ID: 1083619804

View in Genome Browser
Species Human (GRCh38)
Location 11:64043271-64043293
Sequence AGCTCCTCAGAGCCCCGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 269}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083619804_1083619811 -6 Left 1083619804 11:64043271-64043293 CCTGCTCGGGGCTCTGAGGAGCT 0: 1
1: 0
2: 0
3: 28
4: 269
Right 1083619811 11:64043288-64043310 GGAGCTCAGGGGCTGGAGAGGGG 0: 1
1: 2
2: 6
3: 92
4: 833
1083619804_1083619809 -8 Left 1083619804 11:64043271-64043293 CCTGCTCGGGGCTCTGAGGAGCT 0: 1
1: 0
2: 0
3: 28
4: 269
Right 1083619809 11:64043286-64043308 GAGGAGCTCAGGGGCTGGAGAGG 0: 1
1: 0
2: 8
3: 76
4: 815
1083619804_1083619813 22 Left 1083619804 11:64043271-64043293 CCTGCTCGGGGCTCTGAGGAGCT 0: 1
1: 0
2: 0
3: 28
4: 269
Right 1083619813 11:64043316-64043338 CAGGCTAGCTTTCCGCCCTCAGG 0: 1
1: 0
2: 0
3: 6
4: 103
1083619804_1083619812 3 Left 1083619804 11:64043271-64043293 CCTGCTCGGGGCTCTGAGGAGCT 0: 1
1: 0
2: 0
3: 28
4: 269
Right 1083619812 11:64043297-64043319 GGGCTGGAGAGGGGCTGTACAGG 0: 1
1: 0
2: 7
3: 69
4: 462
1083619804_1083619810 -7 Left 1083619804 11:64043271-64043293 CCTGCTCGGGGCTCTGAGGAGCT 0: 1
1: 0
2: 0
3: 28
4: 269
Right 1083619810 11:64043287-64043309 AGGAGCTCAGGGGCTGGAGAGGG 0: 1
1: 0
2: 4
3: 95
4: 820

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083619804 Original CRISPR AGCTCCTCAGAGCCCCGAGC AGG (reversed) Intronic