ID: 1083617975

View in Genome Browser
Species Human (GRCh38)
Location 11:64035821-64035843
Sequence GGCGGCGGCGAGCAGGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 808
Summary {0: 1, 1: 0, 2: 8, 3: 102, 4: 697}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083617975_1083617984 0 Left 1083617975 11:64035821-64035843 CCCGCGCCCTGCTCGCCGCCGCC 0: 1
1: 0
2: 8
3: 102
4: 697
Right 1083617984 11:64035844-64035866 GCTCGCGCGGGCACCGCCGCTGG 0: 1
1: 0
2: 0
3: 11
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083617975 Original CRISPR GGCGGCGGCGAGCAGGGCGC GGG (reversed) Intronic
900101635 1:964542-964564 GGCTGCGGGGAGGGGGGCGCGGG + Intronic
900109370 1:999110-999132 GGGGGCGGCGGGCAGCGCCCGGG + Exonic
900135630 1:1115853-1115875 GGAGGCGGCGACGAGGACGCGGG + Intronic
900139448 1:1133439-1133461 GCAGGCGGCGGGCAGGGCGCAGG - Intergenic
900168472 1:1254522-1254544 GGCGGCCGCGAGCGGGGCGGGGG - Intronic
900180437 1:1308765-1308787 GGAGGCGGGAAGGAGGGCGCGGG + Intronic
900199814 1:1399407-1399429 GGCGGCGTCGCGCTGGTCGCGGG - Intergenic
900249113 1:1657661-1657683 GGCCGAGGCGAGCAGATCGCTGG + Intronic
900260059 1:1722994-1723016 GGCCGAGGCGAGCAGATCGCTGG + Intronic
900349672 1:2228503-2228525 GGCGGCGGCGGGCGCGGCGCGGG + Intergenic
900413910 1:2526411-2526433 TGCGGGGGCGGGCGGGGCGCCGG - Intronic
900414736 1:2529764-2529786 GGCGGCGGTGAGCGGGCGGCGGG + Intronic
900645254 1:3706113-3706135 GGCGGAGGCGGGCCGGGGGCGGG - Intronic
901242827 1:7704811-7704833 GGCGGGGCCGGGCGGGGCGCGGG + Intronic
901279878 1:8026029-8026051 GGCGGGGGCGTGGAGGGCGCGGG - Intronic
901660305 1:10794893-10794915 GGCGGGGGCTGGCCGGGCGCGGG - Intronic
902385569 1:16073642-16073664 GGCAGCGGCGGGCACTGCGCGGG - Intergenic
902768563 1:18632454-18632476 GGCGGCGGCGAACCGGGTCCTGG + Intronic
903224131 1:21885304-21885326 GGCTGCAGTGAGCAGGGAGCTGG - Exonic
903468496 1:23568530-23568552 GGAGGCGGCGTGCAGGGCGCTGG - Intergenic
903750217 1:25616809-25616831 GGCGGCGGCGGGGACGGCGGTGG + Intergenic
903822264 1:26111680-26111702 GGAGGAGGCGAGCGGAGCGCCGG + Intronic
903859728 1:26357339-26357361 GGCGGGGGCGGGCAGGGCACTGG + Intergenic
903907292 1:26696171-26696193 GGCGGCGGCGGCCGAGGCGCCGG - Exonic
903974068 1:27137875-27137897 GGGAGGGGCGAGCAGGACGCTGG - Intronic
904618934 1:31764080-31764102 GGCGGCGCCGGGCCGGGCGCGGG + Intronic
904720069 1:32500842-32500864 GGCGGCGGCGGGAAGGCGGCGGG + Intronic
904724951 1:32539849-32539871 GGCGGCGGCGGGAAGGCGGCGGG + Intronic
904783057 1:32964845-32964867 GGCAGCGGCGCGCGGGGCGGAGG - Intergenic
904822749 1:33256237-33256259 GGCGGGGGCGGGCCGCGCGCTGG - Intergenic
905016404 1:34781640-34781662 GGCGGCGCGGAGGAGGGAGCAGG - Exonic
905205214 1:36339466-36339488 GGCTGCGGGGAGCAGGGAGGGGG + Intergenic
905308532 1:37034569-37034591 GGAGGCGGGAGGCAGGGCGCAGG - Intergenic
905449321 1:38046749-38046771 GGCGGCGCGGCGCAGGGCGCGGG - Exonic
906078414 1:43068412-43068434 GGCGGGGGCGGGCTGGGCGCTGG + Intergenic
906769651 1:48472309-48472331 GGCGGAGTCGGGCAGGGGGCGGG + Intergenic
907189057 1:52633466-52633488 GGTGGCGGCGGGCTGGGCGCGGG + Exonic
907278084 1:53327941-53327963 GGCGGCGGCGCGGGGAGCGCGGG - Exonic
907409414 1:54273992-54274014 GGAGGCGGACAGCAGGGCGGAGG + Intronic
907490491 1:54806088-54806110 AGCGGAGGCGGGCAGCGCGCAGG + Exonic
908355703 1:63323404-63323426 AGCGGCGGCGGGCCTGGCGCGGG + Exonic
908501206 1:64745194-64745216 GGCGGCGGCGAGGGGGGCGCGGG + Exonic
908523386 1:64966112-64966134 GCGGGCGGCGAGGAGGTCGCCGG - Intronic
910301059 1:85708136-85708158 GGCGGCGGAGAGGAGGGGACAGG - Exonic
912270139 1:108200274-108200296 GGCTGCGGCGCGCAGGGCGCAGG + Exonic
912890770 1:113527240-113527262 GGCGGGGGCGGGCAGGGAGGAGG + Intronic
912993487 1:114511115-114511137 GGCGGCGGCGACGCGGGCGGCGG - Exonic
913129736 1:115828714-115828736 GGCGGCGGCGGGCTGGGGGCGGG + Intergenic
913671117 1:121097876-121097898 GGCGGCGGCAGGGAGGGAGCGGG + Intergenic
914022884 1:143885297-143885319 GGCGGCGGCAGGGAGGGAGCGGG + Intergenic
914293606 1:146298065-146298087 GGCGAGGGCGAGTCGGGCGCAGG - Intergenic
914554650 1:148748848-148748870 GGCGAGGGCGAGTCGGGCGCAGG - Intergenic
914661371 1:149793241-149793263 GGCGGCGGCAGGGAGGGAGCGGG + Intronic
914813668 1:151047840-151047862 GGCGGCGGGGACCATGGGGCTGG - Exonic
914845633 1:151282309-151282331 GGCGGCCGCGGGGAGGGCGGCGG + Exonic
914919692 1:151838739-151838761 TGAGGCAGCGAGCAGGTCGCGGG + Exonic
915127991 1:153679120-153679142 GGCGGGAGCCAGCGGGGCGCCGG - Exonic
915309605 1:155000652-155000674 GGGGGCGGGGGGCAGGGGGCGGG - Intergenic
915310076 1:155002228-155002250 GGCGGTGGCGTGCAGGGGGCGGG + Intergenic
916694440 1:167221462-167221484 GGCGGCGGCGAGCACAATGCCGG + Intronic
916961365 1:169893400-169893422 GGTCGCGGCAAGCAGGGCGAGGG - Intronic
917028096 1:170663785-170663807 AGCGGAGGCCAGCAGGGCGGGGG - Intronic
918064417 1:181089596-181089618 AGCGGGGTCGAGCCGGGCGCCGG - Exonic
919809397 1:201399330-201399352 GGCGGCGGCCGGCGGGGCGCGGG - Exonic
919822862 1:201483888-201483910 GGCTGCGGCCAGCAGAGCCCAGG - Exonic
922323301 1:224506433-224506455 GGTGGCATCGAGCAGGGCCCTGG - Intronic
922440657 1:225653055-225653077 GGCGGCGGCGCGGCGAGCGCGGG - Exonic
922958614 1:229626001-229626023 GGCGGCGGGGCGCGGGGCGCGGG - Exonic
923141144 1:231162371-231162393 GGGGTCGGCGAGCAGGCAGCTGG + Intronic
924325439 1:242890453-242890475 GGCGGCGGCCAGTGGGGCTCCGG + Intergenic
924414948 1:243849754-243849776 GGCGGCGGTGCGCAGCGGGCCGG - Intronic
1062885126 10:1010721-1010743 GGAGGCGGCGGGAAGGGGGCAGG - Intronic
1063121298 10:3106875-3106897 GGCAGGGGCGAGGAGGGGGCAGG - Intronic
1064011849 10:11742282-11742304 GGGAGCGGCGAGCCGGGGGCGGG + Intergenic
1064229587 10:13518276-13518298 GGCCGTGGCGAGCAGGCTGCAGG + Intronic
1064274191 10:13891761-13891783 GGCGGCGGCGGGGACGGGGCGGG - Intronic
1065025097 10:21534098-21534120 GGCGGCGGCGAGCGGCGCGGGGG + Intergenic
1065177771 10:23095684-23095706 GGCGGCGGCGGGCCCGGCACCGG + Exonic
1065573965 10:27100229-27100251 GGCGGGGGCGAGCCGGGGGAGGG - Exonic
1066370405 10:34814823-34814845 GGCGGCGGCGGGGACGGCGCCGG - Intronic
1066464200 10:35639448-35639470 GGCGGCGGGGGGCCGGGCGGCGG - Exonic
1066464422 10:35640387-35640409 AGCGGTGGCGCGCCGGGCGCGGG - Exonic
1068080048 10:52308862-52308884 TGCTGCGCCGTGCAGGGCGCGGG + Intergenic
1068544937 10:58334929-58334951 GGGCGCGGCGGGGAGGGCGCAGG + Intergenic
1070032617 10:72692200-72692222 GGCGGCGGCGGCGGGGGCGCCGG + Exonic
1070032660 10:72692358-72692380 GCCGCCGGCGGGCAGGCCGCCGG + Intronic
1070570703 10:77637906-77637928 GCCCGGGGCGAGCGGGGCGCGGG - Intronic
1070788036 10:79173501-79173523 TGGGGCGGGGAGCAGGGGGCGGG + Intronic
1070835668 10:79445576-79445598 AGCGGCTGCGGGCAGCGCGCGGG - Exonic
1071485885 10:86102525-86102547 GGCAGCGCCGGGCAGGGCTCTGG - Intronic
1071532434 10:86400481-86400503 GGCGGCGGCGAGCCGAGACCAGG - Intergenic
1071568207 10:86682330-86682352 GGCAGTGGCGTGCAGGGAGCGGG + Intronic
1072723470 10:97796069-97796091 GGGCGCTGAGAGCAGGGCGCTGG - Intergenic
1072731570 10:97850197-97850219 GGTGGCGGCGAGCTGGGGCCCGG - Intergenic
1073216652 10:101840240-101840262 GGGGGCGGGGTGCAGGGTGCGGG - Intronic
1073326106 10:102644595-102644617 GGCGGCCGCGGGCAGGGGGCCGG - Exonic
1073429806 10:103478769-103478791 GGCGCCGGCCCGCAGGGCACCGG - Exonic
1074086144 10:110210053-110210075 GGTGGCGGCGGCCAGGGCGGCGG - Intronic
1074546391 10:114404720-114404742 GGGGGCGGCGAGCGGGGCCGCGG - Intronic
1074591887 10:114821747-114821769 GGCCGCGGCGGGCAGAGCGGGGG + Exonic
1075438455 10:122461609-122461631 GGTGGCGGCGGACAGGGCGAGGG - Exonic
1075438497 10:122461779-122461801 GGCTGCGGCGGGCAGCGCGCCGG - Exonic
1075725304 10:124607898-124607920 GGCGGCTGCGAGCAGTGCTTTGG + Intronic
1075748516 10:124744321-124744343 GGCGGCGGCGTGCAGGAGGCAGG + Intronic
1075768907 10:124917108-124917130 GGCGGCGGCGCGAAGGGAGGCGG + Intergenic
1076146456 10:128126177-128126199 GGCGGAGGTGAGCGCGGCGCCGG - Exonic
1076372364 10:129963861-129963883 GCAGGCGCCGAGCAGGGCGAGGG - Intergenic
1076373129 10:129967537-129967559 GGGAGCGGCGTGCCGGGCGCAGG + Intergenic
1076707135 10:132308105-132308127 GGCGGGGCCGAGCCGGGGGCGGG + Intronic
1076857612 10:133124891-133124913 GGCGGCGGCGAGAAAAGCGGCGG + Intronic
1076875626 10:133214269-133214291 GGCTGAGGGGAGCAGGGCACAGG + Intronic
1076992085 11:280631-280653 CGAGGCGGCGAGCGGCGCGCGGG + Exonic
1077008522 11:369989-370011 GGGGGCGGCGCGGGGGGCGCGGG + Intronic
1077016389 11:400777-400799 GGCGGGGGTGAGCGGGGCGGGGG - Intronic
1077016435 11:400883-400905 GGCGGGGGTGAGCGGGGCGGGGG - Intronic
1077016784 11:401750-401772 GGCGGGGGTGAGCGGGGCGGGGG - Intronic
1077017280 11:402823-402845 GGCGGGGGTGAGCGGGGCGGGGG - Intronic
1077060875 11:617409-617431 GGCAGCGGCGATGAGGGCGAGGG - Exonic
1077062665 11:624765-624787 GGCGGCGGGGAGCCAGGGGCTGG - Intronic
1077065545 11:639579-639601 GAGGGCGGCGGGCGGGGCGCGGG - Intronic
1077081575 11:726791-726813 GGCGGGGGAGAGGAGGGCGCAGG - Intronic
1077236216 11:1483209-1483231 GGGAGCTGGGAGCAGGGCGCAGG - Intronic
1077253964 11:1572435-1572457 GGGGGCGGGGTGCAGGGTGCGGG + Intergenic
1077409179 11:2395538-2395560 GAGGGCGGGGAGCAGGGCCCCGG + Intronic
1077484259 11:2831689-2831711 GGCAGCGGGGAGAAGGGTGCTGG - Intronic
1077495818 11:2886042-2886064 GGGGGCGGTGAGCGGGGCGGGGG + Intergenic
1077898825 11:6474013-6474035 CGCGGCGGCGGGCGGGGCGTGGG - Intronic
1078168482 11:8910978-8911000 GGAGGCGGGGCGCCGGGCGCTGG - Intergenic
1078316052 11:10294102-10294124 GGCGGCGGCGAGGGCGGCGACGG - Exonic
1078659821 11:13277847-13277869 GGCGGCGGTGAGTCCGGCGCGGG - Exonic
1079244661 11:18743556-18743578 GGCAGCTGAGAGCAGGGCCCCGG + Intronic
1080779945 11:35420102-35420124 GGGGGCGGCGGGCGGGGTGCAGG + Intergenic
1081831915 11:46121550-46121572 GGCGGGGGCGCGCACGGCGGCGG - Intergenic
1081854596 11:46295621-46295643 GGTGGCGGCGTGGAGGGCACCGG - Intronic
1082029518 11:47594313-47594335 GGCGGCAGCGGACAGGGTGCTGG + Exonic
1082784897 11:57311397-57311419 GGGTGCGGCCAGCCGGGCGCAGG + Intronic
1082802860 11:57427139-57427161 GGCGGAGGCGAGCAGGGGACTGG - Intronic
1083617975 11:64035821-64035843 GGCGGCGGCGAGCAGGGCGCGGG - Intronic
1083656232 11:64230934-64230956 GGCAGCGGTGAGTTGGGCGCGGG + Exonic
1083656979 11:64234558-64234580 GGCGGCGGGGGGCTGGGCCCGGG - Exonic
1083747706 11:64744848-64744870 GGCGGCGGGGAGCGGGGCCGCGG - Intronic
1083772938 11:64878502-64878524 GGCGGCTGAGAGCGGGGCGAGGG + Exonic
1083811371 11:65108616-65108638 GGCAGCGGCCAGCAGGGCCCCGG - Exonic
1084165420 11:67372992-67373014 GGCGGCGGAGAGGAGGGCGGAGG - Intronic
1084423643 11:69072712-69072734 GGAGGCTGGGAGCAGGGGGCGGG - Intronic
1084891664 11:72239867-72239889 GGGGGCGGCGGGCCTGGCGCGGG - Exonic
1084946654 11:72642367-72642389 GGCGGCTGCGAGCATGGTCCTGG - Intronic
1085197914 11:74683430-74683452 CGCGGCCGCGAGCAGTGCCCGGG - Intergenic
1085503139 11:77040426-77040448 GGCGGCCGCGCGCAGGGCCCGGG - Exonic
1087163381 11:94973402-94973424 GGCGGCAGAGTGCAGAGCGCGGG - Intronic
1089442056 11:118525527-118525549 GACGGAGGCGAGCAGGGTGGCGG - Exonic
1089556244 11:119317222-119317244 GGCTGCGGCGCGCGGGGCGGGGG - Intronic
1089729644 11:120512051-120512073 GGGAGCGGGGAGGAGGGCGCGGG - Intronic
1089876089 11:121723253-121723275 GGAGGCGGAGAGTAGGGGGCCGG - Intergenic
1090616765 11:128522263-128522285 GCCGGCGGAGAGGAGGGAGCGGG - Intronic
1091309205 11:134560908-134560930 GGGGGGGGCCAGCAGGGCCCAGG + Intergenic
1091567897 12:1661870-1661892 GGCGGCGGGGGGCGGGGGGCGGG + Intergenic
1091616169 12:2052830-2052852 TGCGGCGGCGCGCAGGGAGCCGG - Intronic
1094041166 12:26122816-26122838 CTCGGCGGCGAGCTCGGCGCTGG + Exonic
1094624116 12:32106787-32106809 GGCGGCTCCGAGCAGGGGGCGGG - Intergenic
1095949281 12:47773183-47773205 GGGGGCGGAGCGCGGGGCGCCGG + Intronic
1096238066 12:49943190-49943212 GGCGGAAGAGAGCAGGGCCCTGG + Intergenic
1096675055 12:53221738-53221760 GGCGGCTGAGGGCGGGGCGCGGG - Intronic
1096695271 12:53344819-53344841 GGCGGCAGGGGGCGGGGCGCGGG + Intronic
1096700634 12:53380529-53380551 GGCCGGGGCGGGCAGGGGGCGGG - Intronic
1096784411 12:54009045-54009067 GGCGGCGGCGGGCGGCGAGCGGG - Intronic
1096835750 12:54350176-54350198 AGGGGCGGCGGGCAGGGGGCGGG - Intronic
1097043319 12:56169541-56169563 TGCGGCGGCGGCCAGGGCGGCGG + Exonic
1097237007 12:57547064-57547086 GGCGGCGGCGAGACGGGCTGGGG + Exonic
1100309155 12:93378218-93378240 GGCGAGGGCGAGTCGGGCGCAGG - Exonic
1102101508 12:110281733-110281755 GGCGGAGGCGAGGAGGCCGCGGG + Exonic
1102197185 12:111034050-111034072 GGCCGCGGCGCTCAGGGCCCGGG + Exonic
1102300335 12:111766859-111766881 GGCGGGGGCGGGCCGGGGGCGGG - Intronic
1102471390 12:113161782-113161804 GGGGGCGGGGAGGAGGGGGCGGG - Intronic
1102518484 12:113465341-113465363 GGAGGCGGCGCGCACGGCGCGGG - Intronic
1102933838 12:116881203-116881225 GGCGGCGGTGAGCTGCGCGGCGG + Exonic
1103649682 12:122422771-122422793 GGCGGCGCGGGGCCGGGCGCGGG - Intergenic
1103779406 12:123389129-123389151 GGTGGCGGCGGCGAGGGCGCGGG + Intronic
1103899309 12:124295237-124295259 CACGGCGGCGAGCAGGCTGCAGG + Intronic
1104929262 12:132329495-132329517 GGGGGCGGCGGGGAAGGCGCGGG + Intergenic
1104961521 12:132490425-132490447 GGCGGCGGCGGGCGGCGGGCCGG - Exonic
1105011927 12:132761875-132761897 GGCGCCGTCAGGCAGGGCGCGGG - Exonic
1105217491 13:18297639-18297661 GGCGGCGGCGGCTAGGGCGCAGG + Intergenic
1105943662 13:25171696-25171718 GGCGGCGGCGAGCGCGGCTCAGG - Exonic
1106157431 13:27171566-27171588 GGTGGCGGCGAGCGGGCGGCCGG - Intronic
1106447581 13:29850345-29850367 GGCGGCGGCGGGGAAGGCGGAGG - Exonic
1106517144 13:30465324-30465346 CGCCGCAGCGAGCCGGGCGCTGG - Intronic
1107307376 13:39037683-39037705 GGCGGCGGGGAGGGAGGCGCCGG + Exonic
1107481553 13:40789716-40789738 GGGAGCGGGGAGCGGGGCGCGGG + Intronic
1107851472 13:44576728-44576750 CGCGGCTGCGAGCGGGGCGGCGG + Intronic
1108594261 13:51936441-51936463 GGGGGCAGGGAGCAGGGGGCGGG + Intronic
1109284860 13:60397607-60397629 GGCGGCGGCGGCCTGGGCCCCGG + Intronic
1110318585 13:74135515-74135537 CGCGGCGGCTCGGAGGGCGCGGG + Intergenic
1110705916 13:78602133-78602155 GGCGGCGGCGGCCCGGGCGGCGG - Exonic
1110705945 13:78602190-78602212 GGCGGCGGCGGCCCGGGCGGCGG - Exonic
1112216258 13:97434115-97434137 GGCGGCGGCGGGCGGGGATCTGG + Intergenic
1112507855 13:99985575-99985597 GGCGGCGGCGGGGCGGGCGGCGG + Exonic
1113085665 13:106567522-106567544 GCGTGCGGAGAGCAGGGCGCGGG - Intronic
1113119039 13:106906634-106906656 GGCGGCGGGGCACAGAGCGCGGG + Intergenic
1113737771 13:112690357-112690379 GGGCGCGCCGAGCCGGGCGCGGG + Exonic
1113737879 13:112690692-112690714 GGCGGCCGCGGCCAGGGAGCAGG - Intronic
1113841572 13:113364193-113364215 GGCGGGGGGGGGCAGGGCGGGGG + Intergenic
1114270686 14:21098354-21098376 GGCGGCGGCGGGCGGCGGGCCGG + Exonic
1114634173 14:24178105-24178127 GGCGGCGGCGAGGAGGTGGGGGG - Exonic
1114668936 14:24398831-24398853 GGCGGGGGGGAGGAGGGGGCGGG - Exonic
1114674439 14:24430985-24431007 GGCGGAGGAGAGCAGGGCCGAGG + Intronic
1115474572 14:33800615-33800637 GGCGGCGGCGCGGGGGGCGGCGG + Exonic
1115592210 14:34874959-34874981 GGCGGCGGCGGGCGAGGAGCCGG - Intronic
1115851790 14:37595151-37595173 GGCGGCGGCGCGGCGGGCGGGGG + Intronic
1115985808 14:39102982-39103004 GGCGGCGGCGGGCTGGGGGCTGG - Intronic
1116657929 14:47674751-47674773 GGCGGCGGCGAGCGGAGCGCAGG + Exonic
1116657984 14:47675020-47675042 GGCGGGCGCGGGCAGGGGGCCGG + Intergenic
1117307244 14:54488826-54488848 GGCGGCGGCGGGCAGCGCCCAGG - Intronic
1117680680 14:58200076-58200098 GGCCGCGGCGCGCCGGGCCCGGG - Intronic
1117875934 14:60249734-60249756 GGCGGCGGCGGGCAGGCCTGGGG + Intronic
1118289038 14:64503928-64503950 GGCGGCGGCACTCAGAGCGCGGG - Intronic
1118318195 14:64738151-64738173 GAGGGCGGCCAGCAGGGAGCTGG - Intronic
1118350941 14:64972171-64972193 GCGGGCGGCGAGGAGGACGCCGG + Intronic
1119410278 14:74426080-74426102 GGCGGCGGCGGGCTGCGGGCGGG - Exonic
1120881334 14:89417139-89417161 GGCGGAGGCGAGCGGGAGGCGGG - Intronic
1121190643 14:92026466-92026488 GGCTGCGGCGAGCAAGGAGGCGG - Intronic
1121616983 14:95319909-95319931 GGCGGGCGCGGGCGGGGCGCGGG + Intergenic
1121796760 14:96741970-96741992 GGAGGGGGCGAGCAGAGCGGCGG - Intergenic
1122130722 14:99603436-99603458 GGCGGCGGCGGGGGCGGCGCCGG - Exonic
1122183491 14:99971974-99971996 GGCGGCGGGGCGCGGGACGCGGG - Intronic
1122221080 14:100239407-100239429 GGCGGTGGCGACCACGGCGGCGG + Exonic
1122265898 14:100546675-100546697 GGCGGCGGCGGGCCGGGCCGCGG + Intronic
1122273715 14:100580432-100580454 GGCAGCGGGGAGCACGGGGCGGG - Intronic
1122517619 14:102319793-102319815 GGCGGCAGCGAGGATGGCGGCGG + Exonic
1122543298 14:102509492-102509514 GGCGGCCGCGGGCGCGGCGCGGG + Intronic
1122672859 14:103385455-103385477 AGCGGCGGCCAGCAGGGCGGAGG + Intronic
1122719965 14:103716245-103716267 GGAGGCGGGGTGCGGGGCGCGGG + Intronic
1122788250 14:104173755-104173777 GGCGGCGGCTGGCAGGGCCGGGG + Exonic
1122866119 14:104604758-104604780 AGCGGCGGCGGGAAGGCCGCGGG + Exonic
1122975098 14:105167791-105167813 GCCGGCGGCGACCAGGACCCGGG - Exonic
1122975301 14:105168459-105168481 GGCGGCTGGGAGCCGGGCGCGGG - Exonic
1123004457 14:105314693-105314715 GCCGGGGGCGCGCGGGGCGCGGG + Exonic
1123036637 14:105474497-105474519 CGGGGCGGCGGGCAGGGTGCGGG - Intronic
1124109361 15:26772616-26772638 GGCGGCGGCGGCCTGGGCGGAGG - Intronic
1124109415 15:26772840-26772862 GCGGGCGGCGGGCAGGGCGCGGG - Intronic
1124427014 15:29570854-29570876 GGCGGCCGCGCGCCGGGAGCGGG + Intergenic
1124427037 15:29570920-29570942 GGCGGCGGCGGCATGGGCGCGGG - Intergenic
1124652338 15:31483306-31483328 GGCGGCGGCGCGAGGCGCGCGGG - Exonic
1125589325 15:40844577-40844599 GGCCGGGGCGAGGCGGGCGCGGG - Exonic
1125664145 15:41417068-41417090 GCGTGCGGCGAGCAGGGGGCGGG + Intronic
1125685076 15:41559174-41559196 GGAGGCGGCGGGAAGGGAGCGGG - Exonic
1125880060 15:43185724-43185746 GGCGGCGGGGAGCCGGGCTTGGG + Intronic
1126725083 15:51623128-51623150 GGCGGGGGCGAGTGGGGTGCAGG + Intergenic
1126736622 15:51737543-51737565 GGCGGCGGCGAGGGGGCCGAGGG + Exonic
1129710910 15:77819855-77819877 GGCGGCGCCGCGGAGGGGGCCGG - Intronic
1129885879 15:79036609-79036631 GGCGGTGGGGGGCAGGGCACAGG + Intronic
1130527004 15:84716079-84716101 GGGGACGGCGAGCAGGACACCGG + Exonic
1130540347 15:84817362-84817384 GGCGGCGGCGGGCAGGGGCCCGG + Exonic
1131144346 15:90001681-90001703 GGCGGGGGCGCGGGGGGCGCGGG + Intronic
1132055636 15:98648846-98648868 GGCGGCGGCGGGCGGGGGCCGGG + Intergenic
1132185318 15:99798283-99798305 GGCTGGGGCGGGGAGGGCGCAGG + Intergenic
1132476099 16:138704-138726 GGCGGCCGGGAGAACGGCGCAGG + Intronic
1132499842 16:280451-280473 GGCGGGGGCGACCCGGGTGCCGG + Intronic
1132499897 16:280619-280641 GGCGGCGGCGGGGCGGGCGGCGG + Exonic
1132519979 16:382378-382400 GGCGGGGCAGGGCAGGGCGCGGG - Intronic
1132553168 16:561451-561473 GGGGGCGGCGGGCAGGGAGAAGG + Intronic
1132586021 16:706035-706057 GCCCGCGGCGAGCGGGGCGGGGG - Intronic
1132604582 16:788421-788443 GGCGGGGGCGGGCCGGGGGCGGG - Intergenic
1132676797 16:1124392-1124414 TGGGGCGGCCAGCAGGGCGGAGG - Intergenic
1132704396 16:1236893-1236915 GGCGGGGGCGGGGAGGGGGCAGG + Intergenic
1132707120 16:1249532-1249554 GGCGGGGGCGGGGAGGGGGCAGG - Intergenic
1132724124 16:1331497-1331519 GGCAGGGGTGAGCAGGGTGCTGG + Intergenic
1132752452 16:1465055-1465077 GACGGAGGAGTGCAGGGCGCAGG - Intronic
1132828932 16:1918271-1918293 GCCGGGGGCGGCCAGGGCGCAGG - Exonic
1132915728 16:2342085-2342107 GCCGGCGGCTGGCTGGGCGCGGG - Intergenic
1133156544 16:3880392-3880414 GGCGGCGGCGGGCCGCGGGCCGG - Exonic
1133212931 16:4273138-4273160 GGCCGGGGCGAGAGGGGCGCGGG + Intergenic
1133259236 16:4537940-4537962 CACGTCGGCGAGCCGGGCGCGGG + Intronic
1133270549 16:4609094-4609116 GGGGGCGGCGGGCAGGGGGCTGG + Exonic
1134121348 16:11586870-11586892 GGCGGCGGTGAGTGCGGCGCGGG - Intronic
1135517555 16:23148720-23148742 GGCCGCGGCGCGCAGGGCCAGGG - Exonic
1135517615 16:23148939-23148961 GGCGGCGGCGGGCACGGCGGCGG + Exonic
1135517664 16:23149146-23149168 GGCGGCGGCGCGGGGGGCCCCGG - Exonic
1135745801 16:25015274-25015296 GGCGGCGGCCCGCGGGGCTCGGG + Exonic
1136110850 16:28063040-28063062 GGCGGCGGCCAGCTCGGCTCCGG - Intronic
1136110984 16:28063546-28063568 GGCGGCGGCGGACGCGGCGCGGG + Intergenic
1136375497 16:29862961-29862983 GGCGGCGGGGTCCAGGGCGCAGG - Exonic
1136453963 16:30370110-30370132 GGCGGCGGCGAGGGGGCCGCGGG + Exonic
1136479365 16:30532319-30532341 GGCAGCGGGGAGCAAGGTGCTGG + Exonic
1137426567 16:48385367-48385389 GGCGGCGGCCAGGGGGGAGCCGG - Intronic
1137534899 16:49312798-49312820 GGAGTCAGCGAGCAGGGCGTTGG + Intergenic
1137617793 16:49857319-49857341 GGCGGCGGCAGGCACGGCGCGGG + Intronic
1138265278 16:55656006-55656028 CGGGGCGGCCGGCAGGGCGCGGG - Intronic
1138450726 16:57092408-57092430 TGCCGCGGCGCGCCGGGCGCGGG + Intergenic
1138465502 16:57186764-57186786 GGCTGCGGCTAACAGGGCCCAGG + Exonic
1138619066 16:58197703-58197725 GGCCGCGGGCAGCAGGGCCCGGG - Exonic
1139358804 16:66383761-66383783 GGCTGTGGCGTGCAGGGGGCAGG - Intronic
1139402937 16:66696642-66696664 GGCGGCGGCGGGCGGGCCGCGGG - Exonic
1140124133 16:72106180-72106202 GGCGGGGGCGGGCAGGATGCTGG + Intronic
1140442640 16:74999309-74999331 GGCGGCGGCGAGCGGCGGGCGGG - Exonic
1141099342 16:81185603-81185625 GGCGGCGGCAGGCAGGATGCTGG + Intergenic
1141830107 16:86505691-86505713 GGGGCGGGCGAGGAGGGCGCGGG + Intergenic
1141961712 16:87413402-87413424 GGCGGGGGCCGGCAGGGCCCTGG - Intronic
1141972340 16:87492449-87492471 GGCGGGCGCGCGCGGGGCGCCGG + Intergenic
1141989619 16:87602603-87602625 GGGGGCCGCGGGCCGGGCGCGGG - Intronic
1142120330 16:88383627-88383649 GGCTGCGGGGAGCGGGGCCCGGG + Intergenic
1142136285 16:88453364-88453386 GGCGGCGGCGGCGAGTGCGCGGG + Exonic
1142156317 16:88534248-88534270 GGCCGCGGCGACTCGGGCGCGGG - Exonic
1142230273 16:88896856-88896878 GGCGAGGGCGAGCAGGCCGCCGG - Intronic
1142290829 16:89192995-89193017 GGGGTTGGCGAGCAGGGGGCGGG - Intronic
1142395349 16:89828572-89828594 GGCGGCGCCGCGGCGGGCGCAGG + Exonic
1142699215 17:1649329-1649351 GGCGGCGGCGCGCGGCCCGCGGG + Intronic
1142764596 17:2058095-2058117 GGCGGCGGGGACAAGGTCGCCGG + Exonic
1142982424 17:3679868-3679890 GGTGGCGGCCTGCAGGGCGAGGG - Intronic
1143099868 17:4499071-4499093 GGCGGCGGCGGGCGGCGCGGAGG + Exonic
1143482250 17:7234419-7234441 GGCGGCGGGGGGCGGGCCGCGGG + Exonic
1144775520 17:17782918-17782940 GGCGGCGGCAAGGGGCGCGCAGG - Intronic
1145963858 17:28903062-28903084 GGCGGAGGCGGGCAGGAGGCTGG + Exonic
1146149907 17:30458531-30458553 GGCGGCAGGGAGCAGGGAGGTGG - Intronic
1146255988 17:31391787-31391809 GGCGGCGGCGGGCAGGCGGCGGG + Exonic
1146896472 17:36545273-36545295 GGCGGCGGGGAACAGGCTGCGGG + Intronic
1147123713 17:38351965-38351987 GGCCGCGGCGGGCGGGGCTCCGG + Intergenic
1147160148 17:38564761-38564783 GGGGGCGGGAAGCAGGGCCCAGG + Intronic
1147754797 17:42761213-42761235 GGCGGCGCTGAGCCGGGCCCGGG - Exonic
1147786303 17:42980818-42980840 GGCGGCTGCGGGCAGAGCGGCGG + Exonic
1148122712 17:45222140-45222162 GGCAGCGCCGAGCAGCCCGCGGG + Exonic
1148146917 17:45371827-45371849 GACGGCCGCGGGCAGCGCGCAGG - Intergenic
1148271755 17:46266996-46267018 GCGGGCGGCGAGCCGGGGGCCGG - Intergenic
1148403321 17:47386879-47386901 GGCGGCGGCGGGGAGGGGGTGGG - Intronic
1148406989 17:47424135-47424157 GGCGGCGCCGAGCAGCCCGTGGG - Intronic
1148493466 17:48037808-48037830 GGCGGCGGCGGGCAGGCGGCGGG - Intronic
1148698903 17:49576593-49576615 GCCGGGGGCGAGTGGGGCGCGGG + Intronic
1148710672 17:49678324-49678346 GGGGGTCGCGCGCAGGGCGCGGG + Intergenic
1148768987 17:50056198-50056220 GACGGCGGCGACCCGGCCGCTGG + Intronic
1148782597 17:50130087-50130109 GGCGGCGGGGAGGAGGCGGCTGG + Intergenic
1148911329 17:50944606-50944628 GGCGGCCGAGGGCAGCGCGCTGG - Intergenic
1150125552 17:62632397-62632419 GGCTGAGGGGAGCAGAGCGCAGG - Intronic
1150168547 17:62966834-62966856 GGCGGGGGCGAGCGGGGAGACGG + Intergenic
1150225597 17:63523088-63523110 GGCGGCGGGGAGGGGGCCGCTGG - Intergenic
1150249637 17:63698771-63698793 GGCGGGGGCGGGCAGGGCAGGGG + Intronic
1150373586 17:64662151-64662173 GGCGGCCGCGAGGAGGCGGCGGG - Intergenic
1150583631 17:66498123-66498145 GGAGGCGGGGAGCAGGGGGGAGG - Intronic
1150643458 17:66964594-66964616 GGGGGAGGCGCGGAGGGCGCAGG + Intergenic
1151358006 17:73571761-73571783 GGCAGGGGAGGGCAGGGCGCTGG - Intronic
1151570643 17:74923778-74923800 GGCGGGGGCGGGCAGGGCGGTGG + Intergenic
1151812597 17:76453178-76453200 AGCGGCGGCGAACGAGGCGCGGG + Exonic
1151828699 17:76537583-76537605 GGTGGCGGGGCGCGGGGCGCGGG + Exonic
1151836431 17:76585631-76585653 CGCAGGGGCGACCAGGGCGCGGG - Intronic
1152175154 17:78782334-78782356 GGCGCGGGCGGGCGGGGCGCGGG - Intergenic
1152357716 17:79814836-79814858 GGCGGCGGCGGGAGGGGCGCGGG + Intergenic
1152564219 17:81092989-81093011 GGGGGCAGGGAGCAGGGCCCGGG + Intronic
1152617832 17:81346025-81346047 GGCCGCGGGGCGCGGGGCGCTGG - Intergenic
1152617897 17:81346186-81346208 AGAGGCGGGGAGCACGGCGCTGG - Intergenic
1152644120 17:81460990-81461012 GGCAGCGGCCAGCAAGGGGCCGG + Exonic
1152654868 17:81514804-81514826 GGCGGAGGCGGGCGGGGCTCCGG - Intronic
1152728930 17:81960558-81960580 GGCGGGGAGGTGCAGGGCGCGGG + Intronic
1152732211 17:81977883-81977905 GGTGACGGCGAGCAGGGGGCGGG - Intronic
1152758919 17:82098349-82098371 GGCGGCGGCGCGCCGGGTCCCGG - Intergenic
1152924083 17:83079673-83079695 GGCGGCCGCGCGGAGGACGCGGG + Exonic
1152924099 17:83079736-83079758 GGAGCCGGCGAGCCGGGCGGGGG - Exonic
1153051818 18:907742-907764 GGCGGCGGCGCGCGGCGCGGAGG - Exonic
1153688108 18:7566909-7566931 GGCGGCTTCGAGCCTGGCGCCGG - Exonic
1153794499 18:8609764-8609786 GGCGGCGGCGGTCTGGGCGCGGG + Exonic
1153855090 18:9137213-9137235 GGCGGCGGCGGGCGGGGCCCCGG - Intronic
1153900770 18:9614941-9614963 GGCTGCGGCTGGCAGGGCGGTGG - Intronic
1155392719 18:25352302-25352324 GGCGGCGGCGGGCGGGGCTCGGG - Intergenic
1155507631 18:26548421-26548443 GGCGAGGGCGAGCGCGGCGCGGG - Intronic
1156099634 18:33578379-33578401 GGCGGCGGCGCGCGGCGGGCGGG - Intergenic
1157251465 18:46099624-46099646 GGCGGTGGTGGGCAGGGCGTGGG + Intronic
1157279084 18:46334143-46334165 GGAGGCGGAGCGCGGGGCGCGGG - Intronic
1158259106 18:55588145-55588167 GGCGGCGGCGGGGAGGCAGCAGG - Intronic
1158725707 18:59969689-59969711 GGCGGCGCCGAGCAGCCCGTGGG - Intergenic
1160201760 18:76801944-76801966 GGCCAGGGCGAGCAGGGTGCGGG + Intronic
1160453345 18:78979750-78979772 GGCGGCGGCGGGGGGGGCGCGGG + Intergenic
1160719163 19:589997-590019 GGCGGCGGCGGCCCCGGCGCGGG - Exonic
1160810596 19:1011351-1011373 GGCTGCGGTGAGCGTGGCGCGGG - Exonic
1160861843 19:1240462-1240484 GGCGTCGAGGAGCAGCGCGCCGG + Intergenic
1160897014 19:1407843-1407865 GGCGGCGGGGAGCGGCGGGCCGG - Intronic
1160935480 19:1592650-1592672 GGCGGCGGCGGGCCCGGCGGCGG - Exonic
1160935490 19:1592675-1592697 GGCGGCGGCGAGTGGGGGTCCGG - Exonic
1160947871 19:1652009-1652031 GGCGGGGGCGCGGGGGGCGCCGG - Intronic
1160948032 19:1652418-1652440 GGCGGCGGCGCGCGTGGCCCGGG + Intronic
1160967701 19:1753837-1753859 GGCGGCGGCGGTGGGGGCGCCGG + Exonic
1160991766 19:1863129-1863151 GGCGGCGGAGGGCGCGGCGCCGG + Exonic
1161006664 19:1940716-1940738 GGCGGTGGCGGGCGCGGCGCGGG - Intergenic
1161257996 19:3320410-3320432 GGCGGCGGCCGGGCGGGCGCGGG - Intergenic
1161272409 19:3397385-3397407 GGTGCCGGTGAGCAGGCCGCAGG + Intronic
1161309361 19:3585552-3585574 GGCGGCGGCGGCGAGGGCCCGGG + Exonic
1161333783 19:3700300-3700322 GGCGGCAGAGAGCGGGGCGGCGG - Exonic
1161353395 19:3805992-3806014 GGCGAGGGAGAGGAGGGCGCAGG - Exonic
1161608816 19:5229666-5229688 CGCGGCGGCGCGCTGGGCACTGG + Exonic
1161802630 19:6424544-6424566 GGCGGCGGCGGCCCGGGCGGGGG - Exonic
1161802692 19:6424655-6424677 GGCGGCGGCGGCCCGGGCGGGGG + Exonic
1161959609 19:7516358-7516380 GCCGGCGGCGCGCAGGGCGGGGG - Intronic
1161973368 19:7596101-7596123 GGCGGCGGCCAGCCTGGCGTGGG + Exonic
1162033208 19:7926059-7926081 GGCGGCGGCGGCCCGGGCTCCGG + Exonic
1162395829 19:10417710-10417732 GGCGGCGGCGAGGGCGACGCAGG - Intronic
1162550518 19:11355694-11355716 GGAGGCGGCGAGCTGGGGGAGGG + Intronic
1162778649 19:12995601-12995623 GGCAGCGGCGAGCGCGGCGGCGG + Exonic
1163085988 19:14979905-14979927 CGCGGCTCCGAGCAGGGGGCGGG - Intronic
1163158897 19:15453289-15453311 GGCGGCGGCGGGCAGGACGCCGG + Exonic
1163442480 19:17328812-17328834 GGCGGCGGGGCGCAGGGCGCCGG + Exonic
1163585510 19:18161455-18161477 GGCGGCGGCGAGGACGGCGGCGG - Exonic
1163586788 19:18168692-18168714 GGCGGTGGCGGGGAGGGCCCTGG - Intronic
1163606926 19:18280808-18280830 GGCGGCGGCGGGAAGGGCACAGG + Exonic
1163655661 19:18543514-18543536 GGGGGCGGGGAGGGGGGCGCAGG - Exonic
1163681180 19:18683588-18683610 ACGGGCGGCGAGCAGTGCGCAGG - Intergenic
1163729533 19:18941156-18941178 GAGGGCGGCGCGGAGGGCGCGGG - Intronic
1163774819 19:19211952-19211974 GCCAGCGGAGCGCAGGGCGCAGG + Exonic
1164590132 19:29502127-29502149 GGTGGTGGCGAGCAGGTCACTGG + Intergenic
1165089159 19:33373700-33373722 GGCGGCGGCGCGCGCGGCCCCGG + Exonic
1165093461 19:33398132-33398154 GGCCACGGGGAGCAGGGCGGCGG - Intronic
1165248846 19:34513936-34513958 GGTGGCAGAGAGCAGGGCCCTGG + Intergenic
1165266186 19:34665074-34665096 GGTGGCAGAGAGCAGGGCCCAGG - Intronic
1165349688 19:35269073-35269095 GGCGGGGGCGGGGGGGGCGCGGG - Exonic
1165466737 19:35979123-35979145 TGCGGCGGGGCGCAGGGCTCGGG - Intergenic
1166097364 19:40549263-40549285 GGAGCCGGCGAGCAAGGAGCTGG + Exonic
1166317805 19:41998642-41998664 GCCGCGGGCGAGAAGGGCGCAGG - Exonic
1167456999 19:49601616-49601638 GGCGGTGGTGAGCTGGGCGTGGG - Exonic
1167797545 19:51719640-51719662 GGCGGCGGCGCGGGGGCCGCTGG - Exonic
1168100394 19:54138248-54138270 GGCGGCGGCGGGCGGGGCCCGGG - Intronic
1168239434 19:55081832-55081854 GGCGGAGGCGGCCAGGGTGCTGG + Exonic
1168246955 19:55117289-55117311 GGCGGGGTCGAGCTCGGCGCCGG + Exonic
1168324256 19:55530082-55530104 GGCGGGGGCGCGCAGAGCTCGGG + Exonic
1168549457 19:57280809-57280831 GGCGGCGGCGTGGATGGCTCCGG + Exonic
1168641384 19:58034050-58034072 GCCCGCGGCGCGCAGGGTGCGGG + Exonic
925984731 2:9206729-9206751 GGCGGCGGCCGGCCGGGCGTGGG - Intergenic
926089871 2:10043188-10043210 GGCGGCGGGGCGGAGGGGGCGGG - Intronic
926130968 2:10302915-10302937 GGCGGCGGCGGGCAGCGGACGGG + Intronic
927155683 2:20219911-20219933 GGAGGCGGGCAGCATGGCGCGGG - Intronic
927787262 2:25982452-25982474 GGCGGCGGCGGGGAAGGCGGAGG - Exonic
927964777 2:27262250-27262272 GGGGGCGGCGAGGAAGGAGCAGG - Intronic
928421121 2:31138407-31138429 GGCGGCAGCGGGCAAGGCGGCGG - Intronic
929055793 2:37875121-37875143 GGTGGGGGCGAGCTGGGCGCTGG + Intergenic
929604531 2:43226087-43226109 GAGGGCGGCAAGGAGGGCGCCGG - Intronic
929936326 2:46297043-46297065 GGCGGCCGGGAGCCGGGCTCCGG - Intronic
931348830 2:61470820-61470842 GGCGGCGGCGGGGACGGGGCGGG + Intergenic
933684679 2:85133617-85133639 GGCCGGGCCGGGCAGGGCGCGGG + Exonic
933858473 2:86441563-86441585 GGGGCCGGGGAGCTGGGCGCCGG + Intronic
934296812 2:91749012-91749034 GGCGGCGGCGGCGAGGGTGCGGG - Intergenic
934751561 2:96797293-96797315 GGCCGGGGTGAGCAGGGAGCAGG + Intronic
934966813 2:98730973-98730995 GGCGGCTGCGCGGAGGGCGCGGG - Intronic
935592561 2:104855622-104855644 GGCGGCGGCGGGGGCGGCGCAGG + Exonic
935645297 2:105329590-105329612 GGCGGCGGGGCGCGGGGTGCGGG - Intronic
936114682 2:109692291-109692313 GGGGGCGGTGGGGAGGGCGCTGG + Intergenic
936126709 2:109794600-109794622 GGCGGCGGCGGGGGGGGCGGCGG + Intronic
936561299 2:113541830-113541852 GGCGGGCGGGTGCAGGGCGCGGG + Intergenic
937045110 2:118846986-118847008 GCGGGCGGCGAGGGGGGCGCAGG + Exonic
937950848 2:127387362-127387384 GGGGGCCGCGGGCTGGGCGCCGG - Intronic
937993276 2:127675509-127675531 GGAGGTGGCGAGCAGAGCCCGGG - Intronic
938073064 2:128318537-128318559 GGCGGCGGCGCGCCGGCGGCAGG - Exonic
941911715 2:170770872-170770894 GGGCGCGGCGAGGAGGGCCCGGG - Intergenic
942240813 2:173963732-173963754 GGCGGGGGCGGGCCGCGCGCGGG + Intronic
942277260 2:174332485-174332507 GAGGAAGGCGAGCAGGGCGCCGG + Intergenic
942446145 2:176080249-176080271 GGCGGCGGCGGCGGGGGCGCCGG - Exonic
946306518 2:218859737-218859759 GGGGGCGGGGGGCAGGGGGCCGG - Intergenic
946391305 2:219418405-219418427 GGAGGCGGCGGGCAGGCGGCCGG - Exonic
946843206 2:223837660-223837682 GGGAGCGGGGAGGAGGGCGCGGG - Intronic
946982117 2:225229482-225229504 GGCGCCGTGGAGCAGGGGGCGGG + Intergenic
947012596 2:225582639-225582661 GGGGGCGACGAGGAGAGCGCAGG - Exonic
947407149 2:229790514-229790536 GGCGGCAGGGGGCAGGGAGCAGG + Intronic
947592937 2:231395592-231395614 GGCGGCGGCGGGGCGGGCCCTGG + Exonic
947637830 2:231689008-231689030 GGCGGCCGGGAGCAGGAGGCTGG + Intergenic
947641154 2:231708570-231708592 GGCTGCGGCGAGCAAGGAGGCGG - Exonic
947765255 2:232633682-232633704 GGCGGCGGATCGCAGGACGCGGG - Exonic
947992154 2:234496674-234496696 GGCGGCGGCGGGCGGGGCCCAGG - Exonic
948140563 2:235669799-235669821 GGCCGCGGTGCGCAGGGCCCAGG - Intronic
948415325 2:237798796-237798818 GGCTGCGGAGAGCGGGGCGCTGG + Exonic
948438116 2:237967356-237967378 GGCGTCGGCGGCCGGGGCGCTGG + Intronic
948445054 2:238026132-238026154 GGGGGCGGCGAGCTGGACTCAGG - Intronic
948487237 2:238288706-238288728 GGCGGCGGCGGGCGCGGGGCCGG - Intronic
948772311 2:240257992-240258014 GGCGGCGGAGAGCCAGGAGCGGG + Intergenic
948801580 2:240435729-240435751 GGCGGCGGCGCGGGGCGCGCGGG - Exonic
948801710 2:240436182-240436204 GGCGGCGGGGCGCAGGCGGCAGG - Intronic
949012148 2:241686953-241686975 GGCGGCGCGGCCCAGGGCGCAGG - Exonic
1168855027 20:1002229-1002251 GGCGGCGGCACGGCGGGCGCGGG + Exonic
1169143556 20:3238931-3238953 AGCCGCGGGGAGGAGGGCGCGGG - Intronic
1169236315 20:3932737-3932759 GGAGGCGGAGAGCAGGGCTGTGG + Exonic
1169278451 20:4248779-4248801 GGCGGCGGCGTGGTGGGCGCAGG - Exonic
1170623323 20:18011835-18011857 GGCTGCGGCGAGCAAGGAGCCGG - Intronic
1170847580 20:19975157-19975179 AGCGGCGGCCGGCCGGGCGCAGG + Exonic
1172101184 20:32484479-32484501 GGGGGCGGGGAGGAGGGCGGAGG - Intronic
1172118473 20:32584697-32584719 GGCGGCGGCGGGACTGGCGCGGG - Intronic
1172143914 20:32743277-32743299 GGCGGCGGGGCGTGGGGCGCGGG - Intronic
1172245599 20:33443403-33443425 GGCGCCGCGGAGCCGGGCGCCGG - Exonic
1172284644 20:33732143-33732165 GGCCGCGGGGCGGAGGGCGCCGG + Intronic
1172586957 20:36092192-36092214 GAGGTCGGCGAGCTGGGCGCGGG + Intronic
1172684810 20:36745811-36745833 GTCGCCGGCGGGCTGGGCGCGGG + Intronic
1172684909 20:36746112-36746134 GGCGGCGGCGAGAGGGGCGGGGG + Intergenic
1172702670 20:36862839-36862861 GGCTGCTGCGCGGAGGGCGCGGG + Exonic
1172842110 20:37908207-37908229 GCAGGCGGCCAGCAGGACGCAGG + Intronic
1173489178 20:43465613-43465635 GGTGGCGGGGAGGAGGGGGCAGG + Intergenic
1173930142 20:46811340-46811362 GGCGGCGGGGCGGAGGGCGGGGG - Intergenic
1173939041 20:46894684-46894706 GGCGGCTGGACGCAGGGCGCGGG - Exonic
1174342485 20:49906528-49906550 TGCGGCGGCGGGCAGAGGGCCGG - Exonic
1174357829 20:50010114-50010136 GGCGGCGGCGAGGGGGCGGCGGG + Intergenic
1175215869 20:57391508-57391530 GGGGGCGGCGGGGAGCGCGCGGG - Exonic
1175264366 20:57693511-57693533 GGTGGCGGCCAGCAGGTGGCAGG + Intronic
1175267076 20:57709592-57709614 GGCGGCGCGGCGCGGGGCGCGGG + Exonic
1175340933 20:58228593-58228615 GGCGGGGGCGGGCGGAGCGCGGG - Exonic
1175491648 20:59384289-59384311 GGAGGAGGCGAGCAGGGAGGAGG + Intergenic
1175715504 20:61252411-61252433 GGCGGCGGCGATCGGAGCGGCGG + Exonic
1175847242 20:62065382-62065404 GGCGGCGGGCACCGGGGCGCAGG + Exonic
1175873828 20:62220346-62220368 GGCGGGGGCGGGGAGGGGGCGGG - Intergenic
1175910621 20:62403631-62403653 GGCGGCGGGGAGGAGGCTGCAGG + Intronic
1176005658 20:62861183-62861205 GGCGCCGCCAAGGAGGGCGCGGG - Exonic
1176057268 20:63155357-63155379 GGAGGAGGCGAGCAGGGAGCAGG + Intergenic
1176062317 20:63177826-63177848 GGCGGCGGCGCGGGAGGCGCAGG + Intergenic
1176072418 20:63234160-63234182 GGCGAAGGCGAGGTGGGCGCTGG + Intergenic
1176286233 21:5020856-5020878 GGCGCAGGTGAGGAGGGCGCAGG - Intergenic
1176549761 21:8216104-8216126 GGGGGCGGGGAGCGGGGCGTGGG - Intergenic
1176557652 21:8260333-8260355 GGGGGCGGGGAGCGGGGCGTGGG - Intergenic
1176568686 21:8399138-8399160 GGGGGCGGGGAGCGGGGCGTGGG - Intergenic
1176576600 21:8443373-8443395 GGGGGCGGGGAGCGGGGCGTGGG - Intergenic
1178124255 21:29499983-29500005 GGCAGCAGAGAGCAGGCCGCAGG + Intronic
1178707639 21:34888810-34888832 GGCGGCGGCGAGCCGCGCCCTGG - Intronic
1179375460 21:40846768-40846790 GGCGGCGGCGGGCGGCGGGCGGG - Exonic
1179674892 21:42974695-42974717 GGCGGCGGCGAGAGCGGCGGCGG - Intronic
1179782087 21:43707819-43707841 GTGGGAGGCGAGCAGGGAGCAGG - Intergenic
1179783814 21:43718825-43718847 TGCGGCGGGGCGCGGGGCGCGGG + Intergenic
1179870948 21:44242619-44242641 GGCGCAGGTGAGGAGGGCGCAGG + Intergenic
1180064297 21:45405065-45405087 GGCGGGCGCGGGCAGGGGGCGGG - Intergenic
1180559064 22:16601417-16601439 AGCGGCGGCGCGCGGGGGGCGGG + Intergenic
1180843640 22:18970443-18970465 GCCGCGGGCGCGCAGGGCGCGGG - Intergenic
1180960316 22:19759465-19759487 GGCGGCGCCGGCCAGGCCGCCGG + Intronic
1181514282 22:23402430-23402452 GGCTGCGGGGAGACGGGCGCCGG - Intergenic
1182445503 22:30387273-30387295 GGCGGCGGCGATCTCAGCGCGGG + Exonic
1182549691 22:31094092-31094114 GGCGGCAGGGAGCTGGGGGCTGG - Intronic
1183255140 22:36757128-36757150 GGCGGCTGGGAGCCGGGCTCTGG + Intergenic
1183339785 22:37273868-37273890 GGAGGAGGAGAGCAGGGCACGGG - Intergenic
1183351151 22:37335331-37335353 GGAGGAGGCGAGGAGAGCGCGGG - Intergenic
1183393711 22:37560334-37560356 GGCGGCCGCGAGGACGGTGCCGG + Intergenic
1183605968 22:38866864-38866886 GGGGGCGCCGGGCAGGGGGCCGG - Exonic
1183912951 22:41092452-41092474 GGCGGCGGCGCGGAGCGCGGCGG + Exonic
1184164789 22:42720817-42720839 GGCGGCGGACAGCGGGGCCCCGG + Intronic
1184333757 22:43841402-43841424 GGGTGCGGGGAGCAGGGCTCTGG + Intronic
1184412230 22:44331876-44331898 GGCGGCGGCGGGCGCGGCGCGGG - Intergenic
1184412271 22:44332032-44332054 GGACGCGGCGGGCAGGGCGGCGG - Intergenic
1184445307 22:44543763-44543785 GGCGGGGGCGGGCGGGGGGCGGG + Intergenic
1184787733 22:46680005-46680027 GGAGGCTGGGAGCAGGGGGCAGG + Intergenic
1185271081 22:49929552-49929574 GGCGGGAGCGGGCGGGGCGCGGG - Intergenic
1185330796 22:50251302-50251324 AGCGACCGGGAGCAGGGCGCGGG - Exonic
1185413430 22:50697574-50697596 GGCGGCGGTGCGGGGGGCGCAGG - Intergenic
1185417943 22:50720336-50720358 GGCGGCGGCGAGAAGGCCGGGGG - Intergenic
1203254650 22_KI270733v1_random:132430-132452 GGGGGCGGGGAGCGGGGCGTGGG - Intergenic
1203262706 22_KI270733v1_random:177509-177531 GGGGGCGGGGAGCGGGGCGTGGG - Intergenic
949260740 3:2099775-2099797 GACGGCGGCGAACTGTGCGCCGG + Intronic
950000031 3:9649588-9649610 GGCGGCGGCGGCCCGAGCGCCGG - Exonic
950729772 3:14947548-14947570 CGCGGCGGCGAGGCTGGCGCTGG + Intergenic
953023263 3:39129519-39129541 GGGGGAGGCAAGCAGGGCTCAGG - Intronic
954256488 3:49411491-49411513 AGCGGCGCCGGGCAGGGCGGGGG - Intronic
954553291 3:51499734-51499756 GCCGCCGGCGAGGAGGGGGCGGG - Intronic
955430776 3:58842568-58842590 GGCGGCAGCGAGCTGGGGGAGGG + Intronic
956229461 3:66998067-66998089 GGAGGTGGAGAGCAGGGAGCTGG - Intergenic
956678029 3:71753683-71753705 GGCGGCGGCGGGCCCGGCGGGGG + Intronic
956716832 3:72086910-72086932 GGCAGCGGTGCCCAGGGCGCCGG + Intergenic
956978917 3:74614421-74614443 GGCGGCGGCGAGTGGGCCGTCGG - Intergenic
958026982 3:88059668-88059690 GGGGGCGGGGAGCAAGGCGAGGG + Intronic
959539812 3:107525074-107525096 GGCGGCGGCGCGCAGGGGCGGGG - Intronic
959539866 3:107525229-107525251 GGCAGCGCCGGGCCGGGCGCCGG + Intronic
961305703 3:125958296-125958318 GGCTGCCGCGAGCTAGGCGCTGG + Intergenic
961539750 3:127591254-127591276 CGCCGCGTGGAGCAGGGCGCTGG - Intronic
961603358 3:128076887-128076909 GGCAGCTGCGGGGAGGGCGCGGG - Intronic
961665747 3:128492430-128492452 GGCTGCGGGGCGCAGCGCGCGGG + Intronic
961735930 3:129002153-129002175 GGCGGCGGCGCGGACGGCGCAGG - Exonic
962407583 3:135113149-135113171 GGCGGGGGCCAGCATGGGGCGGG - Intronic
962498629 3:135966489-135966511 GGCGGCGGCCAGGTCGGCGCGGG - Intronic
962770921 3:138609237-138609259 TGCGGCGGGGCGCGGGGCGCGGG + Intronic
963733122 3:148991651-148991673 GGCGGCGGCGGGCTGCGCGGCGG - Intronic
965404118 3:168249489-168249511 GGAGGGGTCGAGGAGGGCGCAGG + Intergenic
966182129 3:177197299-177197321 GGGGGCGGGGAGCGCGGCGCGGG + Intronic
966933715 3:184691953-184691975 GGGGCCGGCGGGCAGGGTGCAGG + Intergenic
967168697 3:186806773-186806795 GGCGGCGGCGCGCGGGCCTCTGG + Intronic
967904106 3:194486805-194486827 GGCGGCGGCGTGCAGCCGGCAGG + Intronic
967924187 3:194633387-194633409 GGCGGCGGCGGCGAAGGCGCCGG + Exonic
968434048 4:575985-576007 GGCGGCGGCGCTGAGCGCGCAGG + Intergenic
968583098 4:1403915-1403937 GGAGGCGCTGAGCAGGGGGCGGG - Intronic
969032611 4:4226770-4226792 GAGGGAGGCGAGCAGGCCGCTGG + Exonic
969075631 4:4575549-4575571 GGAGGCAGCGAACCGGGCGCCGG - Intergenic
969413378 4:7043540-7043562 GGCTGCGGCGGGCCGGGCGGCGG + Exonic
969721371 4:8894460-8894482 GGCAGCGCCTGGCAGGGCGCAGG - Intergenic
973137338 4:46724501-46724523 GGCGGCGGGGCGCTGGGTGCCGG + Intergenic
975410011 4:74038585-74038607 GGCGGCGGAGAGCGTGGCGTGGG + Exonic
975415399 4:74099094-74099116 GGCGGCGGAGAGCGTGGCGCGGG + Exonic
976246468 4:83010786-83010808 GGCGGCGGCGGCCCGGGCTCCGG - Exonic
976390405 4:84499398-84499420 GGGGCCGGCGAGCCGGGCGCAGG + Intergenic
978749526 4:112231695-112231717 GTTGGCGGCGAGCAGGGGCCTGG + Intergenic
979523780 4:121696901-121696923 AGCGGCGGAGAGCCGGGCGACGG + Exonic
980130015 4:128809785-128809807 GGCCGCGGCGGGCGGGGAGCCGG - Exonic
980210507 4:129781566-129781588 GGTGGGGGCGAGCAGGGAGGTGG + Intergenic
981782835 4:148445379-148445401 GGGGGCGCCGAGGAGGGAGCGGG + Intergenic
982198174 4:152936433-152936455 GGCGGGGGCGACCGCGGCGCGGG + Intronic
983792348 4:171813435-171813457 GGCGCCGGGGAGTGGGGCGCGGG + Intronic
983938436 4:173518845-173518867 GGAAGCGGGGAGCAGGGGGCGGG - Intergenic
984734847 4:183099358-183099380 GGCTGAGGGGCGCAGGGCGCGGG - Exonic
984778944 4:183506139-183506161 GGCGGTGGCGAGCTGGCTGCTGG + Intronic
985280614 4:188282809-188282831 GCCGGCGGTGTGCAGGGCCCCGG + Intergenic
985550147 5:528677-528699 GGCGCGGGGGAGCGGGGCGCGGG - Intergenic
985675129 5:1227023-1227045 GGCGTCGGCGGGCAAGGCGTTGG - Intronic
985675147 5:1227083-1227105 GGCGTCGGCGGGCAAGGCGTCGG - Intronic
985675151 5:1227098-1227120 GGCGTCGGCGGGCAAGGCGTCGG - Intronic
985727523 5:1523897-1523919 GGCCGGGGCTAGCTGGGCGCGGG + Exonic
986813642 5:11385098-11385120 GGCGGCGGCGGGCGGCGCGTCGG + Exonic
987108707 5:14664894-14664916 GGAGGCGGCGGCCACGGCGCGGG + Exonic
987258150 5:16179097-16179119 GGCGGCGGCGACCAGCGCGCTGG - Exonic
988755568 5:34244889-34244911 GGGGGCGGGGAGCAGGGTGAGGG + Intergenic
989812567 5:45695858-45695880 GGCGGCGGCGAGGAGCCGGCGGG - Exonic
992391619 5:76336027-76336049 GGGGGCGGCTAGCCGGGCGGGGG + Intronic
992550141 5:77851994-77852016 GGTGGCGGGGAGCCGGGAGCCGG - Intronic
992939649 5:81750479-81750501 GGCGGCGGGGGCCTGGGCGCTGG - Intronic
993803844 5:92379179-92379201 GGCAGCTGACAGCAGGGCGCAGG + Intergenic
995388313 5:111612255-111612277 GGCGGGGGCGGGGTGGGCGCGGG + Intergenic
997560974 5:134846048-134846070 GGCGGCGGCGAGGCAGGCGCTGG - Exonic
997596954 5:135113470-135113492 GGCAGAGGCGGGCAGGGGGCTGG - Intronic
997732652 5:136192464-136192486 GGCGGCGGTAGGCAGCGCGCTGG - Intergenic
997926322 5:138033529-138033551 GGTGGGGGCGGGCAGGACGCAGG - Intronic
998026412 5:138820029-138820051 GGCGGTGGGGGGCAGGGCGGGGG - Intronic
999062813 5:148654171-148654193 GGGGGCGGCAGGGAGGGCGCAGG - Intronic
999062879 5:148654364-148654386 GGCGGCAGCGGGCAGGGCAGCGG - Intronic
999768170 5:154756040-154756062 GGCGGCGGCGAGCCAGGCGCTGG + Intronic
1002001663 5:176199613-176199635 CGCGGAGGGGAGCGGGGCGCGGG + Intergenic
1002140521 5:177134566-177134588 AGCGGCGGTGCGCAGGCCGCAGG - Intronic
1002252675 5:177939370-177939392 CGCGGAGGGGAGCGGGGCGCGGG - Intergenic
1002512776 5:179733421-179733443 GGCCACGGTGAGTAGGGCGCGGG + Exonic
1002580927 5:180209099-180209121 GGCGGCGGCGGGCGGCGCCCCGG - Intronic
1002784712 6:392390-392412 AGCGGAGGCGGGGAGGGCGCGGG - Intronic
1002888043 6:1312888-1312910 GGCGACGGCGAACAGAGTGCGGG + Exonic
1002897998 6:1390176-1390198 GGCGGCGGCGGCGCGGGCGCCGG + Exonic
1002927180 6:1611328-1611350 GGCGGCGGGGCGGAGGGCGCGGG - Exonic
1002927249 6:1611577-1611599 GGCGGCGGCGCGGGGGCCGCGGG + Exonic
1003569467 6:7246744-7246766 GGCGACGGCGAGGCAGGCGCCGG + Exonic
1004627921 6:17393926-17393948 GGGCGCGGCGACCCGGGCGCGGG + Intronic
1004690349 6:17987698-17987720 GGCGGCGGCGGGCGGGGAGGAGG + Intergenic
1004864565 6:19838992-19839014 GGGGGACGCGGGCAGGGCGCCGG + Intronic
1005484327 6:26285373-26285395 CGCCGCGACGAGCAAGGCGCCGG + Exonic
1005554203 6:26956662-26956684 GGGGGCGGGGAGCAGGGTGAGGG + Intergenic
1005643990 6:27824229-27824251 CGCCGCGGCGAGCAAGGCGCCGG - Exonic
1005645207 6:27831401-27831423 CGCCGCGGCGAGCAAGGCGCCGG + Exonic
1006455977 6:34132163-34132185 GGAGGCGGCAAGGAGGGGGCTGG + Intronic
1006547470 6:34791953-34791975 GGCGGCGGCGCGCGCAGCGCCGG - Intergenic
1006618004 6:35342775-35342797 GGCGGCGGGGAACGGGGTGCGGG + Intronic
1007432878 6:41786639-41786661 GGCGGCGGCGCGCACGGCCCAGG + Intronic
1007521375 6:42453308-42453330 AGCAGCTGCGAGCAGGGGGCAGG + Intergenic
1007557817 6:42782014-42782036 GGCGGCGGCGGGCGCGGGGCCGG - Exonic
1007558014 6:42782799-42782821 CGGGGCCGCGAGCAGGGGGCAGG + Intronic
1007665312 6:43510005-43510027 TGCGGAGGCGTCCAGGGCGCGGG + Exonic
1007701917 6:43770781-43770803 CGCGGCGGCGAGCCGCGGGCAGG + Exonic
1008038838 6:46774926-46774948 GGCGCCGTGGAGCAGGGGGCGGG - Intergenic
1008883873 6:56410911-56410933 GGGGGCGGTGAGGAGGGAGCAGG - Intergenic
1010001733 6:70956054-70956076 CGCGGCGGCGCGCAGCGAGCTGG - Exonic
1010419080 6:75651585-75651607 GGCTGAGGCGAGCAGATCGCTGG - Intronic
1011416255 6:87122776-87122798 GGCGGCGGCGGGCCTGGGGCCGG + Intergenic
1011517227 6:88166892-88166914 GGCGGCAGCGAGCTGGGCCCGGG + Intergenic
1012399972 6:98834946-98834968 GGCGGCATGCAGCAGGGCGCGGG + Exonic
1012400013 6:98835096-98835118 GGCGGCGGCGGGGGGGGCGGGGG + Exonic
1012401261 6:98844388-98844410 GGGGGCGGCGGGCACGGCGCTGG - Intergenic
1013082051 6:106821621-106821643 GGAGGCGGGGAGAAGGGGGCAGG - Intergenic
1013099480 6:106974867-106974889 GGCGGCGGCGGCGGGGGCGCTGG - Intronic
1014019523 6:116571477-116571499 GGCGGCGGCCAGGCGGGCGCAGG - Exonic
1014045306 6:116877432-116877454 CCCGGGGGCGAGCAGGGCGGCGG + Exonic
1014272573 6:119349937-119349959 GCCGGCGGCGGGGAGGTCGCGGG + Intergenic
1014632452 6:123803640-123803662 TGGGGCGGGGAGCGGGGCGCGGG - Intergenic
1015910195 6:138161887-138161909 CGGGGCGGCGGGCGGGGCGCGGG + Intergenic
1015976420 6:138795929-138795951 GGCGGTGGCTCGCACGGCGCGGG + Intronic
1016433137 6:144008419-144008441 CGCGGCCGCGAGGAGGGCGCTGG + Intronic
1016982287 6:149864266-149864288 GGCGGAGAGGCGCAGGGCGCTGG - Intergenic
1017103138 6:150865876-150865898 GGAGGCGGCGCGGAGGGCCCGGG - Exonic
1017671971 6:156777710-156777732 GGCGGCGGCGGCGCGGGCGCGGG + Intergenic
1017877645 6:158537217-158537239 GGGGGCGGCGAGGCGGGCGCGGG - Intronic
1018020917 6:159761884-159761906 GGCGGAGGCGCGCGGGGCGCGGG - Exonic
1018400289 6:163414490-163414512 GGCGGCGGGCAGCAGGCAGCGGG + Intronic
1018876507 6:167826810-167826832 GGCGGCGCCGCGCGGGGCGGCGG + Intergenic
1018876516 6:167826844-167826866 GGCGGCGGCGCGCACGGCGGCGG + Intergenic
1018876522 6:167826856-167826878 CACGGCGGCGGGCGGGGCGCGGG + Intergenic
1019103083 6:169647810-169647832 GGCGGCAGCGACCTGGGGGCCGG + Exonic
1019563940 7:1670550-1670572 GGCGGCGGCGGAGCGGGCGCAGG + Intergenic
1019711492 7:2520041-2520063 GGCGGCGGCGCCCGGGGCGCTGG + Exonic
1019716815 7:2542910-2542932 GGCAGCGGAGCGCAGGGCGTCGG + Intronic
1019983941 7:4641765-4641787 GCGGGCCGCGAGCAGGGCCCGGG - Intergenic
1019989610 7:4682450-4682472 GGCGGCGGCGGCCCGGGCGGAGG - Exonic
1020105999 7:5422619-5422641 GGGCGCGGAGTGCAGGGCGCCGG - Intronic
1020238503 7:6374621-6374643 GGCGGCGGGGCGCTGGGTGCCGG - Exonic
1020274299 7:6615511-6615533 GGCGGCGGGGGCCGGGGCGCGGG + Intergenic
1021958798 7:25852580-25852602 GGCGGGGGCGCGGAGGACGCGGG - Intergenic
1021992710 7:26152869-26152891 GGCGGCGCCGAGCAGCCCGTGGG - Exonic
1022104670 7:27189347-27189369 GGCGCCGGCGGGCAGTGCCCAGG + Intergenic
1022655880 7:32319082-32319104 GGTGACGGCGTGGAGGGCGCGGG - Intergenic
1024043803 7:45574419-45574441 GGCGCCGGGGCGCGGGGCGCGGG - Intronic
1024578271 7:50782298-50782320 GGCCGCGGCGGACAGGGCCCGGG - Intronic
1025608216 7:63054479-63054501 GGCGACGGCGAGCGGCCCGCAGG + Intergenic
1025829763 7:65038659-65038681 GGCGGCGGGGACCGGGCCGCTGG + Intergenic
1025917018 7:65873659-65873681 GGCGGCGGGGACCGGGCCGCTGG + Intronic
1026732773 7:72925629-72925651 GGCGGTGGGGAGCGCGGCGCCGG - Intronic
1028477256 7:91265544-91265566 GGCGCCGGCGAGCTGTGCGTGGG + Exonic
1029458602 7:100683148-100683170 GGGGGCGGGGAGCTGGGTGCGGG + Exonic
1031895978 7:127347995-127348017 GGCGGCCGGGCGCAGGGCGGCGG + Intronic
1031966597 7:128031796-128031818 GCCGGCGGCGCGCCGGGGGCCGG - Intronic
1032087305 7:128890934-128890956 CGCGGGTGCGCGCAGGGCGCGGG + Exonic
1032322994 7:130901341-130901363 GCCTGCGGGGAGCAGGGAGCAGG - Intergenic
1032396391 7:131592978-131593000 GGAGGAGGGGAGGAGGGCGCCGG + Intergenic
1033339238 7:140479126-140479148 CGCGGCGGAGCGCCGGGCGCGGG - Intronic
1034223075 7:149460414-149460436 CCCGGCGGCGAGCTGGGCCCCGG + Intronic
1034441067 7:151086368-151086390 GGCGGCGGGGAGGGGGGCTCGGG + Intronic
1034578933 7:152025943-152025965 GGCGGCGGCGCGCGGGGCCTGGG + Intronic
1034578988 7:152026110-152026132 GGGGGCGAGGACCAGGGCGCTGG + Intronic
1034618254 7:152436590-152436612 AGCGGCGGCGCGCGGGGGGCGGG - Intergenic
1034828707 7:154290459-154290481 GGTGGCAGGGAGCAGGGCGAAGG - Intronic
1034911704 7:155003077-155003099 GGCGGGGGCGCGGAGGGCGGGGG - Exonic
1035580702 8:737841-737863 GGCTGCCGGGAGCCGGGCGCGGG + Intronic
1037262894 8:17027489-17027511 GGCGGCGGCCGGCGGGGGGCTGG + Exonic
1037772819 8:21812373-21812395 GGCAGCAGAGAGCAGGGTGCGGG - Intergenic
1037879442 8:22565817-22565839 GGCGCCGGCGAGCTCTGCGCGGG - Exonic
1037882412 8:22579543-22579565 GGCGGCCGCGAGCCGGCCTCGGG + Intronic
1038540342 8:28385856-28385878 GGCCGCGGCGGGCGGGGCGCGGG - Intronic
1039068782 8:33632008-33632030 GGCGGCGTGGAGCAAGGAGCGGG - Intergenic
1039419174 8:37421280-37421302 GGCAGCAGGGAGCAGGGTGCTGG - Intergenic
1039476451 8:37841625-37841647 TGCGGCGGCGGGCAGGGCCCGGG - Exonic
1039542296 8:38382214-38382236 GGCGGCGGCCAGCACGGAGGCGG - Exonic
1039936598 8:42051642-42051664 GGCGGCGGCGCGCGGGCCGCGGG + Intronic
1041686941 8:60652602-60652624 GGCGCGGGCGAGCCGGGGGCGGG + Intergenic
1042271554 8:66961594-66961616 GGCGGCGGCGAATGCGGCGCGGG - Exonic
1042591527 8:70402869-70402891 GGGGGCGGGGAGCCGGGGGCCGG - Intronic
1043435374 8:80232136-80232158 GGCGCCGTGGAGCAGGGGGCAGG - Intergenic
1044839769 8:96327765-96327787 GCTGGCGGCAAGGAGGGCGCAGG - Intronic
1044973642 8:97643874-97643896 GGCGGGGGCGGGCGGGGGGCGGG - Intergenic
1046375692 8:113377037-113377059 GGCGGAGCGGAGCGGGGCGCGGG + Intronic
1048214129 8:132480471-132480493 GGCGGCGGCGACGGGGGCGGCGG - Exonic
1048375485 8:133818946-133818968 GGGGGCGGGGGGCAGGGGGCGGG + Intergenic
1049165355 8:141122240-141122262 GGCGGCGGTGGGGAGGGGGCCGG - Intronic
1049405321 8:142449718-142449740 GGCGGCGGCGGGCGCGGCGTTGG + Exonic
1049472574 8:142782970-142782992 GGGGGCGGGGAGCATGACGCAGG + Intergenic
1049585296 8:143430153-143430175 GGCGGCGGCGCGGGGGGCGGCGG - Exonic
1049643876 8:143727574-143727596 GGCCGAGGGGAGCAGGTCGCCGG + Exonic
1049761990 8:144335963-144335985 GGGGGCGGAGGGCAGGGCCCGGG - Intronic
1049762278 8:144336909-144336931 GGCGGCGGCGGGCGGGGGGCGGG + Intergenic
1049774063 8:144396656-144396678 GGCGGCGCAGAGGAGGGGGCTGG - Exonic
1049891389 9:73509-73531 GGCGGGCGGGTGCAGGGCGCGGG - Intergenic
1049998378 9:1051716-1051738 GCCGGCGGCGGGCTGGGCCCGGG - Exonic
1051290944 9:15545144-15545166 GGGGGCAGCGGGCAGGGGGCAGG + Intergenic
1051320776 9:15902965-15902987 GGCGGCAGCGAGCTGGGGGAGGG + Intronic
1053250819 9:36572815-36572837 GGCGGGGGCGCGCGCGGCGCCGG - Intergenic
1053656771 9:40223663-40223685 GACGGGGCCGTGCAGGGCGCCGG + Intronic
1053690457 9:40584306-40584328 GGCGGCGGCGAGGCGGGCGGCGG - Intergenic
1053690463 9:40584324-40584346 GGCGGCGGCGAGGCGGGCGGCGG - Intergenic
1053732818 9:41074583-41074605 GGCGGGCGGGCGCAGGGCGCAGG - Intergenic
1054274320 9:63053073-63053095 GGCGGAGGCGAGGCGGGCGGCGG + Intergenic
1054274341 9:63053143-63053165 GGCGGCGGCGAGGCGGGCGGCGG + Intergenic
1054301700 9:63385231-63385253 GGCGGCGGCGAGGCGGTCGGCGG - Intergenic
1054301705 9:63385249-63385271 GGCGGCGGCGAGGCGGGCGGCGG - Intergenic
1054368890 9:64369941-64369963 GACGGGGCCGTGCAGGGCGCCGG + Intronic
1054400482 9:64711785-64711807 GGCGGCGGCGAGGCGGGCGGCGG - Intergenic
1054400488 9:64711803-64711825 GGCGGCGGCGAGGCGGGCGGCGG - Intergenic
1054400510 9:64711873-64711895 GGCGGCGGAGAGGCGGGCGGCGG - Intergenic
1054434068 9:65196029-65196051 GGCGGCGGCGCGGCGGGCGGCGG - Intergenic
1054434074 9:65196047-65196069 GGCGGCGGCGCGGCGGGCGGCGG - Intergenic
1054434080 9:65196065-65196087 GGCGGCGGCGAGGCGGGCGGCGG - Intergenic
1054434086 9:65196083-65196105 GGCGGCGGCGAGGCGGGCGGCGG - Intergenic
1054434092 9:65196101-65196123 GGCGGAGGCGAGGCGGGCGGCGG - Intergenic
1054434101 9:65196130-65196152 GGCGGAGGCGAGGCGGGCGGCGG - Intergenic
1054434110 9:65196159-65196181 GGCGGAGGCGAGGCGGGCGGCGG - Intergenic
1054496290 9:65825555-65825577 GGCGGAGGCGAGGCGGGCGGCGG + Intergenic
1054496299 9:65825584-65825606 GGCGGAGGCGAGGCGGGCGGCGG + Intergenic
1054496305 9:65825602-65825624 GGCGGCGGCGAGGCGGGCGGCGG + Intergenic
1054496311 9:65825620-65825642 GGCGGCGGCGAGGCGGGCGGCGG + Intergenic
1054496317 9:65825638-65825660 GGCGGCGGCGAGGCGGGCGGCGG + Intergenic
1054496322 9:65825656-65825678 GGCGGCGGCGAGGCGGACGGCGG + Intergenic
1054527826 9:66152566-66152588 GACGGGGCCGTGCAGGGCGCCGG - Intronic
1054695610 9:68356972-68356994 GGCGGGCGGGTGCAGGGCGCAGG + Exonic
1055945527 9:81688711-81688733 GGCGGCGGCGGGCGAGGTGCAGG + Exonic
1057358022 9:94347659-94347681 AGCCGCGGCGAGCAAGGAGCTGG + Intergenic
1057649727 9:96909958-96909980 AGCCGCGGCGAGCAAGGAGCTGG - Intronic
1058357019 9:104094544-104094566 GGAGGCGGGGCGCGGGGCGCGGG + Intronic
1059102440 9:111483667-111483689 GGCGGCGGCGGGCGGGCCTCGGG - Intronic
1059208252 9:112486781-112486803 GGGGCCGGCGAGCGGGGCGGGGG - Intronic
1060147905 9:121268107-121268129 GGCCGGGGTGGGCAGGGCGCGGG - Intronic
1060468633 9:123929848-123929870 GGCGGAGCCGGGCCGGGCGCGGG - Intronic
1060770148 9:126326731-126326753 CGCGGCGGCGGGCCGGGCTCCGG - Intergenic
1060776171 9:126376513-126376535 TGGGGCGACGAGCAGGGAGCTGG + Intronic
1060849097 9:126860392-126860414 GGGGGCGCCGAGGAGAGCGCGGG + Intergenic
1061261593 9:129483344-129483366 GGGGGCGTCGGGCAGAGCGCCGG - Intergenic
1061419842 9:130467098-130467120 GGAGGTGGCAAGCAGGGCTCTGG - Intronic
1061472123 9:130835203-130835225 GGCGGCGGCGGGGCGGGGGCGGG + Intronic
1061559581 9:131394037-131394059 GGCGGCGGCAGGCGGGGGGCGGG + Intergenic
1061584047 9:131554982-131555004 GCGGGCGGCGAGAAGAGCGCGGG - Intergenic
1062179993 9:135186198-135186220 GTCGGCGGGGGGCAGGGCACAGG - Intergenic
1062230650 9:135479937-135479959 GGAGGCGGCGGGCCGGGGGCGGG - Exonic
1062435482 9:136545054-136545076 GGGGGCGGAGAGCGGGACGCGGG - Intronic
1062478054 9:136739176-136739198 GGCGGCGGCGTGGAGGGCAGAGG + Intronic
1062480053 9:136746912-136746934 GGTGGCGGCGTGCAGGGGTCGGG - Intronic
1062499093 9:136844727-136844749 ACCGGCGGCGAGGCGGGCGCGGG - Exonic
1062529185 9:136992459-136992481 GGCGGCAGCGTGCAGAGCGGCGG - Exonic
1062537752 9:137028314-137028336 AGCGGGGGCGGGCGGGGCGCGGG - Intronic
1062587371 9:137255381-137255403 GGCGCCGGGGAGCGGGGCTCGGG + Exonic
1062599828 9:137314745-137314767 GTCGGCGGCGAGAAGGTCCCTGG + Intronic
1203471051 Un_GL000220v1:115575-115597 GGGGGCGGGGAGCGGGGCGTGGG - Intergenic
1203478872 Un_GL000220v1:159547-159569 GGGGGCGGGGAGCGGGGCGTGGG - Intergenic
1185471470 X:386494-386516 GGGGGCGGCGAGCGGGGCTGTGG + Exonic
1185506447 X:634904-634926 GACGGCGGCGGCCCGGGCGCAGG - Intronic
1185508286 X:644533-644555 GGCGGCGGCGACCACGGCGGCGG - Exonic
1186496500 X:10015710-10015732 GGCGGCGGCGCGGAAGGAGCTGG - Exonic
1190298661 X:49043302-49043324 GGCGGTGGCGAGCTGGGGGGAGG - Exonic
1190440476 X:50470578-50470600 GGCGGCGGCGGCCAAGGCGGCGG + Exonic
1190708443 X:53049035-53049057 GGCGGCGGCCAGCAGGCAGACGG + Intergenic
1191830206 X:65407585-65407607 GGCGGCGGCGGGCGAGGCGCAGG - Intronic
1195716843 X:107826308-107826330 GGCGGCGGCGACCGGGGCCCGGG + Exonic
1197718553 X:129728212-129728234 GGTGGCGGGGAGCTGGGGGCTGG + Intergenic
1197776366 X:130121039-130121061 GCCTGCGCCGGGCAGGGCGCGGG - Intergenic
1198767089 X:140091328-140091350 GGCGGCGGCGACCGAGGCGGCGG + Intergenic
1199772512 X:150983784-150983806 GGCGGCAGCGGGAAGGGGGCCGG + Intronic
1199947186 X:152679376-152679398 GGCGGGGGTTGGCAGGGCGCCGG - Intergenic
1199962494 X:152789078-152789100 GGCGGGGGTTGGCAGGGCGCCGG + Intergenic
1200100775 X:153688398-153688420 GGCGGCGGGGTGCGGGGCGCGGG - Exonic
1201222952 Y:11789446-11789468 GGCGGCGGCCAGTGGGGCTCCGG + Intergenic