ID: 1083615165

View in Genome Browser
Species Human (GRCh38)
Location 11:64022465-64022487
Sequence CGCTCCCCTAAGCCCCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 124}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083615165_1083615174 26 Left 1083615165 11:64022465-64022487 CCCACAGGGGGCTTAGGGGAGCG 0: 1
1: 0
2: 1
3: 7
4: 124
Right 1083615174 11:64022514-64022536 CACTTCCTGCAGGCCAGCGGTGG 0: 1
1: 0
2: 1
3: 25
4: 211
1083615165_1083615168 -9 Left 1083615165 11:64022465-64022487 CCCACAGGGGGCTTAGGGGAGCG 0: 1
1: 0
2: 1
3: 7
4: 124
Right 1083615168 11:64022479-64022501 AGGGGAGCGGAGTTTGTTCTTGG 0: 1
1: 0
2: 0
3: 18
4: 151
1083615165_1083615169 16 Left 1083615165 11:64022465-64022487 CCCACAGGGGGCTTAGGGGAGCG 0: 1
1: 0
2: 1
3: 7
4: 124
Right 1083615169 11:64022504-64022526 ATCGATGCCCCACTTCCTGCAGG 0: 1
1: 0
2: 0
3: 7
4: 77
1083615165_1083615171 23 Left 1083615165 11:64022465-64022487 CCCACAGGGGGCTTAGGGGAGCG 0: 1
1: 0
2: 1
3: 7
4: 124
Right 1083615171 11:64022511-64022533 CCCCACTTCCTGCAGGCCAGCGG 0: 1
1: 1
2: 5
3: 41
4: 356
1083615165_1083615175 27 Left 1083615165 11:64022465-64022487 CCCACAGGGGGCTTAGGGGAGCG 0: 1
1: 0
2: 1
3: 7
4: 124
Right 1083615175 11:64022515-64022537 ACTTCCTGCAGGCCAGCGGTGGG 0: 1
1: 0
2: 1
3: 14
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083615165 Original CRISPR CGCTCCCCTAAGCCCCCTGT GGG (reversed) Intronic
900095121 1:937131-937153 CGCTCCCCGGAGCCTCCTCTTGG + Intronic
900274722 1:1817107-1817129 CTCTCCCCTAACACCCCTGCTGG + Intronic
900488220 1:2933539-2933561 TGCTCCCCGCAGACCCCTGTAGG + Intergenic
902499925 1:16903928-16903950 CCCTCCCCTGACCCCCGTGTGGG + Intronic
903534862 1:24060234-24060256 GGCGCCCCTCAGCCCCCTGCAGG + Intronic
905377673 1:37534787-37534809 CCCTCCCCTAAGTCCTCTGTGGG - Exonic
905404123 1:37721830-37721852 AGCTCCCCAAACCGCCCTGTGGG + Exonic
909384042 1:75035541-75035563 AGGCCCCCTAAGCCCCATGTGGG - Intergenic
913397309 1:118386209-118386231 CCTTTCCCTAAACCCCCTGTTGG - Intergenic
916682318 1:167115848-167115870 CCCTCCTCTAACCCCCCTGAGGG - Intronic
924607975 1:245551576-245551598 AGCACCTCTGAGCCCCCTGTAGG - Intronic
1064553092 10:16521677-16521699 CGCACCCCAAAGCCCCGCGTGGG + Exonic
1073073708 10:100810322-100810344 GGCTCTCCTAAGCCCCCAGGTGG - Intronic
1073773293 10:106759080-106759102 CACTGCCCTAAAACCCCTGTGGG - Intronic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1078406053 11:11070935-11070957 GGCTCCCCAAAGAGCCCTGTGGG + Intergenic
1083615165 11:64022465-64022487 CGCTCCCCTAAGCCCCCTGTGGG - Intronic
1084336628 11:68461241-68461263 CGCTCCCCGAGGCCCCCGGGAGG - Intronic
1086033170 11:82384423-82384445 AGTTCCCCTAGGCCCCATGTGGG - Intergenic
1096397191 12:51275246-51275268 CCCTCCCCTAAGGCCCCTTGAGG - Intergenic
1096571277 12:52524658-52524680 TGCTCCCCACAGCCCCCTGCAGG - Intergenic
1096678739 12:53241115-53241137 TGCTTCCCTGAGTCCCCTGTGGG + Intergenic
1102561790 12:113767426-113767448 CAGTGCCTTAAGCCCCCTGTGGG + Intergenic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1122022849 14:98853777-98853799 CGCTCCCAAAAGCTCCATGTGGG - Intergenic
1122789201 14:104177253-104177275 GGGGCCCCCAAGCCCCCTGTTGG + Exonic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202859512 14_GL000225v1_random:72602-72624 AGCTCACGAAAGCCCCCTGTGGG + Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1126414883 15:48407109-48407131 TGCTCCCCTGTGCCCCCTGTGGG - Intergenic
1128511342 15:68315791-68315813 CACTCCCCACAGCCCCCTGCTGG + Intronic
1129910680 15:79223451-79223473 CACTGCCCTAAGCCCCTTGAGGG - Intergenic
1131060617 15:89401829-89401851 AGCTCCTCTAAGCCCTCTGGGGG - Intergenic
1132621574 16:870451-870473 CTCTCCCTTACGCCCCCAGTAGG + Intronic
1137627969 16:49921504-49921526 CGTTCCCCTAAGCCACCCCTTGG - Intergenic
1137628238 16:49922972-49922994 TGTTCCCCTAAGCCACCTCTTGG + Intergenic
1138144618 16:54597276-54597298 CACTACCCTGAGCCCCCTGATGG + Intergenic
1141067926 16:80928923-80928945 CCCTCCCATGAGCCCCATGTTGG + Intergenic
1141765366 16:86054760-86054782 CGCTCCTCGAAGCCCCTTATAGG + Intergenic
1141805833 16:86340890-86340912 GGCTCCCCTGCGCCCCCTGGTGG - Intergenic
1143298740 17:5892757-5892779 CGCTTCTCTAAGCCCCAAGTTGG + Intronic
1149968269 17:61190041-61190063 CACTCCCCTATGACTCCTGTTGG - Intronic
1154001135 18:10483312-10483334 TGTGCCCCTAAGCCCTCTGTAGG + Intronic
1162361263 19:10221883-10221905 CTCTCCCCTAACCCCCCAGAAGG - Intronic
1163785145 19:19271115-19271137 CCCTCTCCACAGCCCCCTGTGGG - Exonic
1165993375 19:39828221-39828243 CCCGCCCCTAAGCCTCCCGTTGG + Intronic
1168535723 19:57167768-57167790 GGCTCCCCCAACCCCCTTGTGGG + Intergenic
1168665516 19:58202020-58202042 AGTGCCCCTAAGCTCCCTGTTGG - Intronic
925278397 2:2666475-2666497 CGCTCCCCAAAGCCAGGTGTAGG + Intergenic
927210138 2:20634167-20634189 CCCTGTCCTCAGCCCCCTGTGGG + Intronic
932449580 2:71800849-71800871 CCCTCCCCAAAGCCTCCAGTGGG + Intergenic
935960230 2:108418610-108418632 CCGTCCCCTAAGCCCAATGTGGG - Intergenic
937904108 2:127043631-127043653 CGCTGCCCTAGGCCCGCTATAGG + Intergenic
940215219 2:151296825-151296847 CGCACCAGTAAGCACCCTGTTGG + Intergenic
941604668 2:167582683-167582705 CGGTCCTCTAAGCCCCTTGCTGG + Intergenic
943858382 2:192828250-192828272 AGCTGCCCTTAGCCCCCTCTTGG - Intergenic
948921705 2:241068952-241068974 CTCTCCCCTGAGCCCACTGAGGG - Exonic
1171770389 20:29318928-29318950 CGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1176089659 20:63313232-63313254 CCCTCCGCTATACCCCCTGTAGG + Exonic
1177015977 21:15787802-15787824 AGCTCACCTAAGCCCCTTTTTGG - Intronic
1178539047 21:33433971-33433993 GGCCCTCCTAAGCACCCTGTGGG - Intronic
1179457635 21:41509857-41509879 CTCTCCCGGAAGCCTCCTGTGGG + Intronic
1179725886 21:43341045-43341067 CGCTCCCTGGAGCGCCCTGTAGG + Intergenic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1180847524 22:18992107-18992129 CTCCCCCTTCAGCCCCCTGTGGG + Intergenic
1184422807 22:44391646-44391668 CTCTCCCCTCTGCCCTCTGTGGG + Intergenic
1185110596 22:48898157-48898179 CGCTCCCCTTGACCCCCTGTGGG + Intergenic
957084852 3:75669536-75669558 GGCTCCCGAAAGCCCCCTGTGGG - Intergenic
961465552 3:127078831-127078853 CCCTCCCCTACCCCCCCTGCTGG - Intergenic
964643533 3:158934590-158934612 CTCTCCCCTACTCCCCCTCTAGG + Intergenic
965261317 3:166489522-166489544 AGCTGCCCTAAGCCCCCCATAGG - Intergenic
972922817 4:43965303-43965325 AGCTCCCTTAAGCACCCTGTGGG + Intergenic
973841514 4:54865771-54865793 CTCTCTCCTGAGCCCCCTTTGGG + Intergenic
976759249 4:88530475-88530497 CACTCCCCTAAGCCCTCCTTAGG - Intronic
978869360 4:113556690-113556712 GGCTCCCCAAAGACCCCTGAAGG + Intronic
980136558 4:128863654-128863676 TGCTCCCATACGCCCCCTGGTGG + Intronic
982157270 4:152535387-152535409 CCCTCCCCTCAGCCCCCTCCGGG - Exonic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
989268285 5:39502882-39502904 TGCTTCCCTCAGCCCCCTTTGGG + Intergenic
998097636 5:139405521-139405543 CGCTCCCCAAAACCCCCCGGGGG + Intergenic
1003090250 6:3095952-3095974 CTCTCACCTCAGCCCCCTGAGGG + Intronic
1017417184 6:154233668-154233690 CCCTCCCCTCTTCCCCCTGTTGG - Intronic
1019509621 7:1411251-1411273 CCCTCCCCACAGCCCCCTGGGGG + Intergenic
1019574979 7:1733283-1733305 CACTCCCCAAGGCCACCTGTCGG - Intronic
1020742444 7:12039036-12039058 AGCTCCCATAATCCCCATGTAGG - Intergenic
1025670698 7:63613818-63613840 CGCTCCCTCCAACCCCCTGTTGG + Intergenic
1030227425 7:107168963-107168985 CCCTCCCCTCAACCCCCTGGGGG - Intronic
1032594274 7:133223818-133223840 AGCTCCCATAATCCCCATGTGGG - Intergenic
1033134011 7:138769601-138769623 CACTGCGCTAAGCCCCCTTTTGG + Intronic
1040095776 8:43440865-43440887 AGCTCCCCCAGGCCCCATGTGGG - Intergenic
1049031725 8:140043122-140043144 CGCTGCTCTAAACCCTCTGTTGG + Intronic
1049612849 8:143563417-143563439 TGCACCCCTAAAGCCCCTGTGGG - Intergenic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1057953068 9:99385398-99385420 CACTTCCCTAAGTCTCCTGTAGG + Intergenic
1060778066 9:126391248-126391270 CACTCCCCTGTGCCTCCTGTAGG - Intronic
1061207116 9:129171219-129171241 CCCTGCCCTAAGTCCCCTGAGGG + Intergenic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1187255577 X:17638945-17638967 CCCTCCCCTAGGCACACTGTTGG - Intronic
1187486517 X:19709270-19709292 CCCTCCCCTGTGCCCTCTGTAGG - Intronic
1188025979 X:25209816-25209838 CTCTCCCCTAAAACCCCTGGAGG + Intergenic
1189599342 X:42605880-42605902 TGGTCCCCTAAGCCCCCTGTGGG - Intergenic
1196727721 X:118912117-118912139 AGCTCCATTAAGCCCCATGTAGG + Intergenic
1200757375 Y:7002503-7002525 CTCTCACCTCAGCTCCCTGTTGG - Intronic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic
1201904611 Y:19076702-19076724 CGCTCCCGGAAGCCCCCAGTCGG + Intergenic