ID: 1083622752

View in Genome Browser
Species Human (GRCh38)
Location 11:64057066-64057088
Sequence AGAGCTGGTGCGACGCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083622752_1083622759 27 Left 1083622752 11:64057066-64057088 CCAGCCTGCGTCGCACCAGCTCT 0: 1
1: 0
2: 1
3: 4
4: 136
Right 1083622759 11:64057116-64057138 TCGGCTCCCTAAGTGCTTGCTGG 0: 1
1: 0
2: 0
3: 6
4: 97
1083622752_1083622757 8 Left 1083622752 11:64057066-64057088 CCAGCCTGCGTCGCACCAGCTCT 0: 1
1: 0
2: 1
3: 4
4: 136
Right 1083622757 11:64057097-64057119 AGGGCTTCCTGTGTGTTCATCGG 0: 1
1: 0
2: 1
3: 27
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083622752 Original CRISPR AGAGCTGGTGCGACGCAGGC TGG (reversed) Intronic
904042364 1:27592303-27592325 GGTGCGGGTGCGAGGCAGGCAGG - Intronic
906199411 1:43949410-43949432 AGAGCTGGTGCAGCGCCTGCAGG - Exonic
907138947 1:52166869-52166891 AGATCTGGTGTCACCCAGGCTGG - Intronic
907302699 1:53498535-53498557 AAAGATGGTGAGACCCAGGCTGG - Intergenic
911157957 1:94655162-94655184 GGAGCTGGAGGGACGCAGCCTGG - Intergenic
914847097 1:151289306-151289328 AGGGCTGGTGGGGCGCAGGAGGG + Intronic
915308567 1:154995092-154995114 AGAGCTGGTCCCAGGCAGGGAGG - Intergenic
916890933 1:169111744-169111766 ATAGCTGGTGGGTAGCAGGCTGG - Intronic
919587514 1:199457124-199457146 AGAGCTAGTGTGAGGCAGGAAGG + Intergenic
920091457 1:203455902-203455924 GGAGCTGGTGGGGCGCAGGGTGG + Intergenic
920634414 1:207685785-207685807 AGAGCTGGTGAGGCACATGCAGG - Intronic
922768968 1:228171669-228171691 GGAGCTGGGGCAAGGCAGGCAGG - Intronic
1064816822 10:19274812-19274834 AGAGCTGGGGGGAGGCAGGAAGG + Intronic
1067203423 10:44194247-44194269 AGACCAGGTGAGAGGCAGGCAGG - Intergenic
1070735264 10:78859647-78859669 CGAGCTGGTGAGACACAGGATGG - Intergenic
1073148027 10:101293027-101293049 AGAGCTGGAGAGACACAGGGTGG - Intergenic
1073430189 10:103480799-103480821 AGGGCTGGTGTGGAGCAGGCGGG + Intergenic
1075361383 10:121838321-121838343 TGAGCTGGTGAGAAGGAGGCAGG - Intronic
1075815827 10:125264231-125264253 GCAGCTGCTGGGACGCAGGCTGG + Intergenic
1076711677 10:132339133-132339155 AGAGCTGGTGGGATGCGGGTGGG + Intronic
1076921949 10:133458895-133458917 GGAGCTGGTGAGACCAAGGCTGG + Intergenic
1077230869 11:1457662-1457684 GGAGCTGCTGAGATGCAGGCTGG - Intronic
1077231955 11:1461667-1461689 AGAGCTGGTGGGGCGCGGGGGGG + Exonic
1077376994 11:2209754-2209776 AGAGCGGGAGCCAGGCAGGCTGG - Intergenic
1077825497 11:5804464-5804486 AGAGCTGATGGGAAGCAGGTAGG + Intronic
1078083051 11:8217830-8217852 AGAGCTGGGCCGAGGCAGGTGGG - Intergenic
1079603609 11:22341043-22341065 AGAGCTGCTCCGCTGCAGGCGGG - Intronic
1080183729 11:29454374-29454396 AGAGTTGGTGAGACTCAGGATGG - Intergenic
1083622752 11:64057066-64057088 AGAGCTGGTGCGACGCAGGCTGG - Intronic
1084835728 11:71800709-71800731 AGAGCTGCTGCGACTCCCGCAGG + Exonic
1090952898 11:131489091-131489113 AGAGCTGGAGCCACGGAGGAAGG - Intronic
1092407597 12:8231694-8231716 AGAGCTGCTGCGACTCCCGCAGG - Intergenic
1094569192 12:31626993-31627015 AGAGATGGAGCAGCGCAGGCAGG + Intergenic
1094812201 12:34149535-34149557 AGCACTGGTGAGACCCAGGCTGG + Intergenic
1101444614 12:104728753-104728775 AGAGCTGGTGGGACCCAGGAGGG - Intronic
1104398185 12:128453432-128453454 AAAGCTGGTGAGACACAGGAAGG - Intronic
1104680550 12:130748262-130748284 AGGGCTGGTGCGAGCCAGCCTGG - Intergenic
1105392743 13:19996291-19996313 AGAGCTGGTGCCAAGCATGGTGG + Intronic
1108449997 13:50551781-50551803 ACAGCTGGAGCGTCTCAGGCTGG - Intronic
1112238790 13:97660674-97660696 AGAGCCGGTGCAAGGCAGGCTGG + Intergenic
1117986006 14:61386740-61386762 AGTGCTGGTGGGAGGCAGGGAGG + Intronic
1120848875 14:89150646-89150668 AGAGCTGGTGCCAGGCAGCAAGG + Intronic
1123165076 14:106318866-106318888 AGAGCAGGTGCACCGGAGGCTGG - Intergenic
1125325003 15:38527399-38527421 AGAGCTGGTGCCATGAAGGGAGG - Intronic
1128317539 15:66670544-66670566 AGGGGTGGTGGGAGGCAGGCGGG + Intronic
1129106127 15:73308484-73308506 ATTGCTGGTGAGACTCAGGCAGG - Intergenic
1132855020 16:2040859-2040881 AGAGCTGTTGCCACCCAGCCTGG - Intronic
1134055406 16:11166804-11166826 AGAGCTGATGGGCAGCAGGCGGG + Intronic
1134411158 16:14004067-14004089 AGGACTGGTGGGAGGCAGGCAGG + Intergenic
1135867806 16:26120574-26120596 AGAGCTGGTGCGTGGCAGTGTGG + Intronic
1136345369 16:29672061-29672083 AGACAGGGTGCCACGCAGGCTGG - Intronic
1141557110 16:84843487-84843509 AGAGCTGGCTGGACGGAGGCAGG - Intronic
1141698840 16:85633240-85633262 AGAGATGGGGCCACACAGGCAGG - Intronic
1142120171 16:88383180-88383202 AGCGCTGGGGCGGCGCGGGCCGG + Intergenic
1142234133 16:88913518-88913540 ACAGCTGGTGAGAGGGAGGCTGG + Intronic
1143681721 17:8480778-8480800 ACAGCTGGAGAGAGGCAGGCAGG - Intronic
1143857235 17:9860985-9861007 AGAGCTGGAGAGACCCAGGGTGG - Intronic
1144705397 17:17364471-17364493 AGAGCCAGTCAGACGCAGGCAGG - Intergenic
1145214889 17:21043521-21043543 TGAGCTGGAGCGCCGCAGGTCGG + Intronic
1146372606 17:32274994-32275016 AGAGCGGGTGCATGGCAGGCAGG - Intronic
1149605713 17:57923702-57923724 AGAGCTGGTGGGGCGCTGGGTGG + Intronic
1152628049 17:81397191-81397213 AGAGCCGTGGCGGCGCAGGCAGG + Intronic
1152676095 17:81642116-81642138 AGCGCAGGTGTGACTCAGGCAGG - Intronic
1152776535 17:82205493-82205515 GCAGCTGGAGCCACGCAGGCTGG - Intronic
1155671751 18:28379947-28379969 AGAGCTTGTGGGAGGCAGGGTGG + Intergenic
1162709043 19:12578066-12578088 AGAGCTGGAGCGCTGCAGGGTGG + Exonic
1163133067 19:15288644-15288666 GCAGCTGGTGCTACACAGGCTGG + Intronic
1165333685 19:35154979-35155001 AGAGCTGGGGAGACTGAGGCAGG - Exonic
1165739611 19:38197577-38197599 GGAGATGGTGGGACGGAGGCTGG - Intronic
1166324186 19:42039078-42039100 TGAGCTGGTGGGCCTCAGGCGGG - Intronic
1167693042 19:50999009-50999031 AGAGCAGGAGTGAGGCAGGCAGG + Intronic
925240845 2:2325898-2325920 AGAGCTGGAGATAGGCAGGCAGG + Intronic
926154957 2:10448474-10448496 GGAGCTGGTGGGGCGCCGGCGGG + Exonic
931212717 2:60213232-60213254 AGAGCTAGGGCGACTCAGGAGGG - Intergenic
932848109 2:75155494-75155516 AGAGCTGGTGATACTCAGGTGGG - Intronic
944809316 2:203312314-203312336 AGAGCTGGGGAGAGGAAGGCTGG + Intergenic
945119373 2:206442921-206442943 AGAGCGTTTGCGCCGCAGGCTGG - Intergenic
945251551 2:207769452-207769474 AGAACAGGGGCGGCGCAGGCCGG + Exonic
946163360 2:217849067-217849089 AGAGGTGGTGGGACACACGCAGG - Exonic
948364240 2:237444448-237444470 AGAGCTGCTGGGAGGGAGGCAGG - Intergenic
948399178 2:237670696-237670718 AGAGCTGGGCCCAGGCAGGCAGG - Intronic
948663603 2:239521279-239521301 AGAGCTGGTGCGAGGCGTGCAGG + Intergenic
1169227856 20:3867187-3867209 AGAGCTGGTGAGAGGCAGGTTGG - Exonic
1169748465 20:8966878-8966900 AGAGCTGGTGAGAAACAGACCGG + Intronic
1171400968 20:24872824-24872846 AGAGCTGGTGAGCAGCTGGCTGG + Intergenic
1175491126 20:59381791-59381813 AAAGCTGCTGCGCCCCAGGCAGG + Intergenic
1176241256 20:64076907-64076929 AGAGCTGGTACCACGGAGCCTGG - Exonic
1179100992 21:38355526-38355548 AAAGCAGGAGCGAGGCAGGCAGG + Intergenic
1179265559 21:39799332-39799354 AGAGCTGCTGCTACGCCAGCAGG - Intronic
1183675740 22:39297845-39297867 AGAGCTGGTGGGGCCCAGGGAGG - Intergenic
1184995997 22:48208070-48208092 GAGGCTGGTGTGACGCAGGCAGG - Intergenic
1185171196 22:49295594-49295616 AGAGATGGTGGGAGGCGGGCAGG - Intergenic
950525141 3:13518904-13518926 AGGGCTGGCGAGACCCAGGCAGG + Intergenic
950649109 3:14396288-14396310 AGGGCTGGTGCAGGGCAGGCAGG + Intergenic
951080422 3:18445140-18445162 GGAGCTTGTGCGGCGCGGGCTGG + Intronic
954324662 3:49856839-49856861 AGAGCTGGCGCGAGGCAGGCTGG + Intergenic
956664174 3:71626751-71626773 AAAGCTGGAGAGAAGCAGGCAGG - Intergenic
957052649 3:75422068-75422090 AGAGCTGCTGCGACTCCTGCAGG - Intergenic
960640085 3:119815612-119815634 AGAGCTGGAGTCACCCAGGCAGG - Intronic
961568615 3:127782542-127782564 AGTGCTGGCGCGGGGCAGGCAGG + Intronic
961886262 3:130098289-130098311 AGAGCTGCTGCGACTCCCGCAGG - Exonic
966208173 3:177425719-177425741 AGAGCTGGTGCTAAGGAGTCTGG + Intergenic
969240159 4:5892398-5892420 AGAGCTGGGGCGACTCGGTCGGG - Intronic
969669884 4:8583750-8583772 AGAGCTGGTGCCACTCAGCGTGG - Intronic
980005669 4:127539659-127539681 AGAGCTGGTGAAACGCAGAATGG - Intergenic
980167789 4:129250145-129250167 AGAGCTGGTGTCACTCAGGGTGG + Intergenic
985645241 5:1081855-1081877 ACAGCTTGTGCGCCGCAAGCAGG + Intronic
987088218 5:14488296-14488318 AGAGCTGGCGGGACAGAGGCAGG - Intronic
1000128235 5:158268517-158268539 AGAGCTGCTGCCAGGCGGGCAGG + Intergenic
1002019683 5:176355108-176355130 GGAGCTGGAGAGATGCAGGCAGG + Intronic
1006072973 6:31509941-31509963 AGTGCTGGTGAGATCCAGGCAGG - Exonic
1015473415 6:133632540-133632562 AGAGCTGGTGAGGACCAGGCAGG + Intergenic
1016577286 6:145583910-145583932 AGTGCTGGTGCAGAGCAGGCAGG + Intronic
1018230401 6:161669895-161669917 AGAGCCTGTGCGCTGCAGGCTGG - Intronic
1019390440 7:783749-783771 AGAGCTGGGAGGGCGCAGGCAGG - Intronic
1024645667 7:51368499-51368521 AGAGCTGCTGGGATGCAGGGAGG + Intergenic
1024965933 7:55021870-55021892 ACAGCTGGTGGGAGGCAGACGGG + Intronic
1025176153 7:56803472-56803494 AGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1029487508 7:100852601-100852623 GGAGCTGGAGCAGCGCAGGCTGG + Intronic
1030731206 7:112991485-112991507 AGAGCTAATGCGAAGCAGGAAGG + Intergenic
1031993185 7:128211072-128211094 AGAGCTGGAGAGGCTCAGGCCGG + Intergenic
1033366932 7:140678858-140678880 TGGGCTGGTGTGAGGCAGGCGGG + Intronic
1037367728 8:18140789-18140811 AGAGCTGATGGGAAGCAGGTAGG - Intergenic
1037925165 8:22838681-22838703 AGAGCTGGGGCGATGCTGCCAGG + Intronic
1038176165 8:25184070-25184092 AGAGCTGGTGCAAGGGAGGTGGG - Intergenic
1039554823 8:38468183-38468205 GGAGCTGGTGCCCCGGAGGCGGG + Intronic
1044752797 8:95432106-95432128 AGAGGTGGTGCGACCCACCCTGG - Intergenic
1045489386 8:102656843-102656865 CCAGCTGGTGGGAGGCAGGCTGG + Intergenic
1045744315 8:105399365-105399387 AGAGATGGTGAGAGGCAGTCAGG + Intronic
1046674380 8:117092679-117092701 AGAGCTGGGGAGGCACAGGCAGG + Intronic
1048251419 8:132869528-132869550 AGAGCAGGTGCTAGCCAGGCAGG + Intronic
1053569339 9:39288108-39288130 AGAGCAGGAGCGACGCAGAGCGG - Exonic
1054127803 9:61330902-61330924 AGAGCAGGAGCGACGCAGAGCGG + Intergenic
1058051295 9:100409678-100409700 AGAGATGGTGTGACACAGACAGG + Intergenic
1058587912 9:106530436-106530458 AGAGCTGGTGTGATCTAGGCTGG - Intergenic
1059428017 9:114233166-114233188 AGAGCTGGTGAGACTCTGGGAGG + Intronic
1060755009 9:126206298-126206320 TGAGGTGGAGCGAGGCAGGCCGG - Intergenic
1061080563 9:128367321-128367343 AGAGGAGGTGGGAGGCAGGCAGG + Intergenic
1061248991 9:129415607-129415629 GGAGCTGGTGTGACCCAGGATGG + Intergenic
1061889223 9:133608950-133608972 GGACCTGGTGCGAGGCAGCCGGG + Intergenic
1062040266 9:134401327-134401349 AGGGTTGGAGCGACCCAGGCGGG + Intronic
1186163537 X:6803142-6803164 AGAGCTGGAGAGCCCCAGGCAGG + Intergenic