACCCTCAGTGG - Intergenic
927503675 2:23599107-23599129 GGTAGGTTTCTCAACCTCAGAGG + Intronic
927833569 2:26372327-26372349 TCTTGGACTCCTAACCTCAGGGG + Intronic
935544627 2:104387603-104387625 TGTTGGGCTCTCACCCTCTGGGG - Intergenic
939567466 2:143801504-143801526 TCTTGAACTCCCAACCTCAGGGG + Intergenic
941488047 2:166106381-166106403 GGTTGGGGTCCAAACTTCATTGG + Intronic
944191875 2:197011792-197011814 AGTTTGGCTACCAACTTCAGGGG - Intronic
944723397 2:202446180-202446202 TCTTGAACTCCCAACCTCAGGGG - Intronic
1175350310 20:58313393-58313415 GGTGGGGCTCCAGAGCTCAGGGG - Intronic
1175498833 20:59434751-59434773 GGTTGGGCTTCCACCCTCACAGG - Intergenic
1176114960 20:63428171-63428193 GTCTGGGCTCCCACCCCCAGAGG - Intronic
1178584769 21:33862682-33862704 GGTTGGGACCACAGCCTCAGAGG - Intronic
1181369836 22:22407057-22407079 TGTTGGCCTCCTAAGCTCAGAGG + Intergenic
1183309711 22:37102840-37102862 GGGTTGGCTCCAAGCCTCAGGGG + Intronic
1183377305 22:37472655-37472677 GGGTGGGCTCCCACCACCAGCGG - Intronic
1183770883 22:39924802-39924824 GGCTGGGTTCCCATCCTCTGGGG + Intronic
954711699 3:52508103-52508125 GAGTGGGCTCCCTCCCTCAGAGG + Intronic
956729279 3:72182113-72182135 GAGTGGGCTCCAATCCTCAGAGG - Intergenic
961530475 3:127537203-127537225 GGTTGGGCTCACAGACACAGTGG + Intergenic
962267418 3:133953816-133953838 CCTTGGGCTCCCAAGCTGAGGGG + Intronic
964628119 3:158778517-158778539 CTTTGGCCTCCCAATCTCAGTGG + Intronic
966119107 3:176502450-176502472 TCTTGAACTCCCAACCTCAGGGG + Intergenic
969850394 4:9952043-9952065 GGTTCAGGACCCAACCTCAGAGG - Intronic
970602955 4:17654718-17654740 AGTTGGCCTCCCAAACCCAGCGG + Intronic
972054289 4:34780526-34780548 GGTTGGGCTCCCACCATCTTAGG + Intergenic
974742831 4:66029439-66029461 TCTTGAGCTCCTAACCTCAGGGG - Intergenic
975909713 4:79252429-79252451 GGTTGAGCTCCCATTCTCATAGG + Intronic
979524362 4:121701844-121701866 GGTGGGGCTGCCTTCCTCAGTGG + Intergenic
981226454 4:142300218-142300240 GCCTGGCCTCCCAACCTGAGAGG + Intronic
982046968 4:151457764-151457786 GGTGGGGATCACAAACTCAGAGG + Intronic
985527568 5:414997-415019 GGTCTGGCTCTCAGCCTCAGTGG - Intronic
991499816 5:67266014-67266036 GTTTGGCCTCCCATCCTCTGTGG + Intergenic
997251804 5:132394409-132394431 GGATGGGCACCCACACTCAGAGG + Exonic
999378152 5:151101305-151101327 GGTTGGGCTCTTATCTTCAGTGG - Exonic
1001231760 5:169994744-169994766 GGTTGGGGTCCCATCATGAGGGG + Intronic
1002647846 5:180669977-180669999 GGATGGGCTCCTATCCCCAGGGG - Intergenic
1003599277 6:7502683-7502705 GGCTGGGCTCCCTGCTTCAGGGG + Intergenic
1005832342 6:29680925-29680947 GGAGGGGCTTCCAACCTCTGGGG - Intronic
1007843785 6:44737789-44737811 GCTTGGGCTTCCAAACTCAATGG + Intergenic
1008124043 6:47648924-47648946 GGTTGGCCTTCCTATCTCAGGGG - Intergenic
1009543491 6:64996163-64996185 GGTTGGGCAGGCAACCTGAGAGG + Intronic
1012225802 6:96702134-96702156 AGTTGAACTCCCAACCTCACAGG + Intergenic
1012277515 6:97292117-97292139 GGTCTGGCTCCCTGCCTCAGGGG - Intergenic
1015178045 6:130332626-130332648 TTTTGTGCTCTCAACCTCAGTGG + Intronic
1015293311 6:131562133-131562155 GTTTGTGCTCCCAGCTTCAGTGG - Intergenic
1017161710 6:151371619-151371641 GGTTGGGCTCCAAGCCTGTGGGG + Intronic
1017330942 6:153197777-153197799 TCTTGAACTCCCAACCTCAGGGG + Intergenic
1017639648 6:156479723-156479745 CCTTGAACTCCCAACCTCAGGGG - Intergenic
1019622720 7:2000456-2000478 GGTTGGACTACCAACCACCGCGG + Intronic
1021253292 7:18358308-18358330 GTTTGTGCTCCCAACATCAGTGG - Intronic
1024749675 7:52450738-52450760 GGTTGGTCTCACTATCTCAGAGG + Intergenic
1029657753 7:101938315-101938337 GGTTGGTCTCTCAAACTCTGGGG + Intronic
1034952052 7:155305223-155305245 GGTTAGGCTTAGAACCTCAGAGG - Intronic
1035527012 8:321811-321833 GATGGGGCTCCCACCCTCTGAGG + Intergenic
1036018723 8:4816889-4816911 TGTTATGCTCCAAACCTCAGAGG - Intronic
1042548237 8:69970306-69970328 TCTTGAACTCCCAACCTCAGGGG - Intergenic
1045332169 8:101164845-101164867 TCTTGACCTCCCAACCTCAGGGG + Intergenic
1047200404 8:122760456-122760478 GGCTGGGCTTGAAACCTCAGAGG + Intergenic
1052945282 9:34163459-34163481 GTTTGGGCCCCCAAACGCAGTGG - Intergenic
1057958908 9:99436144-99436166 GTTAAGGCTCCCAACCACAGGGG - Intergenic
1059182883 9:112236011-112236033 GGTTGGACTGCAAACCTCAAAGG + Intronic
1062316640 9:135970565-135970587 GGTGGTGCTCCCATCCTGAGAGG - Intergenic
1062550740 9:137085268-137085290 GGTTGGACTCCTGAGCTCAGGGG + Intergenic
1203377692 Un_KI270442v1:390078-390100 GGTTTGGCTCACACCCTCTGAGG - Intergenic
1185810855 X:3109099-3109121 TCTTGAACTCCCAACCTCAGGGG - Intronic
1192080183 X:68040258-68040280 CCTTGTGCTCCCTACCTCAGGGG + Intergenic
1193141012 X:78026928-78026950 TCTTGAACTCCCAACCTCAGGGG - Intronic
1194133165 X:90106630-90106652 GGCTTGGCTCCCAACCATAGAGG - Intergenic
1197685844 X:129438730-129438752 GGTTGGGCTCAGCACCTCATGGG - Intergenic
1197763383 X:130043348-130043370 TGTTGTGCAGCCAACCTCAGGGG + Intronic
1199289559 X:146090692-146090714 GGTTGGGCTCCCAAGGTCTTGGG - Intergenic
1200478952 Y:3676705-3676727 GGCTTGGCTCCCAACCATAGAGG - Intergenic