ID: 1083618623

View in Genome Browser
Species Human (GRCh38)
Location 11:64038151-64038173
Sequence CTGTTTCTAAGGAGGTGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 224}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083618612_1083618623 6 Left 1083618612 11:64038122-64038144 CCATGAAAGCCCCTGGGAGGTCC 0: 1
1: 0
2: 0
3: 28
4: 236
Right 1083618623 11:64038151-64038173 CTGTTTCTAAGGAGGTGATGGGG 0: 1
1: 0
2: 1
3: 17
4: 224
1083618603_1083618623 24 Left 1083618603 11:64038104-64038126 CCCCATCTCCGAGGCCTCCCATG 0: 1
1: 0
2: 0
3: 21
4: 211
Right 1083618623 11:64038151-64038173 CTGTTTCTAAGGAGGTGATGGGG 0: 1
1: 0
2: 1
3: 17
4: 224
1083618604_1083618623 23 Left 1083618604 11:64038105-64038127 CCCATCTCCGAGGCCTCCCATGA 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1083618623 11:64038151-64038173 CTGTTTCTAAGGAGGTGATGGGG 0: 1
1: 0
2: 1
3: 17
4: 224
1083618613_1083618623 -3 Left 1083618613 11:64038131-64038153 CCCCTGGGAGGTCCGCCCAGCTG 0: 1
1: 0
2: 0
3: 10
4: 147
Right 1083618623 11:64038151-64038173 CTGTTTCTAAGGAGGTGATGGGG 0: 1
1: 0
2: 1
3: 17
4: 224
1083618609_1083618623 10 Left 1083618609 11:64038118-64038140 CCTCCCATGAAAGCCCCTGGGAG 0: 1
1: 0
2: 3
3: 38
4: 204
Right 1083618623 11:64038151-64038173 CTGTTTCTAAGGAGGTGATGGGG 0: 1
1: 0
2: 1
3: 17
4: 224
1083618614_1083618623 -4 Left 1083618614 11:64038132-64038154 CCCTGGGAGGTCCGCCCAGCTGT 0: 1
1: 0
2: 0
3: 9
4: 97
Right 1083618623 11:64038151-64038173 CTGTTTCTAAGGAGGTGATGGGG 0: 1
1: 0
2: 1
3: 17
4: 224
1083618606_1083618623 16 Left 1083618606 11:64038112-64038134 CCGAGGCCTCCCATGAAAGCCCC 0: 1
1: 0
2: 1
3: 18
4: 186
Right 1083618623 11:64038151-64038173 CTGTTTCTAAGGAGGTGATGGGG 0: 1
1: 0
2: 1
3: 17
4: 224
1083618615_1083618623 -5 Left 1083618615 11:64038133-64038155 CCTGGGAGGTCCGCCCAGCTGTT 0: 1
1: 0
2: 0
3: 2
4: 106
Right 1083618623 11:64038151-64038173 CTGTTTCTAAGGAGGTGATGGGG 0: 1
1: 0
2: 1
3: 17
4: 224
1083618602_1083618623 27 Left 1083618602 11:64038101-64038123 CCTCCCCATCTCCGAGGCCTCCC 0: 1
1: 0
2: 3
3: 54
4: 505
Right 1083618623 11:64038151-64038173 CTGTTTCTAAGGAGGTGATGGGG 0: 1
1: 0
2: 1
3: 17
4: 224
1083618601_1083618623 30 Left 1083618601 11:64038098-64038120 CCTCCTCCCCATCTCCGAGGCCT 0: 1
1: 0
2: 6
3: 52
4: 550
Right 1083618623 11:64038151-64038173 CTGTTTCTAAGGAGGTGATGGGG 0: 1
1: 0
2: 1
3: 17
4: 224
1083618605_1083618623 22 Left 1083618605 11:64038106-64038128 CCATCTCCGAGGCCTCCCATGAA 0: 1
1: 0
2: 0
3: 9
4: 154
Right 1083618623 11:64038151-64038173 CTGTTTCTAAGGAGGTGATGGGG 0: 1
1: 0
2: 1
3: 17
4: 224
1083618611_1083618623 7 Left 1083618611 11:64038121-64038143 CCCATGAAAGCCCCTGGGAGGTC 0: 1
1: 1
2: 2
3: 27
4: 1016
Right 1083618623 11:64038151-64038173 CTGTTTCTAAGGAGGTGATGGGG 0: 1
1: 0
2: 1
3: 17
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083618623 Original CRISPR CTGTTTCTAAGGAGGTGATG GGG Intronic
903028873 1:20448715-20448737 CGGTTGCCAAGGAGATGATGAGG + Intergenic
903861746 1:26368574-26368596 CTGTTTCCCAGCAGGTAATGGGG - Exonic
910777991 1:90894823-90894845 CTGTTTCTAACTAGGTAATCTGG - Intergenic
910942957 1:92557045-92557067 CTTTTTTTAAGTAGGTGATTAGG - Intronic
915319251 1:155047269-155047291 CTGTCTCTGAGGAGGTGTTCAGG - Exonic
916239567 1:162625304-162625326 TTGATTCTAAGGAGGTGGGGAGG + Intergenic
916481209 1:165216120-165216142 CTGTTTTCCAGGGGGTGATGTGG + Intronic
917027708 1:170661268-170661290 CTATTTCTAGGGAGGTTTTGGGG + Intergenic
917733794 1:177901959-177901981 CTGTTTTCAAGGAGCTCATGAGG - Intergenic
920235821 1:204503942-204503964 CTGTTTCTATGAATGAGATGTGG - Intergenic
923724585 1:236495259-236495281 CTATTTCTAAGTGGGAGATGGGG + Intergenic
923847444 1:237750936-237750958 CTGTTTCTCAAGAGTTGATCTGG + Intronic
924571506 1:245241402-245241424 CTGGTTCTAAGTAGGAGAAGAGG + Intronic
1062931564 10:1356303-1356325 CTGCTTCAAAGCAGGTGATGTGG + Intronic
1062942335 10:1433479-1433501 CCTTTTGTAAGGAGGTGATGAGG - Intronic
1064623075 10:17234413-17234435 CTATTCTGAAGGAGGTGATGTGG - Intronic
1065101785 10:22338382-22338404 CTATTTTTAAGGTGCTGATGGGG - Intergenic
1066149219 10:32597574-32597596 CTGTTTCTTTGGAGGAGAAGAGG + Intronic
1068116451 10:52741829-52741851 CTGTTTCTTATGAGAGGATGAGG + Intergenic
1070037780 10:72743878-72743900 CTGATTCTAAGAAGCTGAGGAGG + Intronic
1071617381 10:87087675-87087697 CTGTGTGTAAGGGGGTCATGAGG - Intronic
1071941564 10:90596836-90596858 CTGTTTCTAATGAGGCCAGGAGG + Intergenic
1075048074 10:119161827-119161849 CTTTTTCTAAGAATGTGCTGGGG - Intronic
1075286157 10:121187917-121187939 ATTTGTCTAAGGAGCTGATGAGG - Intergenic
1076195429 10:128514210-128514232 CTGTCTCTAAGGAGGGGAAAGGG - Intergenic
1078040756 11:7860702-7860724 CTGTTACTGAGGAAATGATGAGG + Intergenic
1079034595 11:17011278-17011300 GTGTTTCTAAGAAGGTGAGAGGG - Intronic
1080252059 11:30244524-30244546 CTGTTGCTAAGGAGGCAAGGTGG - Intergenic
1083153155 11:60806218-60806240 CTGTTTGGAAGGAAGTGAGGAGG - Intergenic
1083182055 11:60993182-60993204 GTGTTCCTAGGGAGGAGATGTGG - Intronic
1083297546 11:61723187-61723209 GGGTTTCCAAGGAGGTGCTGAGG - Intronic
1083618623 11:64038151-64038173 CTGTTTCTAAGGAGGTGATGGGG + Intronic
1085614218 11:77982857-77982879 CAGTTTCTAAGGAGGTCACCAGG + Intronic
1092984209 12:13829666-13829688 CCATTTCTAAGAGGGTGATGTGG + Intronic
1093015694 12:14152391-14152413 TTGTTTCTAGGTAGGTGATCTGG - Intergenic
1093501916 12:19823128-19823150 CTATTTCTAAGGAAATGGTGGGG + Intergenic
1094150997 12:27282997-27283019 TGGTTTCTAAGGATGTCATGAGG + Intronic
1095399630 12:41799702-41799724 GTGTTTCTAAGCAGCTTATGGGG - Intergenic
1095594211 12:43940257-43940279 GTGTTTCTAGGTAGGAGATGTGG - Intronic
1095994099 12:48064174-48064196 CTGTTTCTCAGGAAGTCATTTGG - Intronic
1096346704 12:50854213-50854235 CTGTATCTATTGAGATGATGTGG - Intronic
1099165541 12:79302561-79302583 ATGTTTAAAAGGAAGTGATGTGG + Intronic
1100001583 12:89843434-89843456 CTGTAGCTGAGGAGGTGAGGAGG - Intergenic
1100358853 12:93857814-93857836 CTGGTTGTAAAGAGATGATGTGG - Intronic
1102447082 12:113011433-113011455 CAATCTCCAAGGAGGTGATGGGG + Exonic
1102722117 12:115025865-115025887 TTGTTTCTAAGGTGATGATATGG - Intergenic
1104635470 12:130435765-130435787 CAGTTTTTCAGGAGGTGCTGAGG + Intronic
1106563340 13:30865029-30865051 CTGTTTAAAAGGGGGTGGTGGGG - Intergenic
1106678738 13:31988232-31988254 CTGTTTCTAGGGAGCAGATAAGG - Intergenic
1108789793 13:53954669-53954691 TTGTATCTAAGCAGTTGATGTGG + Intergenic
1109851236 13:68067072-68067094 CTGTTTCTATGGTGGGGGTGAGG - Intergenic
1112516394 13:100056752-100056774 CTTTTTTCAGGGAGGTGATGGGG - Intergenic
1113160812 13:107378864-107378886 CTGTTTTTAATGAGGTGTTATGG + Intronic
1113326108 13:109282914-109282936 CTCTTCCAATGGAGGTGATGAGG - Intergenic
1116732270 14:48638975-48638997 TTGTTTCTAATGAGGTTATTTGG - Intergenic
1117902588 14:60550779-60550801 CTGTTTCTCAGGCTGGGATGTGG + Intergenic
1119074375 14:71621282-71621304 CTGTTTCTCAGAGGGAGATGAGG - Intronic
1120933455 14:89871536-89871558 CTGTTTATAAGGAGGAGTTGGGG - Intronic
1121871728 14:97414226-97414248 GGGATTCTAAGGAGGTGCTGCGG + Intergenic
1122034511 14:98937555-98937577 CATTTTATAAGAAGGTGATGAGG - Intergenic
1125365399 15:38909548-38909570 CTGTGTCTCTGGAGGTGAAGTGG + Intergenic
1126969758 15:54097431-54097453 CTCTTTCTAAGGAGATTATGCGG + Intronic
1127623627 15:60758573-60758595 CTGTTACCATGGAGGTGAAGAGG - Intronic
1128672086 15:69581294-69581316 ATGTTTCCAAGAAGGGGATGGGG + Intergenic
1128834472 15:70798090-70798112 GTGTTTCTAAGGTGGGGGTGGGG - Intergenic
1128998963 15:72317620-72317642 CTGTTTCTGGGGAGAGGATGAGG + Intronic
1130389351 15:83441705-83441727 CTGAGTAGAAGGAGGTGATGAGG + Intergenic
1131884883 15:96901686-96901708 CTTTTTCTAAGGAAGTCATAGGG + Intergenic
1132092029 15:98954794-98954816 ATTTTTCTTAGGAAGTGATGGGG + Intronic
1134366155 16:13581243-13581265 CTGGCTGTAAGGAGGTGATGAGG - Intergenic
1141717012 16:85732743-85732765 CTGGGTCTCTGGAGGTGATGAGG - Intronic
1141803555 16:86327333-86327355 CTGAGGCTCAGGAGGTGATGAGG - Intergenic
1143847115 17:9780863-9780885 GTGTTTCTAGGGATGTGATTAGG - Intronic
1147255868 17:39181691-39181713 CTGTTTCTAATGAGATAAAGGGG - Intronic
1149197967 17:54145947-54145969 CTGTTTCATAGTAGGTGTTGAGG - Intergenic
1149397794 17:56262452-56262474 CTGTTTTTAAGGGTGAGATGGGG + Intronic
1150839537 17:68595047-68595069 CTATTTCTACAGAGGTTATGAGG + Intronic
1151712969 17:75817320-75817342 CTGTTTCTACAGAGGAGCTGCGG - Exonic
1152296959 17:79473291-79473313 CTGTTGCTAGGGAGCTGCTGTGG + Intronic
1152574165 17:81132860-81132882 ATGTTCCCAAGGAGGTGAGGAGG + Intronic
1154171485 18:12056244-12056266 CTGTTTCTAAGGAGGCATGGTGG - Intergenic
1154938171 18:21082580-21082602 CTGTATCTAATGAGGTGATGTGG - Intronic
1157675017 18:49562277-49562299 CTGTTTCTTGGGAGGGGGTGTGG + Exonic
1158331393 18:56367179-56367201 TTGTTTCTTAGGAGGTTATTTGG + Intergenic
1158345698 18:56514389-56514411 CTGTTTATAAGGGGTTGATCTGG - Intergenic
1159754482 18:72347789-72347811 CTGTTTCTATGGTGGTGGTGGGG - Intergenic
1159813284 18:73042687-73042709 CAGTTACTAAGGGGGTAATGAGG - Intergenic
1160591068 18:79944978-79945000 CTGTTGATAAGGGGGTGCTGAGG - Intronic
1161505628 19:4641881-4641903 CTGTTTATAAAGCAGTGATGTGG - Intronic
1162744344 19:12790362-12790384 CTGTTTCTAAGGAAGGGAGTGGG + Intronic
1167123261 19:47531746-47531768 CTGTTTCCAAGAAGGACATGAGG + Intronic
1168065207 19:53915348-53915370 CTGTCTCTGGGGAGGGGATGGGG - Exonic
1168550402 19:57288514-57288536 CTGTTTCATAGGCTGTGATGAGG - Intronic
926332041 2:11833616-11833638 CTGTTTCCAGTGAGGTGAAGTGG + Intergenic
926773458 2:16398859-16398881 CTGTTTATAATGGGGTGATGTGG + Intergenic
927683480 2:25155228-25155250 CTTTTCCATAGGAGGTGATGTGG - Exonic
928062109 2:28124719-28124741 CTGTTTCTAACTGGGTGAGGAGG - Intronic
928277668 2:29917745-29917767 CTGTCTCTCTGGAGGTCATGGGG + Intronic
929132083 2:38586397-38586419 TTGTTTTTGAGGAGGTCATGAGG - Intronic
929837706 2:45422288-45422310 CTGTTTGAAAGGAGGAGAAGGGG - Intronic
931149840 2:59560710-59560732 CTGTTTCTAGGAACGTAATGTGG - Intergenic
931700023 2:64901943-64901965 CTATTTCTAGGGAGGAAATGGGG - Intergenic
932211913 2:69938417-69938439 CTGTTTTCAAGGAGGTGCTTAGG + Exonic
932434439 2:71694950-71694972 TTGTTTCTCAGGTGGTGGTGAGG + Intergenic
932475742 2:72004740-72004762 CAGCTTCTCAGGAGGGGATGGGG - Intergenic
932817362 2:74872646-74872668 CTGTTTCTGTGGAGGGGATAAGG - Intronic
933592594 2:84249246-84249268 CTGGTTCTGTGGAGGAGATGAGG - Intergenic
934699095 2:96424117-96424139 ATGTTACTAAGGAGATGCTGGGG - Intergenic
935828422 2:106974411-106974433 CTGTTCCTAGGGAGGGGGTGTGG + Intergenic
936011882 2:108930268-108930290 GTGTTTCTAAGGAGGTACGGAGG - Intronic
936343179 2:111655464-111655486 CTCTTTCTTTGGAGGTGGTGGGG - Intergenic
939088081 2:137745569-137745591 CTGTCTCTAATGATGTGAAGTGG + Intergenic
944885868 2:204062009-204062031 CTTTTTCTAAGAAGGTCATGGGG + Intergenic
947420384 2:229937183-229937205 TGGTTTTTAAGGAGGTGAGGTGG - Intronic
947677477 2:231995953-231995975 CTGTCTCTCAGGAGGGGCTGTGG + Intronic
948798181 2:240417029-240417051 CTGTCTCTGATGAGGTCATGGGG - Intergenic
1169512761 20:6283158-6283180 CTGTTTCTACTGAGATGTTGGGG - Intergenic
1169926993 20:10793896-10793918 CAGCTTTTAAGGAGGTGCTGGGG - Intergenic
1170443196 20:16399106-16399128 CTGGTTCTGGAGAGGTGATGAGG + Intronic
1171119136 20:22553127-22553149 CTGTGTCTGAGGGGATGATGGGG + Intergenic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1175060168 20:56234770-56234792 GTGTTTTTAAGGAGCTGTTGTGG - Intergenic
1176935462 21:14861457-14861479 CTGTCTCAGAGGAGGAGATGAGG - Intergenic
1178285779 21:31324135-31324157 CTGTTTTTAAGGGGGTCAAGCGG - Intronic
1179062548 21:37992490-37992512 CTGTTTCTAAGCAGCTTATGTGG + Intronic
1179134703 21:38669239-38669261 CTCTTTCTAAGATGGTGTTGGGG - Intergenic
1180083657 21:45497883-45497905 CTGCTCCTCAGGAGGTGATGGGG - Intronic
1180721611 22:17913318-17913340 GTGTTTCTGTGGAGGTGACGAGG + Intronic
1182083501 22:27545434-27545456 CTGTTATGAAGGAGCTGATGTGG - Intergenic
1182461189 22:30485224-30485246 CTGCTACTCAGGAGGTGAGGTGG + Intergenic
1182961552 22:34480113-34480135 CTGTTTCCCAGGTGGGGATGAGG + Intergenic
949523909 3:4884414-4884436 CTGTTTCAAAGGAGTTGGTTTGG + Intronic
950884884 3:16354481-16354503 CTGTGTCAAAGGAGGTGACTTGG - Intronic
952027741 3:29103487-29103509 CTGATTCCAAGGATGTGAGGGGG + Intergenic
952076274 3:29701555-29701577 CTGCTTGTAAGGAGGTGTGGAGG + Intronic
952292060 3:32026829-32026851 CTGTTTCTGAGGAAGTGAAGTGG - Intronic
952898669 3:38095720-38095742 CTTTTCCTAAGGAGGGGAGGAGG + Intronic
953354657 3:42245457-42245479 CTGTTTCTGAACAGGTCATGAGG - Intergenic
953956982 3:47239228-47239250 CAGTTTCAAAGGATGAGATGAGG - Intronic
953960824 3:47264396-47264418 CTGCTCCAAAGGAGTTGATGGGG + Intronic
955220512 3:57019415-57019437 GTGTTCCTAGGGAGGAGATGAGG + Intronic
955298821 3:57757443-57757465 GCGTTTTAAAGGAGGTGATGGGG + Exonic
956500448 3:69877746-69877768 CTGTCTTTAAGGAGCTCATGAGG + Intronic
957723363 3:84032556-84032578 CTGTTGCTGGTGAGGTGATGTGG - Intergenic
959241225 3:103797283-103797305 CGGTTTATAAGGAGGAGGTGGGG - Intergenic
959332418 3:105022990-105023012 CTATTTCAAAGGAGGGGCTGTGG + Intergenic
959988038 3:112598819-112598841 CTGGCTGTAAGGAGATGATGAGG + Intergenic
961122077 3:124381334-124381356 CTGTTTGTAGGGAAGTGATGTGG + Intronic
961656364 3:128444422-128444444 CTGTTTCTAAGGAAGAAAAGGGG + Intergenic
967558706 3:190892936-190892958 GTGTTTGGAAGGAGGTGAAGGGG + Intergenic
967650726 3:191983041-191983063 CTGTTTATATGGAGGTTGTGAGG - Intergenic
968440493 4:621566-621588 CTGTGTGTAATGAGGAGATGCGG - Intergenic
969088978 4:4678638-4678660 CGCCTTCTAAGGAAGTGATGTGG + Intergenic
972487901 4:39559805-39559827 CTGTTTCTAGGGAAGTGACTGGG - Intronic
972954016 4:44366909-44366931 AGGTTTCTAAGTAGGTGATTTGG - Intronic
974194335 4:58552291-58552313 CTGCTTTTAATGAGGTAATGAGG - Intergenic
974238882 4:59217211-59217233 CAATGTCTAAGGTGGTGATGTGG - Intergenic
974262985 4:59548470-59548492 CTGTTTCTAAAGTGGTGCTGTGG + Intergenic
975379237 4:73679169-73679191 CTGTTTCCCAGGAGGGAATGCGG - Intergenic
975481867 4:74889948-74889970 CAGTTTCTGAGTTGGTGATGGGG - Intergenic
975664899 4:76725983-76726005 CTGTTTCTAAAGGGGAGAAGAGG - Intronic
976799102 4:88968224-88968246 TTGTTTCCAAGTAGGTGATGTGG - Intronic
977269844 4:94903680-94903702 GTGTCTTTAAGGAGGTGATTGGG + Intronic
979916499 4:126441318-126441340 CTGTTACTAAGGAGGAGAGCTGG - Intergenic
983857401 4:172662870-172662892 CTCTTTCAAAGGAGGTGGTCAGG + Intronic
984323627 4:178224668-178224690 CTGTTCCAGTGGAGGTGATGGGG - Intergenic
986233296 5:5885959-5885981 CTCTTTCTAAGGAGGTTCTCAGG - Intergenic
988344661 5:30021378-30021400 CTGTTTTGGTGGAGGTGATGGGG - Intergenic
989414654 5:41159654-41159676 CTGTTTCTAAGGAGGATTTGAGG + Intronic
989973237 5:50549964-50549986 CTCTTTCTATGCAGGTGCTGAGG + Intergenic
995071592 5:107928876-107928898 CTTTTTCCAGAGAGGTGATGAGG - Intronic
997008566 5:129849410-129849432 ATGTTACTAAGGAGTTGAGGTGG - Intergenic
998222046 5:140291003-140291025 TTGTTTCTAAAGAGGCAATGAGG - Intronic
999640775 5:153671077-153671099 TTTTTTCTTAGGAGGGGATGGGG + Intronic
999891879 5:155986747-155986769 CTGTTTCTTCAGAGGTTATGCGG + Intronic
999896434 5:156038998-156039020 CTGTTTCTAGGGGGAAGATGAGG - Intronic
1000757860 5:165183863-165183885 CTGTTCCAATGGAGGTGATAGGG + Intergenic
1004821224 6:19369976-19369998 CTGTCTCTAAGGAGGGGTTCAGG + Intergenic
1005425108 6:25694493-25694515 CTGTTTCTGTGGAGCTGCTGGGG + Intronic
1007139998 6:39562523-39562545 CTTCTTCTAAGGAGTTTATGTGG - Intronic
1007171936 6:39870249-39870271 CTGTGGCTAGGGTGGTGATGAGG + Intronic
1009379711 6:63011745-63011767 CAGTTTCTGAAGAGGTAATGAGG - Intergenic
1009623676 6:66107986-66108008 CTTTTTCTAAGGAGTGCATGGGG - Intergenic
1011765787 6:90618010-90618032 CTCTTTCTAAGGAATTGATATGG + Intergenic
1012156009 6:95820255-95820277 CTGTTCCAGTGGAGGTGATGAGG - Intergenic
1012984041 6:105856108-105856130 TTGTCTATAAGGAGATGATGTGG + Intergenic
1013015674 6:106158874-106158896 GTTTTTCTCTGGAGGTGATGAGG + Intergenic
1014517474 6:122397800-122397822 CAGTGTCTAAGGAGGAAATGTGG - Intergenic
1017176571 6:151510565-151510587 ATATTGCAAAGGAGGTGATGAGG + Intronic
1022231236 7:28414997-28415019 CTATTTCTCAGGGGGTGAGGGGG - Intronic
1023227249 7:37983590-37983612 CTGTTTCTCTGGAGATGTTGGGG + Intronic
1023328503 7:39086569-39086591 CTTTTTTTAAAAAGGTGATGAGG + Intronic
1023359182 7:39398604-39398626 GTGGCTCTAAGGAGGTGATCTGG + Intronic
1023826665 7:44014506-44014528 CTGTTTCTTCGGAGGTCCTGGGG - Intergenic
1024828108 7:53416285-53416307 CTGTTCCTAAGGAAGAGCTGAGG - Intergenic
1025740060 7:64187736-64187758 CTGTTTTTGAGGAGGGGAGGTGG + Intronic
1028045548 7:86113606-86113628 CTGTTTCTAAGGGTGAGATTAGG + Intergenic
1029737824 7:102474261-102474283 CTGTTTCTTCGGAGGTCCTGGGG - Intronic
1030640945 7:112005825-112005847 CTGTGTTCAAGAAGGTGATGAGG - Intronic
1030787100 7:113675516-113675538 CAGTTTCAGAAGAGGTGATGGGG + Intergenic
1031500871 7:122514480-122514502 CTGTTTCTAAAGGGGGGAGGGGG - Intronic
1032262698 7:130349848-130349870 CTCTTTCTACGCAGGAGATGGGG - Intronic
1033601739 7:142893604-142893626 TTTTTTTTAAGGAGGTGGTGGGG - Intergenic
1035062216 7:156078007-156078029 CTGCCCCGAAGGAGGTGATGCGG - Intergenic
1036774635 8:11602000-11602022 TTATTTCTAGGGAGGAGATGGGG - Intergenic
1038997592 8:32942350-32942372 CTGTATCTATTGAGGTGATATGG + Intergenic
1039395140 8:37219384-37219406 GTGTATCTAAGAAGGTGAGGAGG + Intergenic
1041183461 8:55273004-55273026 CTGTCTCTAAGGGTGTGATGTGG + Intronic
1042366962 8:67948175-67948197 CTTTTTTTTAGGAAGTGATGGGG + Intergenic
1042810399 8:72819355-72819377 ATATTTCTAAGGGGGTGCTGAGG - Intronic
1042844013 8:73152208-73152230 CTGTTTCTACTGAGGTCACGAGG + Intergenic
1043101225 8:76049010-76049032 CTGTTTCTAAGAAATTCATGTGG + Intergenic
1046093274 8:109528281-109528303 ATGTTTGTAAGGAGATGATGAGG - Intronic
1048443642 8:134477815-134477837 CCCATTCTAAGGAGGTGAGGTGG - Exonic
1048864387 8:138748848-138748870 TTGTATCTAAGAAGGTGATATGG + Intronic
1050830356 9:10003241-10003263 CTGGATCTATGGAGATGATGAGG + Intronic
1051976386 9:22955019-22955041 CTGTTTCTAATTAGCTGAGGTGG - Intergenic
1052449952 9:28616400-28616422 CTGTTTGAAAGCAGCTGATGTGG - Intronic
1056696962 9:88866673-88866695 CTCTTTCAAAGGAGGATATGAGG - Intergenic
1056823651 9:89861574-89861596 CTGTCTCTCAGGAGCTGGTGTGG + Intergenic
1059307011 9:113361643-113361665 CTGTGTCAAAGGAAGTGAGGAGG + Intronic
1061008270 9:127940775-127940797 CTGTCTTTAGGGAGGTGATAAGG - Exonic
1062084182 9:134640526-134640548 CTGTTGCTAACTTGGTGATGAGG - Intergenic
1187140880 X:16592476-16592498 CTGGATCTAGGGAGGTGCTGTGG - Intronic
1188920429 X:35969543-35969565 GTTTTTCTAAGGAGCTGATAAGG + Intronic
1189242104 X:39533214-39533236 GTGTTTCTGAGGTGGCGATGAGG + Intergenic
1189677560 X:43477382-43477404 CTGTTCCCAAGCTGGTGATGTGG - Intergenic
1190008291 X:46759882-46759904 CTGGTCCTAAGGTGGTGGTGGGG + Intergenic
1190618299 X:52261494-52261516 CTGTTTTTTAGGGGGTGAAGCGG - Intergenic
1195402449 X:104475839-104475861 TTCCTTCTAAGGAGCTGATGTGG + Intergenic
1195605736 X:106803455-106803477 CTATTTCTCAGGATGTGATTGGG - Intronic
1198341516 X:135719148-135719170 CAGTTTCTCTGGAGGGGATGAGG - Intronic
1198346482 X:135764215-135764237 CAGTTTCTCTGGAGGGGATGAGG + Intronic
1198348388 X:135781500-135781522 CAGTTTCTCTGGAGGGGATGAGG + Intergenic
1198350292 X:135798764-135798786 CAGTTTCTCTGGAGGGGATGAGG + Intronic
1198352200 X:135816036-135816058 CAGTTTCTCTGGAGGGGATGAGG + Intronic
1198354108 X:135833304-135833326 CAGTTTCTCTGGAGGGGATGAGG + Intronic
1198356018 X:135850554-135850576 CAGTTTCTCTGGAGGGGATGAGG + Intronic
1198357931 X:135867832-135867854 CAGTTTCTCTGGAGGGGATGAGG + Intergenic
1198359845 X:135885115-135885137 CAGTTTCTCTGGAGGGGATGAGG + Intronic
1198366689 X:135946884-135946906 CAGTTTCTCTGGAGGGGATGAGG + Intergenic
1198436740 X:136624557-136624579 CTGTTTCTAAATAGATTATGGGG - Intergenic
1198436905 X:136625932-136625954 CTGTTTCTAAATAGATGATAGGG - Intergenic