ID: 1083623515

View in Genome Browser
Species Human (GRCh38)
Location 11:64060322-64060344
Sequence TGCCCCCGATTTTACAGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2434
Summary {0: 1, 1: 2, 2: 21, 3: 316, 4: 2094}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083623515_1083623523 30 Left 1083623515 11:64060322-64060344 CCTCATCTGTAAAATCGGGGGCA 0: 1
1: 2
2: 21
3: 316
4: 2094
Right 1083623523 11:64060375-64060397 AGACCCAGAAGGCCTCGGATTGG 0: 1
1: 0
2: 1
3: 14
4: 126
1083623515_1083623519 19 Left 1083623515 11:64060322-64060344 CCTCATCTGTAAAATCGGGGGCA 0: 1
1: 2
2: 21
3: 316
4: 2094
Right 1083623519 11:64060364-64060386 GCCTTTCTGCCAGACCCAGAAGG 0: 1
1: 0
2: 3
3: 21
4: 175
1083623515_1083623521 25 Left 1083623515 11:64060322-64060344 CCTCATCTGTAAAATCGGGGGCA 0: 1
1: 2
2: 21
3: 316
4: 2094
Right 1083623521 11:64060370-64060392 CTGCCAGACCCAGAAGGCCTCGG 0: 1
1: 0
2: 1
3: 30
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083623515 Original CRISPR TGCCCCCGATTTTACAGATG AGG (reversed) Intronic
Too many off-targets to display for this crispr