ID: 1083620683

View in Genome Browser
Species Human (GRCh38)
Location 11:64048010-64048032
Sequence CTGAGCCACCACTTCAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 149}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083620671_1083620683 29 Left 1083620671 11:64047958-64047980 CCTGGGACCCTGATGGTGGATAG 0: 1
1: 0
2: 2
3: 5
4: 112
Right 1083620683 11:64048010-64048032 CTGAGCCACCACTTCAGAGTGGG 0: 1
1: 0
2: 2
3: 12
4: 149
1083620673_1083620683 22 Left 1083620673 11:64047965-64047987 CCCTGATGGTGGATAGGAGCTTT 0: 1
1: 0
2: 0
3: 5
4: 142
Right 1083620683 11:64048010-64048032 CTGAGCCACCACTTCAGAGTGGG 0: 1
1: 0
2: 2
3: 12
4: 149
1083620674_1083620683 21 Left 1083620674 11:64047966-64047988 CCTGATGGTGGATAGGAGCTTTC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1083620683 11:64048010-64048032 CTGAGCCACCACTTCAGAGTGGG 0: 1
1: 0
2: 2
3: 12
4: 149
1083620679_1083620683 -8 Left 1083620679 11:64047995-64048017 CCCTGTGTGCTGGGCCTGAGCCA 0: 1
1: 0
2: 1
3: 25
4: 311
Right 1083620683 11:64048010-64048032 CTGAGCCACCACTTCAGAGTGGG 0: 1
1: 0
2: 2
3: 12
4: 149
1083620680_1083620683 -9 Left 1083620680 11:64047996-64048018 CCTGTGTGCTGGGCCTGAGCCAC 0: 1
1: 0
2: 4
3: 87
4: 519
Right 1083620683 11:64048010-64048032 CTGAGCCACCACTTCAGAGTGGG 0: 1
1: 0
2: 2
3: 12
4: 149
1083620677_1083620683 -1 Left 1083620677 11:64047988-64048010 CCCAGTGCCCTGTGTGCTGGGCC 0: 1
1: 0
2: 6
3: 46
4: 319
Right 1083620683 11:64048010-64048032 CTGAGCCACCACTTCAGAGTGGG 0: 1
1: 0
2: 2
3: 12
4: 149
1083620678_1083620683 -2 Left 1083620678 11:64047989-64048011 CCAGTGCCCTGTGTGCTGGGCCT 0: 1
1: 0
2: 3
3: 43
4: 389
Right 1083620683 11:64048010-64048032 CTGAGCCACCACTTCAGAGTGGG 0: 1
1: 0
2: 2
3: 12
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083620683 Original CRISPR CTGAGCCACCACTTCAGAGT GGG Intronic
904020078 1:27457158-27457180 ATGAGCCACCACGTCAGACCAGG + Intronic
904181677 1:28670206-28670228 GTGAGCCACCACTCCAGCCTGGG - Intronic
905928139 1:41766687-41766709 CTGAGCCAACACAGCAGAGAGGG - Intronic
910131099 1:83907447-83907469 ATGACCTACCACTTGAGAGTTGG + Exonic
910366633 1:86472291-86472313 CTGAGCCATCACTTCATATGAGG - Intronic
912457127 1:109805653-109805675 GTGAGCCAACATTTCAAAGTGGG - Intergenic
917623345 1:176820443-176820465 CTGAGGCAGCATTTCAGAATAGG + Intronic
918258346 1:182770708-182770730 ATGAGCCACCACATCAGGCTGGG - Intergenic
918904491 1:190475497-190475519 CTGAGCTAGCAGGTCAGAGTAGG + Intronic
920396798 1:205652476-205652498 GTGAGCCACCACTCCAGCCTGGG + Intergenic
920569120 1:207002968-207002990 CTTAGCCTGCACTTCAGAATGGG + Intergenic
922757693 1:228105634-228105656 TTGAGCCACAACTTCAGAGACGG + Intergenic
924414305 1:243843259-243843281 CTGAGTCATCACTAGAGAGTGGG - Exonic
924453195 1:244197892-244197914 CTGAGCCACCAGTTCAGAGCTGG - Intergenic
1062905996 10:1180141-1180163 CTGTGCCACCTCTGCAGAGATGG - Exonic
1064370459 10:14748061-14748083 CTGAGCCACCTCATCAGAGGAGG - Intronic
1065113272 10:22460477-22460499 CTGACCCACCACTTCAACATCGG - Intergenic
1069513102 10:69056701-69056723 CTGAGCCAAGAACTCAGAGTAGG + Intergenic
1069748567 10:70731610-70731632 CTGAGACAACTCTTCAGAGGTGG - Intronic
1069911224 10:71761031-71761053 CTGGGCCAACACTGCCGAGTAGG - Intronic
1073179952 10:101577700-101577722 CTGAGGGACCAGTCCAGAGTGGG + Intronic
1073711366 10:106046566-106046588 GTGAGCCAACACTCCAGCGTGGG - Intergenic
1074445738 10:113519826-113519848 CTCAGCCACCTCTTCACAGAAGG - Intergenic
1074592745 10:114829007-114829029 CTGAGCATCCACCTCAGAGCTGG - Intronic
1074824616 10:117205765-117205787 GTGAGCCACCACTTCTGACTTGG - Intronic
1077082075 11:728680-728702 CTGAGCCACCACCTCAGGACGGG + Intergenic
1077085078 11:746086-746108 CTGAGCCACCGCGTCAGCCTAGG + Intergenic
1077615568 11:3671281-3671303 CGGAGCCACCACCTCAGCCTGGG - Exonic
1077746205 11:4908944-4908966 CTGAGTCATCACTTCACAGCAGG - Intronic
1077992405 11:7423756-7423778 GTGAGCCATCATCTCAGAGTGGG + Intronic
1079079015 11:17401151-17401173 CTGAGACACCAATTGAGAGAGGG + Intronic
1080896263 11:36450957-36450979 CTGGGCCACCAATGCAGTGTGGG - Intronic
1081306338 11:41516599-41516621 CTGTGCCACCACTCCAGCATGGG - Intergenic
1083620683 11:64048010-64048032 CTGAGCCACCACTTCAGAGTGGG + Intronic
1088852378 11:113715501-113715523 CTGAGCCACTCCTTCAGGGCTGG - Intergenic
1089409278 11:118225621-118225643 CTTAGTCACCACTTCAAAATAGG + Intergenic
1092891774 12:12975604-12975626 CTGAGTCACCACTTCCTAGATGG + Intronic
1099443529 12:82726596-82726618 GTGAGCCACCACACCAGACTTGG - Intronic
1100743373 12:97619514-97619536 CTGACCAACCACTCCAGGGTAGG - Intergenic
1101225771 12:102686864-102686886 CTTAGTCACCATATCAGAGTTGG + Intergenic
1103125179 12:118415811-118415833 CAGAGCCAGAACTTCAGAGAAGG - Exonic
1103504878 12:121435641-121435663 CTTAGCCCCCACTTTTGAGTGGG - Intronic
1106646465 13:31639216-31639238 CTGAGCCACTGCTCCAGAGCTGG - Intergenic
1107742831 13:43471526-43471548 GTGAGCCACCACTTCTGGCTTGG - Intronic
1109401519 13:61835802-61835824 CTGAGTGACCCCATCAGAGTGGG + Intergenic
1110721257 13:78764958-78764980 CTGGCCCACCACCTCAGAATGGG + Intergenic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1114517237 14:23307946-23307968 CTGAGCCGCCAGATCAGAGAAGG - Exonic
1120141633 14:80936057-80936079 CTGCTCCAGCACTTCAGAGCAGG + Intronic
1121469299 14:94139543-94139565 TGGAGCCCCCACTTCAGATTAGG + Intergenic
1122787322 14:104169754-104169776 CTGGGCTACCTCTTCAGAGCTGG + Intronic
1122929106 14:104925330-104925352 CTGAGAGACCCCTGCAGAGTAGG - Intronic
1125633328 15:41166604-41166626 GTGAGCCACCACATCAGGCTAGG - Intergenic
1127520468 15:59738737-59738759 CTGAGCCATCACCTCACAGCTGG + Intergenic
1127996204 15:64154300-64154322 CTCAGCCCCCACTTGGGAGTAGG - Intronic
1128357565 15:66938827-66938849 CTGAGCCACCACATCAGCCCTGG + Intergenic
1128763052 15:70231605-70231627 CTGAGCCACCAATGAAGTGTAGG - Intergenic
1129336813 15:74857108-74857130 CTGAGCCACCAGTTCATAGAGGG + Intronic
1131362691 15:91807356-91807378 CTGAGCAAACTCTTCAGTGTTGG + Intergenic
1133464991 16:6020023-6020045 CTGACCCACCAGGTCAGGGTGGG - Intronic
1133916370 16:10113048-10113070 CTGAGCATCCCCTACAGAGTCGG + Intronic
1136605103 16:31328253-31328275 CTGAGCCTCCACTTCTGGGCTGG + Intronic
1139520536 16:67480423-67480445 CCCAGCCAGCAGTTCAGAGTTGG + Intronic
1140058841 16:71549667-71549689 CTCTGCCACTACATCAGAGTCGG - Intronic
1142150465 16:88510334-88510356 CTGAGCCAACCCCACAGAGTGGG - Intronic
1144106497 17:11991062-11991084 CTGAGGCACCACTTCAAGATGGG + Exonic
1146115697 17:30135928-30135950 ATGAGCCACCACTTGAGCCTGGG - Intronic
1146603326 17:34236765-34236787 CTGAGCAACCATGGCAGAGTTGG - Intergenic
1146715140 17:35079659-35079681 CTGTGTCAACATTTCAGAGTTGG + Intronic
1147674019 17:42192686-42192708 CTGAGCCAGCACTTCTGGGTAGG + Exonic
1147987026 17:44312677-44312699 CTCAGCCACCGCTTCAAAGGTGG + Exonic
1148966968 17:51443836-51443858 CTGAGCCACCACTTCTGCCTTGG + Intergenic
1149917975 17:60629363-60629385 CTGAGCCATCACTTGGGAGATGG + Intronic
1151882871 17:76905377-76905399 CAGGGCCCCCACTTCTGAGTGGG + Intronic
1152748789 17:82053071-82053093 CTGTGCCACCACATCAGGGAGGG - Intronic
1157443307 18:47726331-47726353 CTGAGCCTCCAAGTCAGAGTGGG - Intergenic
1161420546 19:4174205-4174227 CTGATCCCCCACTTCAAGGTGGG + Exonic
1164877453 19:31701381-31701403 CAAAGCGACCACTTCAGAGCAGG + Intergenic
1167988458 19:53338097-53338119 CTGAACCACAACCCCAGAGTAGG - Intronic
925006868 2:450150-450172 CTGAGGCTCCACTTCAGCGGTGG + Intergenic
926564817 2:14457283-14457305 TTGTGACACCACTTCAGAATGGG - Intergenic
926795442 2:16615461-16615483 CTGAGCCCCCACTGCAGGCTGGG + Intronic
927082861 2:19647750-19647772 CTCATCCCCCACTGCAGAGTTGG - Intergenic
928495067 2:31823114-31823136 CTGAGCCACCTCGTCATATTGGG + Intergenic
930316107 2:49798842-49798864 TTGAGCTACCACTTCAGAAAAGG - Intergenic
931858488 2:66329160-66329182 CTTAGCCACCAGTTCAGAGTTGG - Intergenic
933243063 2:79944383-79944405 CTGAGTCATCACTTTAAAGTTGG - Intronic
948211780 2:236199127-236199149 ATGAGCCACCACTTCCGACCTGG - Intronic
1169205868 20:3740116-3740138 CTGAGCCAGCATTTCAGGGCAGG - Intronic
1170999745 20:21400852-21400874 CTGGACCCCCACTTCAAAGTGGG - Intergenic
1172405926 20:34689132-34689154 CTGAGAGATCATTTCAGAGTGGG + Intergenic
1173558044 20:43982080-43982102 CAGAGCCACCACCTCTGAGCAGG - Intronic
1173582437 20:44157129-44157151 CAGAGTCACCACTACAGTGTCGG - Intronic
1180241609 21:46510991-46511013 CAGAACCACCACTTCAGCCTAGG - Intronic
1182523755 22:30902574-30902596 CTGGGCAGCCACTTCAGAGATGG + Intronic
1183745864 22:39691325-39691347 CGGAGCCCGCACCTCAGAGTGGG + Intergenic
950015366 3:9751160-9751182 CTGAGCCACCTCTTGGAAGTGGG - Exonic
953394990 3:42561783-42561805 CTGATCAATCACTTCAGAGCAGG + Intronic
954360643 3:50121028-50121050 CTGAGCCAGCTCCTCAGAGATGG + Intergenic
954414601 3:50387077-50387099 CAGTGCCACCACTTCTGAGGTGG + Intronic
958647464 3:96890801-96890823 ATGAGCCACCACATCTGACTGGG - Intronic
964282643 3:155082932-155082954 CTGAGCCGCCACTTCATCCTGGG + Intronic
967843384 3:194025002-194025024 CTGGGCCACCACTTCAAAAGGGG + Intergenic
969596662 4:8152926-8152948 CTGAGACCCCACTTCAAGGTAGG + Intronic
973267308 4:48223763-48223785 GTGAGCCACCTCATCAGTGTTGG - Intronic
974188679 4:58474794-58474816 CTCAGCCCCCACTTCCCAGTAGG - Intergenic
976195527 4:82528323-82528345 CTGAGCCAGAACTTCAGAGGTGG - Intronic
978170011 4:105658682-105658704 CAGAGCCAGCACTTGAGGGTAGG - Intronic
983539131 4:168889777-168889799 CTGAATCACAAATTCAGAGTTGG - Intronic
985541142 5:488285-488307 CGGAGCCACCGCTCCAGAGCGGG - Intronic
985777338 5:1851633-1851655 CTGAGCCACTCCACCAGAGTGGG - Intergenic
993959891 5:94284748-94284770 TTAAGGGACCACTTCAGAGTGGG - Intronic
994287388 5:97985764-97985786 CTTAGCCACATTTTCAGAGTGGG - Intergenic
994620001 5:102151454-102151476 CTGAGCCACTTCTCCAGGGTTGG - Intergenic
995941157 5:117586405-117586427 CTGAGGCACGATTTCAGAGGAGG + Intergenic
996726640 5:126678466-126678488 GTGAGCCACCACGCCAGAGCTGG - Intergenic
997293403 5:132753905-132753927 CTGAGCCACACATTCAGAGGTGG + Exonic
998203742 5:140145076-140145098 CTCAGCCATCACTTCAGAGCAGG + Intergenic
998743119 5:145227785-145227807 CTGAGCCTGCACTTCAGCCTGGG - Intergenic
998773701 5:145574480-145574502 CAGTGCCATCACCTCAGAGTGGG - Intronic
999311199 5:150553390-150553412 CTGAGCCAGACCTGCAGAGTGGG + Exonic
999610691 5:153366145-153366167 CTGAGCCAAGACTTCAAAGAAGG + Intergenic
999642880 5:153689481-153689503 CTAATCCACTACTCCAGAGTTGG - Intronic
1000268910 5:159664361-159664383 ATGAGGCACCACTTGAGGGTGGG + Intergenic
1001315700 5:170639784-170639806 CTGAGTCACTACGTCAGAGCAGG - Intronic
1002778272 6:347244-347266 AAGAGCCACTACTTGAGAGTGGG + Intronic
1005198278 6:23314090-23314112 TTGAACCACCACTTCAGAGAAGG - Intergenic
1006634523 6:35452497-35452519 CTGAGGCCCCACACCAGAGTAGG + Exonic
1006637807 6:35473191-35473213 CTGAGCCACCTGTCCACAGTAGG - Intergenic
1007424376 6:41737143-41737165 CTGAGCCACCAGAGCAGAGCGGG + Intronic
1010570367 6:77466730-77466752 CTGGGTCACCCCTTCGGAGTAGG + Intergenic
1013951122 6:115782968-115782990 CTGAGCCAGCAGCTCAGAGCGGG - Intergenic
1014104762 6:117549113-117549135 CTTAGTCTCCACTTCAGAGGGGG + Intronic
1014325276 6:119986131-119986153 CTGAGTCACTATTTCAGAGCTGG + Intergenic
1017826827 6:158087631-158087653 CTAAGCCATTACTTCAGAATTGG + Intronic
1023437837 7:40156614-40156636 AGGAGCCACCACCTCAGAGGTGG - Intronic
1026911472 7:74093993-74094015 CTGAGCCACCAAGTCAGCCTGGG + Intronic
1028476970 7:91264357-91264379 CTGAGCCTCCAGTTCTGCGTCGG + Exonic
1029215176 7:98942908-98942930 CTGAGACACAACTTCACAGTAGG - Intronic
1029309466 7:99649024-99649046 CTGAGTCACCCCTTCACTGTTGG + Intronic
1030001528 7:105069100-105069122 CTGTGCCCCAAATTCAGAGTTGG + Intronic
1034457572 7:151179554-151179576 AGGAGCCACCACTTTAGACTTGG - Intronic
1035074712 7:156169853-156169875 GGGAGCCCCCACTTCAGAGGAGG - Intergenic
1035471525 7:159112806-159112828 GTGAGCCTCCTCTTCACAGTCGG - Intronic
1035988351 8:4459419-4459441 CTGAGCCACTGCTTCAGACGTGG - Intronic
1041543006 8:59008539-59008561 CTAAGCCATCACCTGAGAGTGGG + Intronic
1044200842 8:89433875-89433897 CTGAGTGAACATTTCAGAGTAGG - Intergenic
1045965594 8:108021340-108021362 CTGAGCCCCCACTTCCCAGATGG + Intronic
1048722223 8:137338900-137338922 CTGAGACAGCAATGCAGAGTTGG - Intergenic
1048899793 8:139026677-139026699 CTTAGACACCCCTTCAGAGTGGG - Intergenic
1049145640 8:141000198-141000220 CTAAGCCACCGCGGCAGAGTCGG + Intronic
1051279808 9:15431064-15431086 CTGAGCCAGCACATCAGATCAGG - Intronic
1051955797 9:22691683-22691705 CTGTGCCTCCCCTTCACAGTAGG - Intergenic
1055499947 9:76893432-76893454 CTGACCCATCACTTCAGGGAGGG - Intronic
1057273394 9:93663463-93663485 CTGACCCCCCACTTCTGTGTGGG + Intronic
1060391764 9:123283625-123283647 CTGAGCCTGGAGTTCAGAGTGGG - Intergenic
1061601603 9:131674113-131674135 TTGAACCACCACTGCAGAGCAGG + Intronic
1062280077 9:135747856-135747878 CTGAGCCTCCTCTTCAGCATGGG + Intronic
1187947973 X:24444940-24444962 CTGCGCATCCACCTCAGAGTTGG - Intergenic
1190922641 X:54870671-54870693 CTCAGCCACAACCTCACAGTAGG - Intergenic
1195458268 X:105094043-105094065 CTGAGCCACCTCCTCAGATGTGG + Intronic
1197861338 X:130974227-130974249 GTGAGCCACAACTCCAGAGCTGG + Intergenic
1198849414 X:140950081-140950103 GTGAGCCACCACTCCCGACTGGG + Intergenic
1201886701 Y:18892207-18892229 ATGAGCCACCACTTAAGGCTGGG - Intergenic