ID: 1083617792

View in Genome Browser
Species Human (GRCh38)
Location 11:64035215-64035237
Sequence GGCACTGCCCCCTTAATAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 82}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083617778_1083617792 27 Left 1083617778 11:64035165-64035187 CCAAGGTCACAGTCAGCTGGGGA 0: 1
1: 0
2: 2
3: 39
4: 214
Right 1083617792 11:64035215-64035237 GGCACTGCCCCCTTAATAGGTGG 0: 1
1: 0
2: 1
3: 2
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083617792 Original CRISPR GGCACTGCCCCCTTAATAGG TGG Intronic
900726573 1:4220206-4220228 GGCTCTGCCCCCTTTTTAGTAGG + Intergenic
903236141 1:21951889-21951911 GGCACTGCCCCACTTCTAGGCGG - Intergenic
906415402 1:45617923-45617945 GTCACTGCCCTCTTAATATAGGG + Intronic
907872719 1:58457440-58457462 GGCACAGGCCGCTTAATAAGGGG - Intronic
907938510 1:59064716-59064738 GCCATTGCCCACTTACTAGGGGG - Intergenic
911889123 1:103344722-103344744 GGGACTGATCCCTTAATATGTGG - Intergenic
915744081 1:158142814-158142836 GGCACTTGCCACTTAAGAGGGGG - Intergenic
917099221 1:171428967-171428989 GGCACTGACCCCTTAACCTGTGG + Intergenic
917967645 1:180188437-180188459 GGCACTGTCGCCTTAGAAGGCGG + Intronic
922668077 1:227489753-227489775 GGCACTGCGTCCTTACTAGCTGG - Intergenic
1063611711 10:7568442-7568464 GGAACTGCTCCCAGAATAGGAGG + Intronic
1072089135 10:92109782-92109804 TGCACTCTCCCCTTTATAGGTGG + Intronic
1072694014 10:97589865-97589887 GGGACTGCCCTCTTGCTAGGAGG + Exonic
1072908392 10:99476967-99476989 CGCCCAGCCCCCTTAAAAGGGGG - Intergenic
1077720740 11:4625997-4626019 GGCAAGGCCCCTTTAATGGGCGG + Intergenic
1080916587 11:36666508-36666530 GGCAAGGCCCCTTTAATGGGGGG - Intergenic
1083038118 11:59659271-59659293 TGCACTGCCCTCATAATAGCTGG + Exonic
1083313519 11:61799330-61799352 GGCATTGCCTCATGAATAGGAGG + Intronic
1083617792 11:64035215-64035237 GGCACTGCCCCCTTAATAGGTGG + Intronic
1087144640 11:94799748-94799770 GGAACTGCCCACTTACGAGGAGG + Exonic
1088914122 11:114214168-114214190 GGCACTGTCCCCTTACTATGGGG - Intronic
1089632204 11:119790952-119790974 AGCTATGCCCCCTTAAGAGGAGG + Intergenic
1091660223 12:2377668-2377690 TGCACTGCTCACTTAAAAGGTGG + Intronic
1092151418 12:6251511-6251533 GGCCCTGCCCCCTTTATGGAGGG + Intergenic
1100498551 12:95150721-95150743 GGCTCAGCCTCCTGAATAGGTGG + Intronic
1104880814 12:132069214-132069236 GACACTGCTCCCTGAATAGTCGG - Intronic
1105903245 13:24776748-24776770 GGAACTGCCTCCTTCAGAGGGGG - Intronic
1111976891 13:94975632-94975654 GTCACTGCCCACTTAAAAGCAGG - Intergenic
1120109281 14:80534525-80534547 GGCCCTGCTCCCTTAACAGTGGG - Intronic
1122925549 14:104897898-104897920 GGCCCGGCCCCCTTAACGGGAGG + Intergenic
1129073439 15:72971475-72971497 GGTACTGCCCCTTTAAGAAGTGG + Intergenic
1129313018 15:74725543-74725565 GGCACTGCCACCTTTATAGGCGG + Exonic
1129649774 15:77476059-77476081 AGCCCAGCCCCCTTACTAGGCGG + Intronic
1129666580 15:77582696-77582718 GTCACTGCCCCTTTTATGGGCGG - Intergenic
1134033276 16:11009690-11009712 TGCACTGCCCCCTTAAGTTGTGG - Intronic
1138252481 16:55512770-55512792 GCCAAGGCCCCCTTAATTGGTGG - Intronic
1138546654 16:57723432-57723454 GGCACTGCCTCCTTTAAATGTGG - Intronic
1142842347 17:2643366-2643388 GCCTCTGCCCCCCTAATAGCTGG + Intronic
1148115528 17:45172621-45172643 GGCACTGGCCCTTTAAGTGGGGG + Intergenic
1148623377 17:49051354-49051376 GGGGCTGCCCCCTTAGGAGGAGG + Exonic
1148768902 17:50055929-50055951 GGTGCTGCCCCTTTAAGAGGAGG + Intergenic
1162401018 19:10446560-10446582 GGAACTGAGCCCTTTATAGGAGG - Intronic
1166403415 19:42501379-42501401 GGCTCAGCCTCCTGAATAGGTGG - Intergenic
929208234 2:39322782-39322804 GCCACAGCCCCCTGAATAGCTGG + Intronic
931568330 2:63640377-63640399 GCCACTGCCACCTGAATAGCTGG - Intronic
933912902 2:86959846-86959868 GTCTCTGCCTCCTGAATAGGTGG + Intronic
934010093 2:87810044-87810066 GTCTCTGCCTCCTGAATAGGTGG - Intronic
935773662 2:106450768-106450790 GTCTCTGCCTCCTGAATAGGTGG - Intronic
935906402 2:107845153-107845175 GTCTCTGCCTCCTGAATAGGTGG + Intronic
936128186 2:109810293-109810315 GTCTCTGCCTCCTGAATAGGTGG + Intronic
936216511 2:110561192-110561214 GTCTCTGCCTCCTGAATAGGTGG - Intronic
936425652 2:112415766-112415788 GTCTCTGCCTCCTGAATAGGTGG - Intronic
938901324 2:135800770-135800792 GGCACTGCCCCCTACATTGTTGG - Exonic
943328834 2:186534633-186534655 GACTCTTCCCCCTTAATAGCTGG + Intergenic
943984701 2:194604416-194604438 GGCAAGGCTCCTTTAATAGGGGG - Intergenic
947464238 2:230326837-230326859 TGCTCTGCCCTCTTAAGAGGGGG - Intergenic
1169308354 20:4514386-4514408 AGCACTGACACCTTCATAGGTGG + Intergenic
1172467378 20:35166315-35166337 GGCACTTCCCCCTTAGGATGAGG - Intergenic
1172977588 20:38918508-38918530 GGCAAGGCCCCCTTGATCGGAGG + Exonic
1176013626 20:62915170-62915192 GTCACTGTCCCTTTAAAAGGAGG - Intronic
1179559707 21:42207638-42207660 GGCACTGCCACCTTACTACCAGG + Intronic
949940121 3:9148337-9148359 GGCACTGCCCCCAAAATTGCTGG - Intronic
951629759 3:24706798-24706820 GACACTGCCACCTACATAGGGGG - Intergenic
953663161 3:44905755-44905777 GGCATTGCCCTTATAATAGGGGG + Intronic
961038119 3:123657328-123657350 AGCACTGCCCCCATCATATGAGG + Exonic
963316853 3:143768281-143768303 TGCAGTGCCCCCTTAACAAGTGG - Intronic
963841659 3:150114019-150114041 GGAACTGCCACCTTCATCGGTGG - Intergenic
965315204 3:167182294-167182316 TGCACTTTCCCCCTAATAGGTGG + Intergenic
967081830 3:186056905-186056927 GAAACTGTCCCATTAATAGGAGG + Intronic
968087326 3:195879672-195879694 GGCACTTCCCCCTCAACCGGGGG - Intronic
968521998 4:1038243-1038265 GGCACTGCCTACTTTAAAGGAGG + Intergenic
970453102 4:16191396-16191418 CGGACTGCCCCCTTATCAGGTGG + Exonic
973041629 4:45476468-45476490 GGCACTGTCTCCGTAATTGGTGG + Intergenic
976922757 4:90458196-90458218 GGCCCTGCCCCCTTACAAGTTGG - Intronic
977352470 4:95905880-95905902 CATACTGTCCCCTTAATAGGAGG + Intergenic
978850307 4:113327816-113327838 GGCACTTGACACTTAATAGGAGG + Intronic
979674874 4:123399066-123399088 GGCACTGCCACTTTAAAAGTGGG + Intronic
979679506 4:123444306-123444328 GTCACTGTCCCCTTTAAAGGGGG + Intergenic
985569608 5:637851-637873 GGCACTGCCTCCCTAATGTGGGG + Intronic
992425061 5:76648335-76648357 GGCACTGCCTCATTACTAGGAGG - Intronic
1026476452 7:70740038-70740060 TGCACAGCCCCTTTAAAAGGAGG + Intronic
1033534417 7:142298815-142298837 GGCACTGGCACCTCAAGAGGTGG - Intergenic
1033600138 7:142883481-142883503 GGGCCTGCCCCATTCATAGGGGG + Intronic
1188827607 X:34855538-34855560 GGCTCTGCCTCCCAAATAGGTGG + Intergenic
1189556018 X:42146209-42146231 GGCACTGCCATCTTAACAAGTGG - Intergenic
1201474731 Y:14367897-14367919 GGCACAGCCCCCTTCATGGAAGG + Intergenic