ID: 1083618075

View in Genome Browser
Species Human (GRCh38)
Location 11:64036126-64036148
Sequence CCGGGGAGGCGGGTCTCCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 169}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083618075_1083618091 11 Left 1083618075 11:64036126-64036148 CCCGAGGAGACCCGCCTCCCCGG 0: 1
1: 0
2: 1
3: 13
4: 169
Right 1083618091 11:64036160-64036182 GTAGGGCTGGCTGCACCGGGCGG 0: 1
1: 0
2: 0
3: 12
4: 207
1083618075_1083618096 19 Left 1083618075 11:64036126-64036148 CCCGAGGAGACCCGCCTCCCCGG 0: 1
1: 0
2: 1
3: 13
4: 169
Right 1083618096 11:64036168-64036190 GGCTGCACCGGGCGGGGGTCGGG 0: 1
1: 0
2: 2
3: 32
4: 336
1083618075_1083618095 18 Left 1083618075 11:64036126-64036148 CCCGAGGAGACCCGCCTCCCCGG 0: 1
1: 0
2: 1
3: 13
4: 169
Right 1083618095 11:64036167-64036189 TGGCTGCACCGGGCGGGGGTCGG 0: 1
1: 0
2: 8
3: 28
4: 317
1083618075_1083618092 12 Left 1083618075 11:64036126-64036148 CCCGAGGAGACCCGCCTCCCCGG 0: 1
1: 0
2: 1
3: 13
4: 169
Right 1083618092 11:64036161-64036183 TAGGGCTGGCTGCACCGGGCGGG 0: 1
1: 0
2: 0
3: 16
4: 171
1083618075_1083618087 -2 Left 1083618075 11:64036126-64036148 CCCGAGGAGACCCGCCTCCCCGG 0: 1
1: 0
2: 1
3: 13
4: 169
Right 1083618087 11:64036147-64036169 GGCCGCTGCGCAGGTAGGGCTGG 0: 1
1: 0
2: 5
3: 29
4: 198
1083618075_1083618094 14 Left 1083618075 11:64036126-64036148 CCCGAGGAGACCCGCCTCCCCGG 0: 1
1: 0
2: 1
3: 13
4: 169
Right 1083618094 11:64036163-64036185 GGGCTGGCTGCACCGGGCGGGGG 0: 1
1: 0
2: 7
3: 31
4: 303
1083618075_1083618082 -7 Left 1083618075 11:64036126-64036148 CCCGAGGAGACCCGCCTCCCCGG 0: 1
1: 0
2: 1
3: 13
4: 169
Right 1083618082 11:64036142-64036164 TCCCCGGCCGCTGCGCAGGTAGG 0: 1
1: 0
2: 0
3: 6
4: 99
1083618075_1083618084 -6 Left 1083618075 11:64036126-64036148 CCCGAGGAGACCCGCCTCCCCGG 0: 1
1: 0
2: 1
3: 13
4: 169
Right 1083618084 11:64036143-64036165 CCCCGGCCGCTGCGCAGGTAGGG 0: 1
1: 0
2: 0
3: 8
4: 81
1083618075_1083618090 8 Left 1083618075 11:64036126-64036148 CCCGAGGAGACCCGCCTCCCCGG 0: 1
1: 0
2: 1
3: 13
4: 169
Right 1083618090 11:64036157-64036179 CAGGTAGGGCTGGCTGCACCGGG 0: 1
1: 0
2: 2
3: 14
4: 264
1083618075_1083618093 13 Left 1083618075 11:64036126-64036148 CCCGAGGAGACCCGCCTCCCCGG 0: 1
1: 0
2: 1
3: 13
4: 169
Right 1083618093 11:64036162-64036184 AGGGCTGGCTGCACCGGGCGGGG 0: 1
1: 0
2: 2
3: 29
4: 250
1083618075_1083618089 7 Left 1083618075 11:64036126-64036148 CCCGAGGAGACCCGCCTCCCCGG 0: 1
1: 0
2: 1
3: 13
4: 169
Right 1083618089 11:64036156-64036178 GCAGGTAGGGCTGGCTGCACCGG 0: 1
1: 0
2: 1
3: 41
4: 382
1083618075_1083618097 20 Left 1083618075 11:64036126-64036148 CCCGAGGAGACCCGCCTCCCCGG 0: 1
1: 0
2: 1
3: 13
4: 169
Right 1083618097 11:64036169-64036191 GCTGCACCGGGCGGGGGTCGGGG 0: 1
1: 0
2: 1
3: 37
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083618075 Original CRISPR CCGGGGAGGCGGGTCTCCTC GGG (reversed) Intronic
900514338 1:3074084-3074106 CTGGGCAGGCGGGTCTACCCTGG - Intronic
901063822 1:6485631-6485653 GCGGGGAGGCGGGGATCCCCGGG - Intronic
901285507 1:8075518-8075540 CCGAGGAGGCGGATCACCTGAGG - Intergenic
901394795 1:8973250-8973272 CCGGGCAGGCGGATCACCTGAGG - Intronic
901635274 1:10667594-10667616 CCGGGGAAGCGGGCCTCACCTGG + Intronic
901771485 1:11532463-11532485 CTGGGGAGGTGATTCTCCTCTGG + Intronic
905731960 1:40303944-40303966 CCGGGGAGGCCGGCCACCCCTGG + Exonic
912270052 1:108199941-108199963 CCGAGGAGGTGGGTCGCCGCCGG - Exonic
914505938 1:148288749-148288771 CGGTGGGGGCGGGTGTCCTCCGG - Intergenic
915333538 1:155127932-155127954 GCGGGGACGCGGGTCTCCTATGG - Exonic
918453579 1:184684737-184684759 CCATGGTGGCGGTTCTCCTCTGG + Intergenic
922586328 1:226737241-226737263 CCGGGGCTCCGGGGCTCCTCGGG + Exonic
924121046 1:240798458-240798480 CTGGGGAGGTGGGTATCATCAGG + Intronic
924384250 1:243487732-243487754 CCGGGGAGGCGGGGCTTCCTGGG + Intronic
1063049983 10:2436683-2436705 CCGGGCAGGCGGATCGCCTGAGG + Intergenic
1064244432 10:13657582-13657604 CCGGGGAGGAGGGGGTCCTGAGG + Intronic
1064552890 10:16520838-16520860 CCGGGAAGGCGGGTCCGCGCGGG - Exonic
1067066209 10:43105582-43105604 ACGGGAAGGCGGATCACCTCCGG + Intronic
1067476866 10:46573177-46573199 CTGGGGAGGGGGGTGTGCTCGGG - Intergenic
1067617871 10:47768603-47768625 CTGGGGAGGGGGGTGTGCTCGGG + Intergenic
1071206134 10:83281362-83281384 CAGGGTAGGCGGGTCACCTGAGG + Intergenic
1075438620 10:122462266-122462288 CCGGGGTGGCGGATTTCCGCGGG + Intronic
1076320824 10:129580215-129580237 CCGGGGGGGCGGGACTGCGCAGG + Intronic
1077010023 11:375544-375566 CTGGGGATGTGGGGCTCCTCGGG + Intronic
1077386100 11:2270245-2270267 CCGGGGACGCGGGTCTCCGCCGG + Exonic
1083232615 11:61332829-61332851 CCGGGGCGGCGGGCCTCCCTAGG + Intronic
1083309594 11:61777513-61777535 CCGCGGGGGCGGGGCTCCTGGGG + Intronic
1083618075 11:64036126-64036148 CCGGGGAGGCGGGTCTCCTCGGG - Intronic
1084653095 11:70500418-70500440 CCAGGGCGGCAGGGCTCCTCGGG + Intronic
1085604026 11:77881322-77881344 CCAGGGAGGGGCCTCTCCTCTGG - Intronic
1086695412 11:89838924-89838946 CCAGGGAGGCGGATCTTCTAAGG - Intergenic
1086710741 11:90005561-90005583 CCAGGGAGGCGGATCTTCTAAGG + Intergenic
1089498266 11:118918644-118918666 CAGAGGAGGGAGGTCTCCTCTGG - Intronic
1089543295 11:119204157-119204179 CGAGGGAGGCGGATCACCTCAGG - Intergenic
1090404182 11:126467310-126467332 CCTGGGAGGCCGGTCTTCCCAGG + Intronic
1090777885 11:129981101-129981123 CCGGGCAGGCGGATCACCTGAGG - Intronic
1092858369 12:12696246-12696268 CCGGGGTGGCGCTTCTCCTCAGG + Intergenic
1094523990 12:31219764-31219786 CCGGGGAGGCCGGCCTGCACAGG - Intergenic
1096997254 12:55846321-55846343 TGGGGGAGGCGGGTTTCCTATGG + Intergenic
1101997061 12:109533128-109533150 CCCGAGAGGCAGGTCTCCTGTGG - Intronic
1102333408 12:112056099-112056121 CCAGGGAAGCGGATCACCTCAGG + Intronic
1104623903 12:130337790-130337812 CCTGTGGGGCGGGGCTCCTCTGG + Intergenic
1104756524 12:131273109-131273131 CCAGGGGGGCCGGTCTCCGCCGG + Intergenic
1105339165 13:19503814-19503836 CCCGGGAGGCAGAACTCCTCAGG - Intronic
1105706566 13:22971110-22971132 CTGTGGATGCAGGTCTCCTCAGG + Intergenic
1105723792 13:23141469-23141491 CCGAGGAGGCGGATCACCTGAGG + Intergenic
1106208298 13:27620096-27620118 CCCGGGAGGCGGGCGGCCTCCGG - Intronic
1107397503 13:40032939-40032961 CCAGGGAGGCGGATCACCTGAGG + Intergenic
1119709568 14:76812347-76812369 CGGGCGAGGCGGGTCGGCTCTGG - Intronic
1120852201 14:89181518-89181540 CCGGGGAGGGGCCTTTCCTCAGG - Intronic
1121662070 14:95642483-95642505 CCAGGGAAGCGGGTCTTATCTGG - Intergenic
1121693180 14:95892427-95892449 CCGGGGAGCCGGGCCACCTCCGG + Intergenic
1121729723 14:96178074-96178096 CAGGGGAGGGGGGTTTCCTGAGG + Intergenic
1125484224 15:40101161-40101183 CAGGGGAGGCAGCTCTGCTCAGG + Intronic
1128161034 15:65422951-65422973 CCGGGGAGGCGCGGCGCCGCGGG + Exonic
1129644566 15:77419203-77419225 CGGGGGAGGAGGGTCTCTCCCGG + Intronic
1129666972 15:77584769-77584791 CCTGGGAGGGGGGTCCCCTCTGG + Intergenic
1131052874 15:89359822-89359844 CCTCGAAGGCTGGTCTCCTCAGG - Intergenic
1131677203 15:94682606-94682628 CCAGGCAGGCGGATCACCTCAGG + Intergenic
1132996987 16:2828631-2828653 ACGGGGACGCCGGTCTCATCGGG - Intergenic
1133230918 16:4366144-4366166 CCCGGGAGAAGGGGCTCCTCCGG + Intronic
1133298444 16:4767054-4767076 CCGGAGCGGCGGGTCTCGGCGGG + Exonic
1134100372 16:11447770-11447792 CAGGGGAGGTGGCTCTTCTCTGG + Intronic
1137317050 16:47336728-47336750 CCGAGGAGGCGGGTCACCTGAGG + Intronic
1138880970 16:61014634-61014656 GCTGGGAGGCGGGTATCCTGGGG + Intergenic
1141159161 16:81617595-81617617 CTGGGGAAGGGAGTCTCCTCTGG + Intronic
1141676906 16:85522442-85522464 GCGGGCAGGAAGGTCTCCTCTGG - Intergenic
1142130745 16:88430525-88430547 CGGGAGCTGCGGGTCTCCTCGGG - Exonic
1142957562 17:3531888-3531910 CCAGGGAGGCGGGTACCCTGAGG + Intronic
1143568675 17:7740754-7740776 CCGGGAAGGCGGGTTCCCTCCGG - Intronic
1143594845 17:7907842-7907864 CCTGGGAGGAGGGTGTCCTGAGG + Intronic
1145813719 17:27780941-27780963 CCCGGGCTGCGTGTCTCCTCTGG + Intronic
1145957862 17:28867286-28867308 CCGGGCAGGCGGATCACCTGAGG - Intergenic
1146885923 17:36470894-36470916 CAGGGGAGGTGAGTCTCCTGAGG + Intergenic
1147643598 17:42020212-42020234 CCTGGGAGGCGAGGCTCGTCCGG + Intronic
1147872106 17:43594685-43594707 CCGAGGAGGCGGATCACCTTAGG + Intergenic
1149431333 17:56596954-56596976 CCGGGGAGGGGGCTCGGCTCCGG - Intergenic
1151927364 17:77208414-77208436 GCGGTGAGGCAGGTCTCCTTGGG - Intronic
1152834413 17:82519963-82519985 CGGGGGCGGCGGGTCCCCGCCGG + Exonic
1157353363 18:46911446-46911468 CCAGGCAGGCGGATCGCCTCAGG - Intronic
1160044854 18:75377015-75377037 CTGGGGAGCTGGGTCTTCTCTGG + Intergenic
1161023984 19:2026593-2026615 CAGGGCAGGCGGATCACCTCAGG + Intronic
1161405730 19:4090222-4090244 CCGGCGATGCGGGTCAGCTCAGG + Intergenic
1161433563 19:4248556-4248578 CTGGGGAGTTGGGACTCCTCGGG + Intronic
1161681137 19:5680422-5680444 TCGGGGACTCGGGTCCCCTCCGG + Intronic
1162111673 19:8403130-8403152 GCGGGGAGGCGGGTAGCCTCAGG + Intronic
1162568500 19:11457391-11457413 CCTGGCTGGCGGGTCCCCTCTGG + Intronic
1163432311 19:17275704-17275726 TAGGGGTGCCGGGTCTCCTCTGG + Intronic
1164001121 19:21100288-21100310 CCAGGGAGGTGGATCCCCTCAGG + Intronic
1165090811 19:33387593-33387615 CCTGGGAGACGGGTGGCCTCCGG + Intronic
1167551770 19:50166098-50166120 CTGGGGAGGTGGGTCGCCTGTGG + Intergenic
1168035818 19:53718479-53718501 CAGGACAGGCGGATCTCCTCAGG + Intergenic
1168401689 19:56088995-56089017 CCGGGGAGGCGGGCCGGCTGGGG + Exonic
926707500 2:15847055-15847077 CTGGGGAGGCGGGACTCTCCAGG - Intergenic
927198340 2:20563387-20563409 GTGGGGAGGAGGGACTCCTCAGG + Intronic
927513506 2:23658840-23658862 CCTGGGAACCAGGTCTCCTCAGG + Intronic
933655202 2:84881115-84881137 CCGGGGCCGCGGGGCGCCTCCGG + Exonic
933985094 2:87584295-87584317 CCGGCGAGGCTGGGCTTCTCGGG - Intergenic
934101827 2:88660540-88660562 ACCTGGAGGAGGGTCTCCTCTGG + Intergenic
936308749 2:111366516-111366538 CCGGCGAGGCTGGGCTTCTCGGG + Intergenic
948637251 2:239347294-239347316 CCAGGGAGAAGGCTCTCCTCTGG - Intronic
1171006080 20:21467069-21467091 CCAGGGAGGAGGGGATCCTCAGG - Intergenic
1171372069 20:24668600-24668622 CCGGGGAGGCGGGTATTCCTGGG - Intergenic
1172039183 20:32031612-32031634 CCGGGGAGGAGGGTGTGTTCTGG - Exonic
1172451523 20:35028323-35028345 CCGAGGAGGCGGGTCGCTTAAGG - Intronic
1172639421 20:36431964-36431986 CTGGGGAAGGGGCTCTCCTCTGG - Exonic
1172702662 20:36862816-36862838 CCGGGGAGGCGGGCGGCCGCGGG + Exonic
1175924938 20:62466976-62466998 CCTGGGAGGCGGGTGTCCAGGGG - Intronic
1175987472 20:62771153-62771175 CTGGGGAGGCGGGACCCCCCTGG - Intergenic
1178589647 21:33898587-33898609 CAGGGGAGGCTGGACTCCTGGGG - Exonic
1179464602 21:41563224-41563246 GGTGGGAGGCGGGTCACCTCTGG - Intergenic
1179609946 21:42543754-42543776 CCGGGGAGCCGGTTCTCTCCTGG + Intronic
1180150955 21:45947538-45947560 CCGGGGAGAGGGTTCTCCTGTGG + Intergenic
1180702442 22:17788956-17788978 CCTGGCAGGCGGGTCTGGTCCGG + Exonic
1180857901 22:19059746-19059768 CTGGGGAGCAGGGTGTCCTCCGG - Intronic
1181009622 22:20032767-20032789 CAGGTGAGGCTGGGCTCCTCAGG - Intronic
1181633055 22:24161498-24161520 GCCGCGAGGAGGGTCTCCTCTGG - Intronic
1184617616 22:45648672-45648694 CCGGGGTGGCTGGTGTCCACAGG - Intergenic
1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG + Intronic
950902784 3:16512910-16512932 CCTGGGAGGTGGGTTTGCTCTGG - Intronic
954028263 3:47800246-47800268 CCAGGCAGGCGGGTCACCTGAGG - Intergenic
959359005 3:105366960-105366982 GGGGGGCGGCGGGTCTCCTCAGG - Exonic
961319527 3:126063289-126063311 CCAGGGAGGGGTGACTCCTCTGG - Intronic
961438057 3:126932843-126932865 CAGGGCAGGCGGGGCTTCTCTGG + Intronic
962426298 3:135271822-135271844 CCTGGCAGGCATGTCTCCTCTGG - Intergenic
966463518 3:180203575-180203597 CAGGGGAGTGGGGTCCCCTCTGG - Intergenic
966743562 3:183254567-183254589 CCGAGGAGCCGGAGCTCCTCAGG - Intronic
967954379 3:194867106-194867128 ACAGGGAGGTTGGTCTCCTCAGG + Intergenic
968084909 3:195869910-195869932 CCGCCGAGGTGGGCCTCCTCGGG - Intronic
968269721 3:197394124-197394146 CCGAGGAGGCGGATCACCTGAGG + Intergenic
968958951 4:3733208-3733230 CCAGGAGGGCGGGTGTCCTCTGG - Intergenic
969366759 4:6699785-6699807 CATGGGAGGCTGGTCTCCTGGGG - Intergenic
969705665 4:8789830-8789852 CTGGAGAGGCCGGGCTCCTCTGG - Intergenic
979624060 4:122826885-122826907 CTTGGGAGGCGGCTCTCCCCAGG + Exonic
980109445 4:128621314-128621336 CGGGGCAGGCGGGTCACCTAAGG - Intergenic
981153963 4:141412449-141412471 ACGAGGAGGCAGGTCTCCACAGG - Intergenic
984266746 4:177505643-177505665 GCGGGGAGGCGGATAGCCTCAGG - Intergenic
985478302 5:92043-92065 CCGGGGCGGGGCGTCTCCCCTGG - Intergenic
985773503 5:1827648-1827670 CCGGGGAGGGGGGGCCCCACAGG - Intergenic
986285466 5:6355429-6355451 CAGGGGAGAGGGGTCTCCTGCGG - Intergenic
990557581 5:56951693-56951715 CCGCGGAGGGGGGGCTCCGCCGG + Intronic
991686891 5:69189694-69189716 CCGGGCAGGCGGGCCACCGCAGG + Exonic
992962835 5:81972441-81972463 CCGGGGAAGCGGGTCCCCGCCGG + Intronic
997137627 5:131343478-131343500 CAGGGCAGGCGGATCTCCTGAGG + Intronic
997705695 5:135950090-135950112 TTGGTGAGGAGGGTCTCCTCTGG + Intronic
1000443695 5:161294200-161294222 GTTGGGAGGCGCGTCTCCTCAGG + Exonic
1004923685 6:20400050-20400072 CAAGGGAGGCGGATCTCCTAGGG + Intergenic
1006558550 6:34889472-34889494 TCCGGGAAGCGGCTCTCCTCAGG + Exonic
1006794063 6:36721197-36721219 CCAGGCAGGGGGGCCTCCTCAGG - Exonic
1006867695 6:37222432-37222454 CCGGGGAAGGGGGCCTCCTGGGG + Intronic
1007416710 6:41695239-41695261 CCAGGGATCCCGGTCTCCTCTGG + Intronic
1008051906 6:46908786-46908808 ACGGGGAGGCGGGTGTTCTCTGG + Intronic
1010980416 6:82364340-82364362 CGCGGGAGACGAGTCTCCTCGGG + Intronic
1011789793 6:90885730-90885752 GCTGGGAGGCGGGTAGCCTCGGG - Intergenic
1018312806 6:162528086-162528108 GCGGGGCGGCGGGTCACCTGAGG + Intronic
1019182628 6:170200578-170200600 TCGGGGAGGCTGCTCTTCTCCGG - Intergenic
1019344365 7:522218-522240 CCGGGGAGGGGGGTCCGCGCGGG - Intergenic
1019421578 7:953571-953593 CTGGGGTGGCGGGACTGCTCCGG + Intronic
1022443497 7:30452050-30452072 CCGGCGTGGAGGGTCTCCACTGG + Exonic
1028183007 7:87747893-87747915 CCTGGGAGGCGGGTAGCCTGTGG - Intronic
1030975309 7:116114878-116114900 GCGGGGAGGGGGGTTTCCTTTGG - Intronic
1031428416 7:121636047-121636069 CCGGGGAGGTGGATCACCTGAGG - Intergenic
1032083147 7:128869929-128869951 CCGGGCAGCAGGGGCTCCTCGGG - Intronic
1033756552 7:144401539-144401561 CCGGGGAGGAGGAACTGCTCCGG - Exonic
1034462660 7:151206481-151206503 CAGGGCAGGCGGATCTCCTGAGG + Intergenic
1035171963 7:157021863-157021885 CCGGCGGGGCGGTTTTCCTCCGG + Intergenic
1038417463 8:27407629-27407651 CCCGGGAGGTGGGTCTCCCCAGG + Intronic
1038475307 8:27862160-27862182 CTGGGGAGGTGGGTATCCTGAGG + Intergenic
1039546300 8:38413671-38413693 CGGGGCAGGCAGGGCTCCTCGGG + Exonic
1045497425 8:102720158-102720180 CGGGGGAGGGGGGTCTTCTGAGG - Intergenic
1049332197 8:142060528-142060550 CCTGGGAGGCCGGGCTCCTGAGG - Intergenic
1049936279 9:504464-504486 GCGGGGAGCCGGGCGTCCTCTGG + Intronic
1050441785 9:5671506-5671528 CGGGGCAGGCGGGTCACCTGAGG - Intronic
1052778953 9:32760934-32760956 GCGAGGAGGGGGGACTCCTCGGG - Intergenic
1055464090 9:76546766-76546788 CAAGGCAGGCGGATCTCCTCAGG - Intergenic
1056643435 9:88389053-88389075 CCGGGGACGCGGGCCTGCCCTGG + Intronic
1057900378 9:98943794-98943816 CCGGGGCGGCCGGTATCCCCCGG + Exonic
1061037664 9:128122530-128122552 GCAGGGAAGAGGGTCTCCTCTGG + Intronic
1061782638 9:133004840-133004862 CCTGGGAGGGGGGCCTCCTCTGG + Intergenic
1062003326 9:134227558-134227580 CTGGGGAGTGGCGTCTCCTCTGG + Intergenic
1062521877 9:136961355-136961377 GCGGGGAGGCCAGGCTCCTCAGG + Intergenic
1192167636 X:68835634-68835656 CAGGGAAGGCGGGTCTCATCAGG + Intronic
1195615637 X:106909761-106909783 CCTGGGACGGGGGTCCCCTCTGG + Intronic
1202043682 Y:20714400-20714422 CCTGGGAGATGGGTATCCTCGGG + Intergenic