ID: 1083610963

View in Genome Browser
Species Human (GRCh38)
Location 11:64004104-64004126
Sequence AGCAGGGAGATGCCTAAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083610963_1083610968 13 Left 1083610963 11:64004104-64004126 CCCATCTTAGGCATCTCCCTGCT 0: 1
1: 0
2: 0
3: 14
4: 165
Right 1083610968 11:64004140-64004162 GCCCTGCCTTCCAGCCTCCACGG 0: 1
1: 1
2: 6
3: 89
4: 554

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083610963 Original CRISPR AGCAGGGAGATGCCTAAGAT GGG (reversed) Intronic
900373183 1:2341328-2341350 AGCAGGGTGATGCCCAGGAAGGG - Intronic
900894462 1:5473623-5473645 AGCAGGGAGCAGCAAAAGATTGG + Intergenic
900971267 1:5993455-5993477 AGGAGGGAGAAGCTTAAGATAGG - Intronic
902039557 1:13482979-13483001 AGCAGGGAAATGCCAGAGCTGGG + Intronic
903311946 1:22465652-22465674 AGCAGGGAGAAGCCAAACAGTGG + Intronic
904700404 1:32354535-32354557 AACTGGGAGATGGCTAAGCTGGG - Intronic
905492440 1:38355053-38355075 TGCAGGGAGATGACAATGATAGG + Intergenic
907119248 1:51994008-51994030 AGCAGTGGGATACCTAAAATGGG + Intergenic
907330105 1:53665159-53665181 AGCAGGGAAATGACAAAAATGGG + Intronic
908570565 1:65405981-65406003 AGCAGGGAGGTGCCTACAACTGG + Exonic
910769382 1:90815682-90815704 AGGAGGGAAATGGCTAAGATGGG - Intergenic
911145561 1:94549289-94549311 AGCTGGGAAATGGCTAAGCTGGG + Intergenic
912702610 1:111889295-111889317 AGCAGGGAGGAGACCAAGATGGG + Intronic
912836124 1:112998034-112998056 AGCAGGGAGATGGCCAAAATAGG - Intergenic
914896280 1:151676964-151676986 AGCAGAGAGATGCTAAACATAGG - Intronic
915935588 1:160088522-160088544 AGCGGGGAGGTGCCTGAGCTGGG + Exonic
919832478 1:201551977-201551999 AGTGGGGAGATGACTAAGAGGGG - Intergenic
920038081 1:203078271-203078293 ATGATGGAGATTCCTAAGATTGG + Exonic
920304554 1:205010203-205010225 AGCAGGGAGAGGCTGAAGATGGG + Intronic
923680204 1:236112608-236112630 TGCATGGAGCTGCTTAAGATTGG - Intergenic
924383949 1:243486333-243486355 AGAAGTGAGATCCCTAAGAAGGG - Intronic
1063014188 10:2058499-2058521 AGCGGAGAGAGGTCTAAGATTGG + Intergenic
1066013403 10:31214854-31214876 AGCAGGATGAGGCCTAAAATAGG - Intergenic
1067183372 10:44006954-44006976 AGCAGGGAGGTGCCTTAAGTGGG - Intergenic
1068929603 10:62575855-62575877 AGCACGGATATGCCTAAGCCTGG - Intronic
1069540710 10:69291918-69291940 AGCAGGGAGTTGGCTATCATGGG + Intronic
1072838873 10:98747716-98747738 AGCAGTGAGATGCCAAAAAATGG - Intronic
1074935221 10:118171763-118171785 AGCAGGGAGATGCCTACAAAGGG + Intergenic
1076114236 10:127884375-127884397 AGCAGAGAAAAGCCTAAGAAAGG + Intronic
1076280537 10:129242608-129242630 AGCAGGGAGTTTCCTCAGCTCGG + Intergenic
1076326377 10:129626538-129626560 TGCAGGGAGACGCCTGAGCTGGG + Intronic
1076760799 10:132605090-132605112 AGCAGGGAGATCCCTGAGGAGGG + Intronic
1078639687 11:13083061-13083083 AGCATGGAGATGCCCAAGTTGGG + Intergenic
1080155333 11:29104329-29104351 AGCAAGGAGATCCCTAAGTAAGG - Intergenic
1081202831 11:40238773-40238795 AGCAGGTATATGAATAAGATAGG - Intronic
1083610963 11:64004104-64004126 AGCAGGGAGATGCCTAAGATGGG - Intronic
1083713435 11:64562407-64562429 ATCAGGGAGATGGCAAAGAAGGG - Exonic
1084627636 11:70320774-70320796 AGCAGAGAATTGCCTTAGATGGG - Intronic
1085403815 11:76249978-76250000 AGCATGGGGATGCCTAGGCTGGG - Intergenic
1085798999 11:79570249-79570271 AACAGGAAGTTGCCTAAGAGAGG - Intergenic
1087407950 11:97752780-97752802 AGCAGGGAGAGGCCAGGGATGGG + Intergenic
1087442972 11:98208620-98208642 AGCAGGGAGAGGCCAAGGAGTGG + Intergenic
1088156459 11:106810293-106810315 AGCAGGCAAAGGCCCAAGATGGG - Exonic
1089260626 11:117221581-117221603 AGCAAGGACATTCCAAAGATGGG + Intronic
1089398727 11:118152526-118152548 AGAAGGAAGATGCCTTGGATGGG - Intronic
1092523378 12:9294856-9294878 AGCAGGGAGATGCTAGAGACAGG + Intergenic
1092543916 12:9437043-9437065 AGCAGGGAGATGCTAGAGACAGG - Intergenic
1094509030 12:31085008-31085030 AGCAGGGAGATGCTAGAGACAGG + Exonic
1095232995 12:39764194-39764216 AGCTGGGAGATGTCTGAGTTGGG + Intronic
1096761005 12:53841967-53841989 AGGAGGGAGATGTGAAAGATGGG - Intergenic
1096971006 12:55666360-55666382 GGCAGGGAGATACCTGAGGTTGG + Intergenic
1101715581 12:107309223-107309245 AGCAGGAAGAAGCCTATGTTGGG - Intergenic
1101973752 12:109336899-109336921 AGCATGGAGTTGTCTAACATGGG + Intergenic
1104054067 12:125216018-125216040 AGCAGAGAGATTCTTAAGAAGGG - Intronic
1104479251 12:129093136-129093158 TGCAGGGACATGCCACAGATGGG + Intronic
1105735757 13:23268607-23268629 AGGAGGGAGATGCCCATGGTGGG + Intronic
1106557121 13:30819170-30819192 AAGAGGGAGATGCCTGAGACAGG - Intergenic
1110014805 13:70386986-70387008 AGCAGGGAGAGGCCAATGAGTGG + Intergenic
1110439200 13:75508276-75508298 AGCAGGGAGAGGCCAAACAGTGG + Intergenic
1111474247 13:88725130-88725152 AGCACAGAGATGCCTGAGTTTGG - Intergenic
1115893030 14:38053554-38053576 AGCAGGGAGGTCTCTAAGAGGGG + Intergenic
1116961568 14:50973120-50973142 AGCAGGGAGAGGCCAAGGAGCGG - Intergenic
1117206174 14:53445917-53445939 AGCTGGGAGCTGACTAGGATAGG + Intergenic
1118922482 14:70162224-70162246 AAAATGGAGAAGCCTAAGATGGG + Intronic
1119925422 14:78488981-78489003 AGCTGGGAGTTTCCTAAGAGAGG - Intronic
1131428695 15:92368671-92368693 TGCAGGGAGATGACGAAGGTGGG - Intergenic
1131664002 15:94550289-94550311 AGCAGGGAGACTTCTGAGATGGG + Intergenic
1132322102 15:100933063-100933085 AGCAAGAAAATGCCTAAGAAAGG + Intronic
1133225580 16:4338855-4338877 AGCAGGGAGAGGCCCCAGATGGG - Exonic
1135355656 16:21767034-21767056 GGCAGGGAGAAGACGAAGATGGG - Intergenic
1135454145 16:22583179-22583201 GGCAGGGAGAAGACGAAGATGGG - Intergenic
1136232102 16:28892591-28892613 AGAAGAGAGATGGTTAAGATGGG - Intronic
1137555210 16:49466025-49466047 AGCAGGGAGGTGGCGAAGCTAGG - Intergenic
1138529504 16:57627421-57627443 AGCAGGGAGGTGCCCGAGTTGGG - Intronic
1142048137 16:87939194-87939216 AGCAGGGAGATGAGGAAGACAGG - Intergenic
1143073121 17:4315141-4315163 ATTAGGGAGAGGGCTAAGATAGG + Intronic
1144580981 17:16459432-16459454 AGCAGCGACGTCCCTAAGATAGG + Intronic
1145834057 17:27940400-27940422 AGCATGAAGCTGCCTCAGATGGG + Intergenic
1146003197 17:29143919-29143941 AGCATGGTGGTGCCTAAGAGGGG - Intronic
1146656619 17:34638517-34638539 GGCAGGGGGTTGCTTAAGATGGG - Exonic
1151169998 17:72237783-72237805 AACAGGGGGATGCCCAAGCTTGG + Intergenic
1151443404 17:74148180-74148202 AGCAGGGAGAGGCTCAGGATGGG - Intergenic
1151952852 17:77364714-77364736 AGCGGGGAGATGCCCAACATTGG - Intronic
1154121206 18:11654069-11654091 AGCAGGGAGGTGCTTTAGACGGG - Intergenic
1154433242 18:14324466-14324488 AGCAAGGAGATGTCTCATATCGG - Intergenic
1156083031 18:33363356-33363378 AGCAGGAAGAAGTCTGAGATAGG + Intronic
1156967117 18:43107711-43107733 AGCATGGAGGTGCCAAAGACTGG - Intronic
1159026468 18:63187015-63187037 AACAGGGAAATGCTTAAGGTTGG - Intronic
1159375629 18:67588874-67588896 AGCTAGGAGATGCCAAAGATTGG - Intergenic
1159529474 18:69637089-69637111 AGCAGGGAGCTCCCCAAGCTTGG + Intronic
1160418946 18:78731265-78731287 AGCACGGAGATGATCAAGATGGG - Intergenic
1160538420 18:79607511-79607533 GCCAGGGAGATGCCTTAGAAAGG + Intergenic
1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG + Intronic
1162238731 19:9329889-9329911 AACAGGGAGATGCCAAGGTTAGG - Intronic
1168400446 19:56083200-56083222 GGCAGGCAGATCCCTAAGGTTGG - Intergenic
927934932 2:27071078-27071100 AGTAGGTAGATGCCCAAGTTGGG - Intronic
927966976 2:27276422-27276444 AGCAGGGAGAGGTCTAAGCCAGG - Intronic
930381693 2:50637781-50637803 AGCAGGGACATGCCAGAGAATGG + Intronic
931117177 2:59177528-59177550 TGCAGGGAAATATCTAAGATTGG - Intergenic
931218055 2:60264429-60264451 AGCAGGGAGAGGCAGCAGATGGG - Intergenic
935055074 2:99558674-99558696 GGCAGGGAGATACATTAGATGGG + Intronic
935361666 2:102250953-102250975 GGCAGGGCGATGCCCAAGACGGG + Intergenic
936597149 2:113858953-113858975 AGCAAGAAGATGACTCAGATTGG + Intergenic
937993137 2:127675126-127675148 AGCAGGGAGACGCCCAAAAAAGG + Intronic
938758873 2:134405796-134405818 AGCAGAGGGTTTCCTAAGATTGG - Intronic
939933138 2:148257310-148257332 AGCAGGGAGCTACCTGGGATTGG - Intronic
941541943 2:166797011-166797033 AACAGGAAGAAGCCTAAAATTGG - Intergenic
943820320 2:192314109-192314131 ACCAGGGAGATCCCTGAGACAGG - Intergenic
945969333 2:216220854-216220876 AGCAGTTAGATGACAAAGATAGG + Intergenic
946495733 2:220193402-220193424 AGCAGGGAGAGGCCGGAGAGTGG + Intergenic
1172753427 20:37267272-37267294 AGTAGGGAGAAGCTTAAAATGGG + Intergenic
1172874864 20:38158080-38158102 AGCAGGGACATTTCTGAGATTGG - Intronic
1173613806 20:44389823-44389845 CGGAGGAAGATGACTAAGATGGG + Intronic
1175199866 20:57269483-57269505 ATCTGGGAGATGCCTTAGCTTGG - Intergenic
1179536388 21:42055474-42055496 AGCAGGGAGAGACCCCAGATGGG - Intergenic
951287878 3:20837239-20837261 AGCAGGAAAATGTGTAAGATGGG - Intergenic
951445272 3:22772405-22772427 AGGATGGTGATGCCTAAGCTTGG + Intergenic
953499773 3:43421979-43422001 TGCAGGTAAATGCCTAGGATTGG - Intronic
953565259 3:44026929-44026951 AGCAGGGAGATGGAGAAGAAGGG - Intergenic
954081450 3:48214413-48214435 AGCAAGGAGATGCCCCAGGTTGG + Intergenic
957686049 3:83503988-83504010 AGAAGGGAGCTGCCTGAGATTGG - Intergenic
958161299 3:89819049-89819071 AACAGGGAGATGCCAGAGAATGG + Intergenic
960773297 3:121218642-121218664 GGCAAGGAGATGCCTGAGATGGG + Intronic
962898182 3:139734712-139734734 AACAGGGAGATAAATAAGATGGG + Intergenic
964465846 3:156991195-156991217 AGCGGGGAGTTGGCTATGATTGG + Intronic
964809710 3:160650881-160650903 AGGTGGGAGAGGCCTAAGCTAGG + Intergenic
965972618 3:174580835-174580857 CTCAGGGAGATACCTAAGAGTGG + Intronic
967818291 3:193817075-193817097 AGCAGGCAGCTGCCTAATCTGGG + Intergenic
969859722 4:10026147-10026169 AGCAGGGAGATGCCCAAGCGAGG - Intronic
970006290 4:11414005-11414027 AGCAGGAGGATGCATGAGATAGG + Intronic
970232281 4:13923020-13923042 AGCCAGGAGATGCCAAGGATAGG - Intergenic
978257012 4:106704511-106704533 AACTTAGAGATGCCTAAGATTGG + Intergenic
978542025 4:109827475-109827497 AGCAGAGAAAAGCCTAAGAAAGG + Intergenic
979434266 4:120670588-120670610 AGTCTTGAGATGCCTAAGATGGG - Intergenic
979547724 4:121956311-121956333 AGTAGAGAGATGCCAAAGAAAGG - Intergenic
980137417 4:128872015-128872037 AGCAGGGAGAGGCCCACGATGGG + Exonic
980916600 4:139039087-139039109 AGCACTGAGATGGCTGAGATGGG + Intronic
984138573 4:175973713-175973735 AGCAGTGAAATGGCTAAGAAGGG + Intronic
985766665 5:1783627-1783649 AGCAGGGAGATGTTTAAGGAAGG + Intergenic
987369547 5:17180590-17180612 AGGAGAGAGATGCCCAAGAGAGG + Intronic
988051055 5:26031596-26031618 TGCAGGGAGATGCCGAGGGTTGG - Intergenic
989096699 5:37788499-37788521 AGTTGAGAGATGCTTAAGATGGG - Intergenic
989134720 5:38142360-38142382 GGCAGGCAGATGCCTGAGCTCGG + Intergenic
994985101 5:106923001-106923023 AGGAGAGAGATGCCAGAGATAGG + Intergenic
996447864 5:123577868-123577890 AGGAGGGGAATGACTAAGATGGG - Intronic
1007241324 6:40427766-40427788 GACAGAGAGATGCCTAAGACAGG - Intronic
1011141310 6:84160445-84160467 AGGAGGGAGATCCCTGAGTTGGG - Intronic
1016487736 6:144561646-144561668 AGAAGGCAAGTGCCTAAGATGGG - Intronic
1017610866 6:156184893-156184915 ATAAAGGAGATGCCTCAGATTGG - Intergenic
1018390567 6:163338009-163338031 CTCAGGGAGATGCCCAAGAGGGG - Intergenic
1021922102 7:25495692-25495714 AGCAGGGAGATGGGCAATATAGG + Intergenic
1023752587 7:43386322-43386344 AGCAGGCAGAATTCTAAGATGGG - Intronic
1025974646 7:66359917-66359939 AGAAGGGAAATTCCTAGGATTGG + Exonic
1026186462 7:68085485-68085507 AGTTTGGAGATGCCCAAGATCGG - Intergenic
1033477868 7:141708127-141708149 AGGAGGGAGATGCCTGAATTAGG + Intergenic
1035025400 7:155821701-155821723 AGCAGTGAGATGCCCAAGGCAGG - Intergenic
1037469362 8:19192078-19192100 AGCAGGGAGAGGCAGAAAATTGG + Intergenic
1037881555 8:22575749-22575771 AGCAGGGAGACACCAGAGATGGG + Exonic
1039056466 8:33540932-33540954 ACCAGAGAGGTGCCGAAGATGGG + Intergenic
1048877887 8:138851263-138851285 AGCAGGGAAAAGCCTAAGCCTGG + Intronic
1049360527 8:142210611-142210633 TGCAGGGAGATGCCTGAGCCAGG - Intergenic
1053016235 9:34663846-34663868 AGCTGGGAGCTGCCTAGGGTGGG + Intronic
1054744168 9:68837300-68837322 AGCGGGGGGACGTCTAAGATGGG - Intronic
1054976361 9:71150456-71150478 ACCAGGGAATTACCTAAGATTGG - Intronic
1055441843 9:76344311-76344333 AGCATGGAGAGGCATCAGATGGG - Intronic
1055971648 9:81917961-81917983 CTCAGGGAGATTCCAAAGATGGG + Intergenic
1055973401 9:81933033-81933055 CTCAGGGAGATTCCAAAGATGGG + Intergenic
1055975155 9:81948125-81948147 CTCAGGGAGATTCCAAAGATGGG + Intergenic
1055980187 9:81993325-81993347 CTCAGGGAGATTCCAAAGATGGG + Exonic
1056374170 9:85990837-85990859 AGCAGGGTGAGGCCTAGCATGGG + Intronic
1060064371 9:120490302-120490324 AGCAGTGAGATGCCTCAGAGAGG - Intronic
1060186468 9:121566934-121566956 GGCAGCGAGATGTCTAAAATAGG - Intergenic
1187841375 X:23492472-23492494 AGCAGGGAGATGGGGAATATAGG + Intergenic
1192056812 X:67781629-67781651 AGCAGGGAGCTGCAAAAGAAGGG - Intergenic
1195445222 X:104945026-104945048 AGCAGGCAGAGGACCAAGATTGG - Intronic
1196844379 X:119887002-119887024 TCCAGGGAGATGCCCTAGATAGG - Intergenic
1198061838 X:133053718-133053740 AGCAGGGAGATCTCTTAGGTTGG + Intronic
1198110291 X:133497070-133497092 AGCAGTTAGATGCCTAATGTAGG - Intergenic
1200150731 X:153950131-153950153 AGCAGGGAGACGCCGCACATGGG + Intronic
1201511080 Y:14763821-14763843 AGCATGGAGATGCCAAACAAAGG - Intronic