ID: 1083616030

View in Genome Browser
Species Human (GRCh38)
Location 11:64027141-64027163
Sequence CTGCTAACCCTCTGTGACAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 129}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083616030_1083616043 20 Left 1083616030 11:64027141-64027163 CCGATGTCACAGAGGGTTAGCAG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1083616043 11:64027184-64027206 GGGGAGTGTGGCTGAGAGGAGGG 0: 1
1: 0
2: 5
3: 80
4: 983
1083616030_1083616040 8 Left 1083616030 11:64027141-64027163 CCGATGTCACAGAGGGTTAGCAG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1083616040 11:64027172-64027194 GGGCTTTGCAGAGGGGAGTGTGG 0: 1
1: 0
2: 6
3: 56
4: 569
1083616030_1083616041 16 Left 1083616030 11:64027141-64027163 CCGATGTCACAGAGGGTTAGCAG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1083616041 11:64027180-64027202 CAGAGGGGAGTGTGGCTGAGAGG 0: 1
1: 1
2: 5
3: 55
4: 584
1083616030_1083616037 -1 Left 1083616030 11:64027141-64027163 CCGATGTCACAGAGGGTTAGCAG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1083616037 11:64027163-64027185 GTGGGGAAGGGGCTTTGCAGAGG 0: 1
1: 2
2: 5
3: 57
4: 489
1083616030_1083616042 19 Left 1083616030 11:64027141-64027163 CCGATGTCACAGAGGGTTAGCAG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1083616042 11:64027183-64027205 AGGGGAGTGTGGCTGAGAGGAGG 0: 1
1: 1
2: 6
3: 93
4: 764
1083616030_1083616038 0 Left 1083616030 11:64027141-64027163 CCGATGTCACAGAGGGTTAGCAG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1083616038 11:64027164-64027186 TGGGGAAGGGGCTTTGCAGAGGG 0: 1
1: 1
2: 8
3: 62
4: 609
1083616030_1083616039 1 Left 1083616030 11:64027141-64027163 CCGATGTCACAGAGGGTTAGCAG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1083616039 11:64027165-64027187 GGGGAAGGGGCTTTGCAGAGGGG 0: 1
1: 0
2: 4
3: 74
4: 552
1083616030_1083616044 28 Left 1083616030 11:64027141-64027163 CCGATGTCACAGAGGGTTAGCAG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1083616044 11:64027192-64027214 TGGCTGAGAGGAGGGCAGAGAGG 0: 1
1: 1
2: 10
3: 92
4: 999

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083616030 Original CRISPR CTGCTAACCCTCTGTGACAT CGG (reversed) Intronic
900868660 1:5286431-5286453 CTGCTGGCCCACTGTGACTTTGG - Intergenic
901783594 1:11610273-11610295 CTGTCAACCCTCTGTGGCAGTGG - Intergenic
902292452 1:15444427-15444449 CTCCTGACCCTCTGGGACCTTGG + Intronic
903804757 1:25997521-25997543 CCTCTCACCCTCTGTGACCTTGG - Intronic
906611903 1:47209432-47209454 CAGCTAACCCTCTGCGGCTTGGG - Intergenic
911458437 1:98157446-98157468 CTGTTAACCATTTGTGACAACGG - Intergenic
911587295 1:99705292-99705314 CTGGTAACCATCTGTGACCTGGG + Intergenic
913597498 1:120393037-120393059 GAACTAACCTTCTGTGACATGGG + Intergenic
914089832 1:144486277-144486299 GAACTAACCTTCTGTGACATGGG - Intergenic
914308778 1:146447939-146447961 GAACTAACCTTCTGTGACATGGG + Intergenic
914512546 1:148346550-148346572 GAACTAACCCTCTGTGACATGGG - Intergenic
916375629 1:164150464-164150486 CTGCTGGCCCTTTGAGACATGGG - Intergenic
916576380 1:166070582-166070604 CTTCTACCCCAGTGTGACATGGG - Exonic
917179954 1:172285385-172285407 CTGCTAACATTCAGTGAGATTGG - Intronic
921770825 1:219037947-219037969 TTGTTAATCCTCTGTGGCATTGG + Intergenic
1064307544 10:14181467-14181489 CTGCTTCCCCTCTGTGACGACGG - Intronic
1065428540 10:25630789-25630811 CTCCTACCCCTCTGGGAGATAGG + Intergenic
1065898678 10:30186355-30186377 CAGCTAACCCTGTGTGACCTTGG - Intergenic
1067131798 10:43572040-43572062 CTGCTTTTCCTCTGTGACATTGG - Intronic
1067202341 10:44184417-44184439 CTGCCCACCTACTGTGACATTGG - Intergenic
1071519336 10:86319394-86319416 CTGCTTAACCTCTCTGACCTTGG - Intronic
1074466015 10:113681370-113681392 CTCCCAACCACCTGTGACATAGG + Intronic
1080792897 11:35537266-35537288 CTGCTCACCCTTTTTGGCATCGG + Intergenic
1083616030 11:64027141-64027163 CTGCTAACCCTCTGTGACATCGG - Intronic
1083895813 11:65619219-65619241 CTGCCAAACCTCTTAGACATGGG + Intronic
1090570472 11:128039227-128039249 ATGCTAACCCTCTGTAAGAGTGG - Intergenic
1091147603 11:133293283-133293305 ATGCACACCCTCTGTGACCTAGG + Intronic
1095972535 12:47912521-47912543 CTGCAAACCCTCTGAGATGTGGG + Intronic
1096334254 12:50741241-50741263 CTGCTGCTCCTCTGTGAGATGGG - Intronic
1097434594 12:59542452-59542474 ATGTAAACCCTCTGTGATATTGG - Intergenic
1098245240 12:68510458-68510480 CTTATAACCCTCTGTGAGATAGG + Intergenic
1101398373 12:104367554-104367576 CACCAAATCCTCTGTGACATGGG - Intergenic
1101604382 12:106236967-106236989 CTGCTGTTCCTCTGTGAAATGGG + Intergenic
1103813184 12:123632306-123632328 CTGTTAACACTCTGGGACTTAGG - Intronic
1113217262 13:108056776-108056798 ATTCTAATCATCTGTGACATAGG + Intergenic
1113657210 13:112074460-112074482 CAGCTTACCCTGGGTGACATGGG + Intergenic
1122122364 14:99561352-99561374 CTGTCCACTCTCTGTGACATGGG - Intronic
1202900559 14_GL000194v1_random:34110-34132 CTGCACACCCCCTGTGATATTGG + Intergenic
1125324886 15:38526469-38526491 CTGCAAACCCTCTGTGACTCAGG + Intronic
1131815370 15:96216300-96216322 CTGCTAACCTTTTGTGACAAAGG + Intergenic
1132793715 16:1707664-1707686 CTGCTTTGCCTCTGTGACCTTGG + Intronic
1133406057 16:5525424-5525446 CTGCCCACCCTGTGTGACCTTGG - Intergenic
1133536775 16:6710027-6710049 CTGCTCACCCTTTGAGAGATGGG + Intronic
1143208754 17:5167071-5167093 CTGATAACTCTGTGTTACATGGG + Intronic
1144129366 17:12231086-12231108 TTACTAACCCTGTGTGGCATAGG + Intergenic
1144618082 17:16795181-16795203 CTGATAACTCTGTGTTACATGGG + Intronic
1144894623 17:18520510-18520532 CTGATAACTCTGTGTTACATGGG - Intergenic
1145137602 17:20423734-20423756 CTGATAACTCTGTGTTACATGGG + Intergenic
1148932996 17:51142224-51142246 CTGTTAAACCACTGAGACATGGG + Intergenic
1148999110 17:51738913-51738935 CCGCTAAATCTCTGTGACCTTGG + Intronic
1151067436 17:71167832-71167854 ATGCTAACCCTCTGGGAAAAGGG + Intergenic
1158058004 18:53304606-53304628 CTACTAACCCTCCCTGACCTTGG - Intronic
1160131799 18:76231818-76231840 CTGCTCACCCTCTGTGGCCTCGG + Intergenic
1161265895 19:3364360-3364382 CGGCTCTCCCTCTGTGAAATGGG - Intronic
1161528424 19:4771822-4771844 CTGCTACCCATCAGTGTCATGGG + Intergenic
1162308709 19:9891736-9891758 GTACTAACCCTCTGAGACTTGGG + Intronic
1163827030 19:19529568-19529590 CTCCTCAGCCTTTGTGACATGGG + Intronic
1166242342 19:41503011-41503033 GTGTACACCCTCTGTGACATGGG + Intergenic
1166315042 19:41984930-41984952 CAGCAGACCCTCTGGGACATTGG + Exonic
1166756887 19:45198013-45198035 CTGCTAACCACCAGTGACCTCGG - Intronic
927849116 2:26487845-26487867 CTGCTGACCATCAGTGCCATGGG - Intronic
930501836 2:52231043-52231065 CTCAGAACTCTCTGTGACATAGG - Intergenic
932210382 2:69923432-69923454 CTGCCAACCCTCTTTGAAAAAGG + Intronic
932749882 2:74364753-74364775 CTGACAACCCTCTGGGATATAGG + Intronic
936901957 2:117491219-117491241 CTGCTGCACCTTTGTGACATGGG + Intergenic
939555728 2:143670510-143670532 CTGCGAACACTCTGGAACATGGG - Intronic
940992432 2:160111292-160111314 CTCCCAACCCTCTGTGACTGTGG - Intronic
944442623 2:199757840-199757862 CTTCTAAGCCACTTTGACATAGG - Intergenic
945579250 2:211572346-211572368 ACGCTAACAATCTGTGACATTGG + Intronic
946761561 2:222998961-222998983 CTCCTAACACTCTGTGAGAAGGG - Intergenic
948547551 2:238743492-238743514 CTGCTGACCCACTGTGTGATGGG - Intergenic
1174273376 20:49385559-49385581 CAGCTAAAACTCTGTGACAATGG - Intronic
1175677883 20:60962396-60962418 ATTCTAACCCTGTGTGACTTTGG + Intergenic
1175951407 20:62585527-62585549 CTGCTCACCCGCCCTGACATGGG + Intergenic
1176619934 21:9048888-9048910 CTGCACACCCCCTGTGATATTGG + Intergenic
1183623189 22:38986686-38986708 CCGCTGCCCTTCTGTGACATGGG + Intronic
953215004 3:40909735-40909757 CCCTTAACCCTATGTGACATTGG + Intergenic
954195071 3:48991546-48991568 CTGCAACCCCTCTGTGAAGTGGG + Intronic
958895376 3:99823433-99823455 CTGCTAGGCCTTTGTGAAATTGG - Intronic
965892145 3:173527764-173527786 TTATTAACCCTCTGTTACATGGG + Intronic
967862310 3:194161283-194161305 CTGCTCAGCCTCTGTGGCCTTGG + Intergenic
971934026 4:33123791-33123813 CTGCCAACCATTTTTGACATTGG + Intergenic
972580474 4:40391266-40391288 CTGCTCACCCCCTCTGACAATGG + Intergenic
973087274 4:46081213-46081235 TTGCTAAACCTCTGTGAGATGGG - Intronic
974907295 4:68074261-68074283 TTGCTAAGCCTCTGTAAAATGGG + Intronic
975647772 4:76562305-76562327 CTGTTAACCCTCAGAAACATGGG - Intronic
976080878 4:81353497-81353519 CTTGTAACCCCCTGTGACATGGG + Intergenic
977623227 4:99161555-99161577 CAGCTAACCCTGTGTGACCAGGG - Intergenic
982662623 4:158225164-158225186 CTGCTAACGCCCTTAGACATGGG + Intronic
983623804 4:169785330-169785352 GTGCACACCCTCTGTGATATTGG - Intergenic
985655443 5:1129341-1129363 CTGCTAAGGCTCTGTGAGACTGG - Intergenic
985873475 5:2577482-2577504 CTGCCAGCCCTGTGTGACCTGGG + Intergenic
992558583 5:77927967-77927989 CATCTATCCCTCTGTGACTTTGG + Intergenic
996372675 5:122769932-122769954 CTGCTATCCCTCCTTGTCATTGG + Intergenic
998884318 5:146678058-146678080 CTTTTAACCCTCTGAGCCATGGG - Intronic
1000940576 5:167355522-167355544 CTCCTAACCCCTTGTGACACAGG + Intronic
1001186481 5:169578797-169578819 ATCCTATCCCTCTGTGACTTGGG + Intergenic
1001465709 5:171963850-171963872 CTGCTTACACTCTTTGTCATTGG - Intronic
1003665866 6:8110831-8110853 GTGCTAAGCCTCTGAGACAGTGG - Intergenic
1003683203 6:8276124-8276146 GTGCAAAACCCCTGTGACATGGG + Intergenic
1004887389 6:20064515-20064537 CTGTTAACCTGATGTGACATTGG + Intergenic
1006915802 6:37593276-37593298 CTGCTGACGCTCAGTGCCATGGG - Intergenic
1009682302 6:66912124-66912146 GTGCTATCCCTCTGAGATATAGG + Intergenic
1017133284 6:151126537-151126559 CTGTCATCACTCTGTGACATCGG - Intergenic
1018899597 6:168044440-168044462 CTGCTGACCCTCCGGGACCTGGG + Intronic
1019210110 6:170397966-170397988 CTGCTTACCCTCTTTGGCTTGGG + Intronic
1023820372 7:43977333-43977355 CTGCACCCCCTCTTTGACATGGG - Intergenic
1023907201 7:44531344-44531366 CTGCAAATCCTATGTGACCTTGG + Intronic
1024346488 7:48319759-48319781 TTCCTAACTCTCTGTGACCTTGG + Intronic
1024607997 7:51038632-51038654 TTGCTACCCCTCTGTTACTTGGG - Intronic
1024749813 7:52452434-52452456 CTGTTGACCCTCTGGGACTTTGG - Intergenic
1025099426 7:56122935-56122957 CTGCCAACCCGGTGGGACATTGG - Intergenic
1025257413 7:57394003-57394025 CTTGTAACACCCTGTGACATTGG + Intergenic
1027453115 7:78355495-78355517 ATGCTGACCCTCAGTGAAATAGG + Intronic
1029748656 7:102530854-102530876 CTGCACCCCCTCTTTGACATGGG - Intergenic
1029766603 7:102629938-102629960 CTGCACCCCCTCTTTGACATGGG - Intronic
1033220342 7:139523453-139523475 CTGCTCACCATCTGTGAAAATGG - Intergenic
1037118723 8:15257178-15257200 GTTCTATCCCTCTGTGACTTTGG - Intergenic
1038590933 8:28837048-28837070 CTACTAAGCCTTTGTGACACAGG - Intronic
1039838766 8:41278783-41278805 CTGCTCCCCATCTGTCACATGGG - Intronic
1039886837 8:41659629-41659651 CCCCTAACCCTCTGGGACTTTGG + Intronic
1045317688 8:101057547-101057569 CTGCAGACCCTCTGTGCCAGAGG + Intergenic
1045590837 8:103594859-103594881 CTGCTATCCCTATAAGACATGGG + Intronic
1048439019 8:134446046-134446068 TTGCTAACCCTCAAAGACATTGG + Intergenic
1048858011 8:138700382-138700404 CTCCAAACCCTGTGTGACCTTGG + Intronic
1052990214 9:34514594-34514616 CTGTGAGCCCTCTGTGCCATGGG + Intronic
1053089967 9:35266130-35266152 CTGCTCTCTCTCTGTGACTTTGG + Intronic
1054831990 9:69635823-69635845 CTGAAAACTCTCTGAGACATTGG + Intronic
1056770545 9:89475198-89475220 CTGCCCAGCCTCTGTGACACTGG - Intronic
1059559880 9:115323991-115324013 CTCCCAACCTTCAGTGACATGGG + Intronic
1060184277 9:121554318-121554340 TTGCAAACCCTCTGGGACCTGGG - Intergenic
1061847389 9:133395304-133395326 ATGCTCACACTCTGTGAAATGGG + Intronic
1203743136 Un_GL000218v1:19346-19368 GTGCACACCCTCTGTGATATTGG + Intergenic
1187205053 X:17174246-17174268 CTGTTAACCCTATTTGACAAAGG - Intergenic
1188434117 X:30140947-30140969 CTGCTGACCCACAGTGACCTTGG - Intergenic
1188659268 X:32738127-32738149 CTGGTAACCCTCTGTGATTTTGG - Intronic
1189232124 X:39460706-39460728 CTGCCCACCCTCTGTGGCTTCGG + Intergenic
1193934819 X:87604846-87604868 GTGCAAATGCTCTGTGACATTGG - Intronic
1197207023 X:123799261-123799283 CTGGTCACCCTCTGTGGCATTGG + Intergenic
1197209114 X:123814946-123814968 CTGGTCACTCTCTGTGGCATTGG - Intergenic
1201156665 Y:11136813-11136835 GTGCACACCCTCTGTGATATTGG + Intergenic
1201446964 Y:14067618-14067640 GTGCTACCACTGTGTGACATGGG - Intergenic