ID: 1083615545

View in Genome Browser
Species Human (GRCh38)
Location 11:64024357-64024379
Sequence AAATCATAGGACCCCCTCAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083615545_1083615549 6 Left 1083615545 11:64024357-64024379 CCGTTGAGGGGGTCCTATGATTT 0: 1
1: 0
2: 0
3: 7
4: 90
Right 1083615549 11:64024386-64024408 CTTTACAGATGAGAAAATAGAGG 0: 3
1: 34
2: 423
3: 2466
4: 8266
1083615545_1083615550 16 Left 1083615545 11:64024357-64024379 CCGTTGAGGGGGTCCTATGATTT 0: 1
1: 0
2: 0
3: 7
4: 90
Right 1083615550 11:64024396-64024418 GAGAAAATAGAGGTTCGCAGAGG 0: 1
1: 0
2: 1
3: 51
4: 545

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083615545 Original CRISPR AAATCATAGGACCCCCTCAA CGG (reversed) Intronic
904091331 1:27946937-27946959 AAATCAGAAGCTCCCCTCAAGGG - Intronic
904809773 1:33155810-33155832 AAATCACAGATCCCCCCCAAGGG - Intronic
904872835 1:33631667-33631689 AAATTATAGCACCCTCCCAAGGG + Intronic
906630940 1:47367590-47367612 AATTCTTAAGACTCCCTCAATGG - Intronic
906884991 1:49635008-49635030 GAATCATAAGATACCCTCAAAGG - Intronic
909344507 1:74570656-74570678 AAAGCATAGGGCCCACTTAAAGG + Intronic
912100213 1:106194321-106194343 AAATCATAGGCATCCCTGAAAGG + Intergenic
913227656 1:116714026-116714048 GCATCAGAGGGCCCCCTCAAGGG - Intergenic
913499865 1:119462222-119462244 ACATCAGAGGATCCCCTCAAGGG - Intergenic
915899700 1:159837584-159837606 CAATCAGATGACACCCTCAATGG + Intronic
921531615 1:216289490-216289512 AAATTATAGAATTCCCTCAAAGG - Intronic
922026739 1:221756811-221756833 AAGTCATAGAACCCCAACAATGG + Intergenic
1066004848 10:31136609-31136631 AAACCATAGAACCCACTCAGAGG - Intergenic
1068664137 10:59654847-59654869 TAATAATAGGACCTACTCAATGG - Intronic
1070385339 10:75919036-75919058 AAATCATTGGATCCTCACAAGGG + Intronic
1071064581 10:81615247-81615269 AAGTAATATGACACCCTCAAAGG + Intergenic
1073550786 10:104399100-104399122 AAATGATAGAAATCCCTCAAGGG + Intronic
1078997382 11:16716888-16716910 AATTACTATGACCCCCTCAAAGG - Intronic
1083615545 11:64024357-64024379 AAATCATAGGACCCCCTCAACGG - Intronic
1086416477 11:86593459-86593481 ATATCATATGAGCCCCACAAAGG + Intronic
1088652990 11:111974850-111974872 AAGTCAAAGGACCCCAGCAAAGG - Intronic
1089062726 11:115639318-115639340 AAAACATAGGTCCCTCTGAAGGG - Intergenic
1091283756 11:134396891-134396913 AAATCAAAGGACGCCGTCAGGGG - Intronic
1091681007 12:2526434-2526456 AAATCACAGGACATGCTCAAAGG + Intronic
1094871465 12:34601412-34601434 ACAGCATAGGTCCCCATCAAAGG + Intergenic
1097510420 12:60531705-60531727 AAACCATAGCATCACCTCAAAGG - Intergenic
1103516722 12:121513132-121513154 GAATCCTAGGAACCCCTCAGGGG - Intronic
1104448194 12:128849695-128849717 AATACATATGACCCTCTCAATGG - Intergenic
1105526813 13:21185469-21185491 AAATCATAAAACACCCTCCAAGG - Intergenic
1107531352 13:41284978-41285000 GAATCATAATACCTCCTCAAGGG - Intergenic
1109116804 13:58398620-58398642 AAATCAAAGGCTCCGCTCAAAGG + Intergenic
1109349896 13:61166006-61166028 TATTTATAGGATCCCCTCAAAGG + Intergenic
1111423798 13:88052630-88052652 AAATCAAAGGCACCACTCAAAGG + Intergenic
1118084875 14:62403380-62403402 AACTCATATGACCTCCCCAAAGG + Intergenic
1120611762 14:86650031-86650053 AAATAATATGATCCCTTCAATGG + Intergenic
1123954324 15:25318554-25318576 AAATCATATGATCATCTCAATGG - Intergenic
1131585269 15:93685972-93685994 AAATCATATGATCATCTCAATGG + Intergenic
1143712168 17:8742556-8742578 GAATCACAGGAGCCCCTGAAGGG - Intronic
1149549708 17:57531292-57531314 TAATCATAGAACCTCCTCACAGG + Intronic
1162695443 19:12470172-12470194 AAAGCATAGGAATCCCTCAGTGG + Intronic
1165963308 19:39553298-39553320 AAATGATTGGCCACCCTCAAAGG - Intergenic
929839841 2:45446762-45446784 AAAACATAGGTCGCTCTCAAAGG + Intronic
930726974 2:54692108-54692130 AAACCATAGGAACCGCTGAAGGG - Intergenic
933343789 2:81056823-81056845 AAATCTTATGATCACCTCAATGG - Intergenic
935639172 2:105274503-105274525 ACATCATAGCAGCCCCTCAGTGG - Intronic
941037187 2:160581315-160581337 CAAGCATAGGAGCTCCTCAAAGG + Intergenic
1171080275 20:22174749-22174771 AAATCATATGATCATCTCAATGG - Intergenic
1175640052 20:60621260-60621282 AAATCATAAGTTCCCCTTAAGGG - Intergenic
1177935114 21:27335461-27335483 AAATCATGTGATCCTCTCAATGG + Intergenic
1180104791 21:45611109-45611131 AAACCATAGGATCAACTCAATGG - Intergenic
1183070282 22:35391222-35391244 TAATCCTAGTATCCCCTCAACGG + Intronic
949472695 3:4413381-4413403 AAATAATAGTACCTACTCAAGGG + Intronic
952173573 3:30836307-30836329 AAATCACAGGAACCCTTCCAAGG + Intronic
952539495 3:34352645-34352667 AAGTCATATGATCCTCTCAATGG - Intergenic
953166950 3:40473662-40473684 AAATCATATGATCATCTCAATGG - Intergenic
953201176 3:40779994-40780016 AAGTGATAGGACGCCCGCAAGGG - Intergenic
955647422 3:61154927-61154949 ACATCATCTCACCCCCTCAAAGG + Intronic
964433387 3:156627779-156627801 AAAAAATAGGAGCCCATCAATGG - Intergenic
970379518 4:15492917-15492939 GCATCAGAGGGCCCCCTCAAGGG - Intronic
976628051 4:87207877-87207899 ACATCGGAGGGCCCCCTCAAGGG + Intronic
976917188 4:90390680-90390702 TAATCCTAGGACCCCATCAATGG - Intronic
990577605 5:57138228-57138250 GAATCAGAGGAGCCCTTCAAGGG - Intergenic
991318937 5:65346373-65346395 AAATCATATGATCATCTCAATGG + Intronic
992641456 5:78771816-78771838 AAATCATAGGATCCAACCAAAGG - Intergenic
992848733 5:80781741-80781763 AAATCAAAGAAACACCTCAAAGG - Intronic
995974689 5:118019430-118019452 CAATCATAGGACTGCATCAAAGG + Intergenic
999636374 5:153627270-153627292 AAATAATAGTACCCACCCAATGG - Intronic
1002213791 5:177613735-177613757 AAATCATACCACCACATCAACGG + Intergenic
1002983118 6:2161738-2161760 AAACCAAAGGACCCCTTTAAGGG + Intronic
1005106034 6:22225277-22225299 AAAACATAAAACCCCCTGAATGG + Intergenic
1005259165 6:24039094-24039116 AAATCATATGATCATCTCAATGG - Intergenic
1007370405 6:41423182-41423204 GAATCATAGTACCTACTCAAAGG - Intergenic
1010781829 6:79953198-79953220 GCATCAGAGGGCCCCCTCAAAGG - Intergenic
1011071809 6:83393195-83393217 GCGTCAGAGGACCCCCTCAAAGG + Intronic
1012281657 6:97335109-97335131 AAATCATATGACCCTCACTAGGG - Intergenic
1019548597 7:1591095-1591117 TAATAATAGGACCCCTTCAAAGG + Intergenic
1024483752 7:49893076-49893098 AAATAATATGTCCTCCTCAAAGG - Intronic
1026344878 7:69465275-69465297 AAATCCTATGACCCCCTCTTTGG + Intergenic
1028286381 7:89007808-89007830 AAATCTTAGGACCAGCTCAAAGG + Intronic
1030389642 7:108910713-108910735 CAAGCATATGACCCCTTCAAAGG + Intergenic
1032126460 7:129197746-129197768 AAATCATATGATCATCTCAATGG - Intronic
1036284373 8:7430679-7430701 AAATTATAGCACCCCATCATAGG - Intergenic
1036337103 8:7880851-7880873 AAATTATAGCACCCCATCATAGG + Intergenic
1041890257 8:62860375-62860397 AAATCATACCACTCACTCAAGGG + Intronic
1042481352 8:69307287-69307309 AAATCATAGCAACCCCACACAGG - Intergenic
1048638781 8:136329377-136329399 AAATCATATCAATCCCTCAAGGG - Intergenic
1048784848 8:138039663-138039685 AATTCATAGAACCACCTCAAGGG + Intergenic
1050527868 9:6561752-6561774 AAAACATAGCACCCCCTAAATGG - Intronic
1056127733 9:83553483-83553505 GAATCATAGGCACCCCTGAAAGG - Intergenic
1056136842 9:83638081-83638103 AAAACTTAGGACTCCCACAAAGG + Intronic
1061059601 9:128243782-128243804 AGATCAGGGGACCCCCTCAGTGG - Intronic
1061412280 9:130428164-130428186 AAAACATAGGGCCCACTCCAAGG - Intronic
1189193205 X:39129445-39129467 AAATCATGGGACCCTCCTAAAGG + Intergenic
1192238591 X:69312381-69312403 AGAACCTAGGACCCACTCAAGGG + Intergenic
1193736470 X:85162786-85162808 AAATCATATGATCATCTCAATGG - Intergenic
1194215620 X:91127643-91127665 AAATCATAGGTGCCCATCAAAGG + Intergenic
1195231620 X:102855602-102855624 AAATCACATGACCATCTCAACGG - Intergenic
1197256571 X:124269739-124269761 AAACCATAGGGCCCCATAAATGG + Intronic