ID: 1083623719

View in Genome Browser
Species Human (GRCh38)
Location 11:64061304-64061326
Sequence CAGCGTGAAGGAAGGGCAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 488
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 459}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083623719_1083623724 4 Left 1083623719 11:64061304-64061326 CCGTCTGCCCTTCCTTCACGCTG 0: 1
1: 0
2: 3
3: 25
4: 459
Right 1083623724 11:64061331-64061353 TCCGCCCCCAGCCCGCAGCCTGG 0: 1
1: 0
2: 3
3: 46
4: 460
1083623719_1083623732 13 Left 1083623719 11:64061304-64061326 CCGTCTGCCCTTCCTTCACGCTG 0: 1
1: 0
2: 3
3: 25
4: 459
Right 1083623732 11:64061340-64061362 AGCCCGCAGCCTGGAGGTGAGGG 0: 1
1: 0
2: 3
3: 29
4: 294
1083623719_1083623731 12 Left 1083623719 11:64061304-64061326 CCGTCTGCCCTTCCTTCACGCTG 0: 1
1: 0
2: 3
3: 25
4: 459
Right 1083623731 11:64061339-64061361 CAGCCCGCAGCCTGGAGGTGAGG 0: 1
1: 0
2: 3
3: 54
4: 411
1083623719_1083623726 7 Left 1083623719 11:64061304-64061326 CCGTCTGCCCTTCCTTCACGCTG 0: 1
1: 0
2: 3
3: 25
4: 459
Right 1083623726 11:64061334-64061356 GCCCCCAGCCCGCAGCCTGGAGG 0: 1
1: 0
2: 4
3: 46
4: 471
1083623719_1083623736 25 Left 1083623719 11:64061304-64061326 CCGTCTGCCCTTCCTTCACGCTG 0: 1
1: 0
2: 3
3: 25
4: 459
Right 1083623736 11:64061352-64061374 GGAGGTGAGGGCCCTCTGCTAGG 0: 1
1: 0
2: 1
3: 35
4: 645

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083623719 Original CRISPR CAGCGTGAAGGAAGGGCAGA CGG (reversed) Intronic
900764855 1:4497981-4498003 CAGCCTGGAGGGAGGGGAGAAGG - Intergenic
901814774 1:11787888-11787910 GAGCTGGAAGGCAGGGCAGAGGG - Exonic
902993739 1:20207796-20207818 CAGTGTGAAGCAAGACCAGAAGG + Intergenic
903190974 1:21655847-21655869 CAGGGAGATGGAAGGGGAGAGGG + Intronic
903766052 1:25735031-25735053 CAGCTTGAAGAAAGGGCTGGAGG + Intronic
903789997 1:25886243-25886265 CAGTGGGAGGGAAGGGCAGAGGG + Intronic
905147092 1:35895212-35895234 CAACTTGTAGGCAGGGCAGATGG - Exonic
906231002 1:44164307-44164329 CAGCAGTAAGGAAGGGAAGATGG + Intergenic
906746238 1:48224095-48224117 CAGGGTGAGGGCAGGGCAGTGGG - Intronic
906793582 1:48679123-48679145 CAGCCTGAAGGGTGGGCACAGGG + Intronic
907053099 1:51342963-51342985 CAGTGTGCAGGGAGAGCAGAGGG - Intronic
907357190 1:53886032-53886054 CAGGGGGAAGGAATGCCAGAAGG + Intronic
907670568 1:56471371-56471393 AGGAGTGAAGGAAGGGAAGAAGG + Intergenic
907722075 1:56981438-56981460 GAGGGAGAAGGAAGGACAGATGG - Intergenic
910860940 1:91741856-91741878 CAGTGTGGAGGAGGGGTAGAAGG - Intronic
910886875 1:91973157-91973179 TAGAGTGAGGTAAGGGCAGAGGG + Intronic
912358405 1:109074043-109074065 CAGGGTGGCGGCAGGGCAGAGGG - Intronic
912689315 1:111792420-111792442 CAGGGTCAGGGAAGGACAGAAGG + Intronic
912933897 1:113986353-113986375 CAGGGAGAAGCCAGGGCAGAAGG + Intergenic
913406299 1:118495776-118495798 CACGGTGAAGGAGGAGCAGAGGG + Intergenic
915106973 1:153540803-153540825 CAGCGGGCAGGGAGGGCAGGGGG + Intronic
915733959 1:158072873-158072895 TAGCAGGAAGGAAGGGGAGAGGG + Intronic
915835943 1:159174720-159174742 ATGTGAGAAGGAAGGGCAGATGG - Intronic
916008196 1:160680846-160680868 CAGGGAGAAGGAAGGGCAAGTGG - Intronic
916291782 1:163174852-163174874 CAGCGAGAAGGAAGAAGAGAGGG + Intronic
916431691 1:164736151-164736173 CAGGGTGAAGGGAGGGGAGAGGG - Intronic
919367130 1:196675811-196675833 CAGAGTGAAGGAGGAGGAGAAGG + Intronic
919914776 1:202132630-202132652 CAGGGTGAAGGAGAGGCCGAGGG + Exonic
920039260 1:203085266-203085288 CAGTGGGGAGGAAGTGCAGAAGG - Intronic
920198804 1:204246646-204246668 CTGGGTGAAGAAAAGGCAGAGGG + Intronic
922354786 1:224765409-224765431 CTGCTGGAAGGAGGGGCAGATGG + Intergenic
922542397 1:226429204-226429226 GAGCGTGGGGGAAGGGGAGAGGG + Intergenic
922604542 1:226881336-226881358 CAGGAGGAGGGAAGGGCAGAAGG - Intronic
922804676 1:228379105-228379127 CAGCGTGATGGAAGAGAGGAAGG - Intergenic
923086592 1:230707447-230707469 CAGCATGAAAGTAGGGCAGCTGG + Intronic
923573510 1:235137764-235137786 CAATGTGAGGGAAGCGCAGAAGG - Intronic
923625437 1:235610139-235610161 CAAAGTCAAGGAAGGGCTGAGGG - Intronic
924444886 1:244119971-244119993 CAGCGTGTAGGAAGGGTTGAAGG + Intergenic
1062795385 10:341285-341307 CAGCTTAATGGAACGGCAGAAGG + Exonic
1063904627 10:10768954-10768976 CAGGTAGAAGGAAGGACAGAGGG - Intergenic
1064009216 10:11722120-11722142 CAGAGCTAAGGATGGGCAGAGGG - Intergenic
1064315660 10:14253716-14253738 CAAGGTGAAGGAAGAGCAAATGG - Intronic
1064612077 10:17114124-17114146 CAGCGTGCAGGCAGGGCTGTTGG + Exonic
1064709452 10:18108988-18109010 CAGAGTCAAGGAAAGGAAGAGGG - Intergenic
1065063047 10:21927954-21927976 CAGAGTAAAGGAAGGGAAGGAGG + Intronic
1065865444 10:29911118-29911140 CAGCAGGCAGGAAAGGCAGATGG - Intergenic
1065874170 10:29982927-29982949 CAGAAAGAAGGAAGGGAAGAAGG + Intergenic
1066448496 10:35506562-35506584 CAGCATGAAGAAAGGGAAGAAGG - Intronic
1066584896 10:36922000-36922022 CAGGGAGAAAGAAGGGAAGATGG - Intergenic
1066707977 10:38202003-38202025 CAGAGTGAAGGCAGTGAAGAGGG + Intergenic
1069416314 10:68203968-68203990 CAGCGTGGAGGTAGAGAAGAAGG - Intronic
1070626441 10:78054372-78054394 AAGCTTGAAGGAAGGGCACTTGG - Intronic
1070732606 10:78841739-78841761 GAGCATGGAGGAAGGGCAGGGGG + Intergenic
1071468468 10:85961790-85961812 AAGCCTGAAGGAAGGGAAAAAGG - Intronic
1071516816 10:86303462-86303484 CAGCAGGAAGGAGGGGCACAGGG + Intronic
1071885846 10:89950164-89950186 CAACTTGTTGGAAGGGCAGAAGG - Intergenic
1071994802 10:91137271-91137293 AAGCATAAAGGAAGGGAAGAAGG + Intergenic
1072782317 10:98259248-98259270 GAGGGTGGAGGAAGGGCTGAGGG + Intronic
1073285519 10:102385267-102385289 CAGGAAGAAGGAAGGGAAGAGGG - Intergenic
1074437194 10:113444254-113444276 CAGTGGGAAAGAAGGACAGAGGG - Intergenic
1074495310 10:113975179-113975201 TAGCGTGAAGGAAGGAATGAAGG - Intergenic
1075055494 10:119215430-119215452 CAGTGTGGAGGAGGGGGAGAAGG + Intronic
1076040468 10:127243515-127243537 CAGGTAGAAGGAAGGGCAGGTGG - Intronic
1076619641 10:131778991-131779013 CAGCCTGCAGGAAGGGCCCAAGG + Intergenic
1076835067 10:133016884-133016906 CAGCGGGAAGGAAGGAGGGAAGG - Intergenic
1077185774 11:1234750-1234772 CAGCGGGCAGGGAGGGCAGGGGG + Intronic
1077331950 11:1987744-1987766 GGGCGGGAAGGACGGGCAGATGG - Intergenic
1077366662 11:2163975-2163997 CAGTGTCAGGGAAGGGCGGAGGG + Exonic
1077370217 11:2178212-2178234 CAGCTGGAAGGAAGGGCATCCGG + Intergenic
1077729385 11:4713402-4713424 CAGAGTGTAGGAAGAACAGAAGG - Intronic
1078619881 11:12897451-12897473 CAGGTTGAATGAAGGGGAGAGGG + Intronic
1079081587 11:17417008-17417030 CAGCGTGATGGAAAGGCAATGGG - Intronic
1081960227 11:47130635-47130657 CAGTGTGGGGGAAGGGAAGAAGG - Intronic
1082651574 11:55800332-55800354 CAGGGTGAAGGTTGGGAAGAGGG + Intergenic
1083623719 11:64061304-64061326 CAGCGTGAAGGAAGGGCAGACGG - Intronic
1084196787 11:67527295-67527317 CAGAGGGAAGGATGGGTAGAAGG + Intergenic
1084890590 11:72235049-72235071 CAGCGCGTAGGAGGGGCAGGAGG + Intronic
1085774919 11:79357042-79357064 CAGAGTGAAAGAAGAGAAGAGGG - Intronic
1086398984 11:86445461-86445483 CAGTGAGAAGGAAATGCAGAAGG + Intronic
1086437625 11:86798102-86798124 CAGCTGGAAGGAAGGGAAGAAGG - Intronic
1088044297 11:105428840-105428862 CTGAGTGAAGAAGGGGCAGATGG - Intergenic
1088628369 11:111749819-111749841 CAGTGTGAAAGCAAGGCAGATGG - Intronic
1088671969 11:112150556-112150578 CACAGGGAAGGAAGGGAAGACGG - Intronic
1089286136 11:117409353-117409375 CAGAGAGAAGGAAGGGGAGAGGG - Intronic
1089628794 11:119770534-119770556 CACAGAGGAGGAAGGGCAGAGGG + Intergenic
1089744202 11:120605718-120605740 CAGCGTGGCTGAAGGGCAGGGGG - Intronic
1090193878 11:124799456-124799478 CAGGATTGAGGAAGGGCAGAAGG - Intronic
1090482731 11:127082299-127082321 CAGAGTGAGGGAAGGGCACAAGG - Intergenic
1090500775 11:127258458-127258480 GAATGTGAAGGAAGAGCAGATGG - Intergenic
1202814931 11_KI270721v1_random:42920-42942 GGGCGGGAAGGACGGGCAGATGG - Intergenic
1092258133 12:6938103-6938125 CAGAGGGAAGGAAGGAAAGAGGG - Intronic
1092284305 12:7120082-7120104 CAGAGTAAAGTGAGGGCAGAGGG + Intergenic
1094167692 12:27459469-27459491 CAGGGTGCAGGATGGGAAGAAGG + Intergenic
1095375299 12:41520078-41520100 CAGTGTGGAGGAAGAGAAGAGGG - Intronic
1096231992 12:49901942-49901964 CAGGGTGGAGGAAGGGCAAGAGG + Intronic
1097194983 12:57238239-57238261 CAGCGAGAAGGAAAGGGAGGCGG - Intronic
1098051726 12:66461442-66461464 CAGAGTGCAGGAAGGGCCCACGG + Intronic
1099930513 12:89068792-89068814 CAACATGAAGGAAGGGGGGAAGG + Intergenic
1100000259 12:89826100-89826122 CAGGGTGAAGGAGGAGGAGAAGG - Intergenic
1100466191 12:94848042-94848064 CAATGTGAAGCAAAGGCAGAAGG - Intergenic
1100602620 12:96124947-96124969 CAGCCTGCAGAAAGGGGAGAAGG + Intergenic
1102253423 12:111403032-111403054 CAGCAAGAAGGAAGGGCGGTTGG + Intergenic
1103206042 12:119129946-119129968 CAGATGGAAGGAAGGACAGATGG + Intronic
1103242483 12:119425928-119425950 CTGAGTGAAGGAAAGGCAAAGGG + Intronic
1104299112 12:127547906-127547928 AAATGTGAAGGAAAGGCAGACGG - Intergenic
1104486021 12:129151710-129151732 CAGCTAAAAGGAAGAGCAGAGGG + Intronic
1104612430 12:130240700-130240722 CCGGGTGAAGGGAGGGAAGAGGG + Intergenic
1105038940 12:132946843-132946865 GCGCGTGAGGGAAGGGCTGAAGG - Intronic
1106325001 13:28680504-28680526 CATCGTCTAGGAAGGGGAGAGGG - Intergenic
1106332870 13:28755213-28755235 CAGCGCAAAGGAAGGGGAGGAGG - Intergenic
1106457454 13:29939555-29939577 CAGCGAGGTGTAAGGGCAGAAGG + Intergenic
1106465974 13:30015002-30015024 CAGTATGAAGGAAGGGGAGCTGG + Intergenic
1106697778 13:32195839-32195861 TATTCTGAAGGAAGGGCAGAGGG + Intronic
1107420328 13:40240107-40240129 CAGTGTGGAGGGAGGGCAGGGGG - Intergenic
1107873047 13:44764547-44764569 CAGCGTGAAGGAATGATAAATGG + Intergenic
1111412635 13:87896264-87896286 CAGCTTCCAGGAAAGGCAGAGGG - Intergenic
1113150754 13:107261262-107261284 CAGTGTGGAGTAAGAGCAGAGGG - Intronic
1113339918 13:109412432-109412454 CAGTGTGAGGGAGGGGAAGAGGG - Intergenic
1113990412 14:16023839-16023861 CAGAGGGAAGGATGGACAGAGGG - Intergenic
1114528712 14:23381952-23381974 CAGCTGGCAGGAAGGACAGATGG + Intergenic
1115915416 14:38307130-38307152 CAGGGTGAAGGGAGGGAGGAGGG + Intergenic
1116378877 14:44239748-44239770 CAGGAGGAAGGAAGGGAAGAAGG - Intergenic
1116582729 14:46662669-46662691 CAGAGAGAAGGCAGGGAAGAAGG + Intergenic
1117343670 14:54812624-54812646 CAGGATGAAGGAAGGGAAGGAGG - Intergenic
1117706620 14:58476416-58476438 TACCGTGAAGAAAGGGCAGCTGG + Intronic
1117767484 14:59098031-59098053 AAGCAGGAAGGATGGGCAGAAGG - Intergenic
1117918317 14:60701727-60701749 AAGAGTGAAGGAAGGAAAGAGGG - Intergenic
1119216983 14:72876596-72876618 CTGAGGGAAGGAAGGCCAGATGG - Intronic
1119572527 14:75688221-75688243 CAGCCTCCAGGAAGGGAAGAGGG + Intronic
1119675036 14:76547192-76547214 GAAGGAGAAGGAAGGGCAGAAGG + Intergenic
1119773893 14:77236940-77236962 CAGCGTGGAGGAGGGTGAGAGGG - Intronic
1119773904 14:77236986-77237008 CAGCGTGGAGGAGGGTGAGAGGG - Intronic
1120133076 14:80829943-80829965 CAATGTGAAGGAAGGAAAGAAGG + Intronic
1120205001 14:81578717-81578739 CAGGGGGAAGGAAGGGGAGAAGG + Intergenic
1120768619 14:88354926-88354948 ATGGGTGAAGGAAGGGTAGATGG - Intergenic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121732117 14:96194271-96194293 CTGCATGCAGGGAGGGCAGAAGG + Intergenic
1121812938 14:96907546-96907568 TGGCTGGAAGGAAGGGCAGATGG + Intronic
1122159837 14:99774786-99774808 CTGAAGGAAGGAAGGGCAGAAGG + Intronic
1122871730 14:104641850-104641872 CAGCGTGAATGAAGGAGTGAAGG + Intergenic
1122968856 14:105144315-105144337 CTGGGTGATGGAAGGGCAGTAGG - Intronic
1122978818 14:105181923-105181945 CAGGGGGAGGGAAGGGCAGCTGG - Intergenic
1122985453 14:105209631-105209653 CATCGAGGAGGGAGGGCAGACGG - Exonic
1123776256 15:23583661-23583683 CTGCGTGAAGGAGAGACAGAAGG + Intronic
1124604552 15:31160854-31160876 CAGCTGGGCGGAAGGGCAGAGGG - Intronic
1126859391 15:52869608-52869630 TAGCAGAAAGGAAGGGCAGAAGG + Intergenic
1127903409 15:63358231-63358253 CAGCTGGAAGGAAAGGAAGATGG + Intronic
1128579539 15:68799256-68799278 CTGCTGGAAGGAAGGGGAGAGGG + Intronic
1128745574 15:70111812-70111834 CTGCGTGGGGGAAAGGCAGATGG - Intergenic
1129109516 15:73329431-73329453 CAGTGTGAGGGAAGAGCAGGAGG - Intronic
1130669252 15:85895974-85895996 CAGAGAGAAGAAGGGGCAGAGGG - Intergenic
1130935336 15:88465546-88465568 CAGCCAGAAGGAAGGGAAAAGGG - Intronic
1130960015 15:88653031-88653053 CACCCTGTGGGAAGGGCAGAGGG + Intronic
1131417329 15:92272042-92272064 AAGAGTTAAGGAAGGACAGAGGG + Intergenic
1131424193 15:92332114-92332136 CAGCCTGAAGGGAGGGAGGAGGG - Intergenic
1131468147 15:92672412-92672434 GAGCGGGAGGGGAGGGCAGATGG - Intronic
1132626253 16:892970-892992 CAGCGTGAGGGCAGGGCACCCGG - Intronic
1132810073 16:1793166-1793188 CATCGTGACAGAAGGGCAGTCGG - Intronic
1132894754 16:2223522-2223544 CAGCGTGAGGGAACGGCAAGAGG - Intergenic
1135887271 16:26321686-26321708 CAGCCAGAAGGGAGGGAAGAAGG - Intergenic
1136429349 16:30187778-30187800 CAGGGTCAAAGAAGGGCAGCAGG - Exonic
1136909566 16:34134918-34134940 CAGAGGGAAGGATGGACAGAGGG - Intergenic
1139320416 16:66109719-66109741 AAGGGGGAAGGAAGGGAAGAGGG + Intergenic
1139476050 16:67203096-67203118 CTGCGTGGAGAAAGGGAAGAGGG - Intronic
1140903583 16:79392150-79392172 GAGAGTGAAGGAAGGAGAGAGGG + Intergenic
1141081804 16:81059642-81059664 GAGGGTGGAGGAAGGACAGAGGG + Intronic
1141157916 16:81609970-81609992 CAGTGTGGTGGCAGGGCAGAGGG + Intronic
1141713995 16:85716552-85716574 CAGAGGGAGGGAAGGGGAGAGGG + Intronic
1142398167 16:89844890-89844912 AAGAGTGAAGGAGGGGCAGGTGG - Intronic
1142856172 17:2731562-2731584 CAGTGAGGAGGAGGGGCAGAGGG - Intergenic
1143115823 17:4581485-4581507 CAGCGTGGGGAAAGGACAGAAGG - Intergenic
1143475897 17:7203817-7203839 CTGGGTGAAGGAGGGGAAGAGGG + Intronic
1143665993 17:8360975-8360997 CACTGAGAAGGAAGGGCAGTGGG - Intergenic
1143977094 17:10837901-10837923 GAGATGGAAGGAAGGGCAGAAGG + Intronic
1144232346 17:13220700-13220722 CAGGGTGAAGGCAAGGTAGATGG + Intergenic
1145065651 17:19759740-19759762 CAGGGGGCAGGGAGGGCAGAGGG - Intergenic
1145736964 17:27239910-27239932 AAGTCTGAAGGAAGGGCAGGGGG - Intergenic
1146262016 17:31428047-31428069 TGGGGTGAGGGAAGGGCAGAGGG - Intronic
1146843943 17:36172051-36172073 CTTCGGGAAGGAAGGACAGAAGG + Intronic
1146856249 17:36259986-36260008 CTTCGGGAAGGAAGGACAGAAGG + Intronic
1146864370 17:36328389-36328411 CTTCGGGAAGGAAGGACAGAAGG - Intronic
1146872156 17:36383897-36383919 CTTCGGGAAGGAAGGACAGAAGG + Intronic
1146879518 17:36434982-36435004 CTTCGGGAAGGAAGGACAGAAGG + Intronic
1147067229 17:37928977-37928999 CTTCGGGAAGGAAGGACAGAAGG - Intronic
1147075042 17:37984521-37984543 CTTCGGGAAGGAAGGACAGAAGG + Intronic
1147078761 17:38008538-38008560 CTTCGGGAAGGAAGGACAGAAGG - Intronic
1147086567 17:38064067-38064089 CTTCGGGAAGGAAGGACAGAAGG + Intronic
1147094699 17:38132473-38132495 CTTCGGGAAGGAAGGACAGAAGG - Intergenic
1147102510 17:38188030-38188052 CTTCGGGAAGGAAGGACAGAAGG + Intergenic
1147165447 17:38590866-38590888 TAGGGTGTAGGAAGGACAGAGGG - Intronic
1147250451 17:39150209-39150231 CAGTGGGAAGTATGGGCAGAGGG - Intronic
1147362886 17:39942782-39942804 TGGCGTGAAAGAATGGCAGAAGG + Intronic
1147583393 17:41639045-41639067 AAGAGGGAGGGAAGGGCAGAGGG - Intergenic
1148454926 17:47806086-47806108 CAGCGGGGAGGAAAGGCAGCTGG + Intergenic
1148496791 17:48057749-48057771 CTGCCTGAAGGAAAGGAAGAAGG - Intronic
1149462230 17:56839234-56839256 CAGCGTGAAGGGTGGGCTTAGGG + Intronic
1149847083 17:60014496-60014518 CTTCGGGAAGGAAGGACAGAAGG + Intergenic
1150085442 17:62271113-62271135 CTTCGGGAAGGAAGGACAGAAGG + Intergenic
1150213042 17:63452059-63452081 CAGCATGAAGAAGAGGCAGAAGG + Intergenic
1150440179 17:65184837-65184859 CAGTGAGAAGGAAGGAAAGAAGG - Intronic
1151745526 17:76009781-76009803 CATCGTGAAGGAGGTGAAGAAGG - Exonic
1151778951 17:76229237-76229259 AAGTGTGAAGGAAGAGGAGAGGG - Intronic
1151886469 17:76925859-76925881 CAGGGAGTAGGGAGGGCAGAGGG + Intronic
1151951872 17:77359042-77359064 CAGCCAGAGGGAAGGGAAGAAGG + Intronic
1152331241 17:79674549-79674571 CAGCTTGCAAGAAGGGCAGTGGG - Intergenic
1152495234 17:80666481-80666503 CAGAGTGTAGGAAGGGCGCAAGG + Intronic
1152908740 17:82984889-82984911 CAGCTTGAAGGAAGTGGACAGGG - Intronic
1155183393 18:23367440-23367462 CAGCATGAAGGTACTGCAGAGGG + Intronic
1156203996 18:34866027-34866049 CAGTGTGAAGGAACGCAAGATGG - Intronic
1156604631 18:38651812-38651834 CAGTGTATAGGAAGGGCTGAAGG + Intergenic
1156772203 18:40742152-40742174 GAGAGGGGAGGAAGGGCAGAGGG + Intergenic
1157218185 18:45802681-45802703 CAGAGTGAGGGTGGGGCAGAAGG - Intergenic
1157814266 18:50719668-50719690 CAGCCTGTTGGAAGGGCAGCTGG - Intronic
1158131078 18:54153287-54153309 CAGAGTGAGGGAATGGAAGAGGG + Exonic
1158791744 18:60788309-60788331 CAGCATGGTGGAAGAGCAGAAGG + Intergenic
1158963762 18:62606596-62606618 AAGCGGGAAGGAGGGGAAGAGGG - Intergenic
1160124250 18:76155817-76155839 CAGGGTGTTGGAAGGGTAGATGG - Intergenic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1161766111 19:6209868-6209890 AGGAGGGAAGGAAGGGCAGATGG - Intergenic
1162401213 19:10447756-10447778 AAACCTGGAGGAAGGGCAGAGGG - Intronic
1163159535 19:15456641-15456663 CAGCGCCTAGGAAGGGCAGGAGG + Exonic
1163383591 19:16985475-16985497 AAGGGTGGATGAAGGGCAGACGG + Intronic
1163427259 19:17246219-17246241 GAGGCTCAAGGAAGGGCAGAGGG - Intronic
1164623820 19:29714018-29714040 AAGCAGGAAGGAAGGGGAGAGGG - Intronic
1164815966 19:31203750-31203772 AAGAAGGAAGGAAGGGCAGAAGG - Intergenic
1165154241 19:33777654-33777676 CAGGGTGAAGGAGAGGCAGGAGG - Intergenic
1165272302 19:34721348-34721370 CAGAGAGAAGGAAGGGGACAAGG + Intergenic
1165412059 19:35668140-35668162 CACTGTCAAGGGAGGGCAGATGG + Intronic
1166072434 19:40395011-40395033 CAGGAGGAAGGGAGGGCAGAGGG - Exonic
1166317686 19:41998184-41998206 CAGCCTGTAGGCAGGGCTGAGGG + Intergenic
1166453278 19:42919136-42919158 CAGCGTGCAGGCAGGTCACAGGG + Intronic
1167697355 19:51023103-51023125 CAGCGTGCAGGAAGGGGGCAAGG - Exonic
1168087147 19:54056583-54056605 CAGGGTCAATGAGGGGCAGAGGG - Intronic
925611795 2:5707264-5707286 CGGCGGGAAGGAAAGGCAGTCGG - Intergenic
925834411 2:7930166-7930188 TAGAGGGAAGGAAGGGCTGAGGG + Intergenic
926728173 2:16014625-16014647 CAGCCTGCAGAAAGTGCAGATGG - Intergenic
927651097 2:24914184-24914206 CAGCCGGAAGGGAGGACAGATGG - Intronic
927906378 2:26861405-26861427 CTGCCTGAAGGAAGGGATGAAGG - Intronic
928221910 2:29410366-29410388 CAACTTGAAGCAAAGGCAGAAGG - Intronic
928324263 2:30307310-30307332 CAGCATGGAGTCAGGGCAGAAGG - Intronic
928424525 2:31167024-31167046 CAGCAAGAAGCAAGGGGAGAGGG + Intergenic
929431678 2:41892870-41892892 CAGAGAGAAGGAAGGGAAGGAGG + Intergenic
929906045 2:46047460-46047482 CAGCCTGCTGGGAGGGCAGAGGG - Intronic
930303840 2:49652661-49652683 CAGTCTGAAGGAAGAGTAGAGGG - Intergenic
930486763 2:52019971-52019993 CAGCATGAAGGTAGAGAAGATGG + Intergenic
932449489 2:71800491-71800513 CAGTGGGAAGGCTGGGCAGATGG - Intergenic
932492453 2:72131017-72131039 GAGAGTTAAGGAAGGGAAGACGG + Exonic
932886712 2:75555340-75555362 CAGAGGGAAAGAAGGGGAGATGG - Intronic
933266616 2:80187700-80187722 CAGAGAGAAAGAGGGGCAGATGG + Intronic
933417391 2:82003708-82003730 CAGTGTTAAGTAAAGGCAGATGG + Intergenic
933591725 2:84240364-84240386 CAAAGAGAAGGAAGGACAGAAGG + Intergenic
935368732 2:102322289-102322311 AAGCATGAAGGATGGCCAGAAGG - Intronic
936276681 2:111103972-111103994 GAGGGTAAAGGAAGGGAAGAGGG - Intronic
936521961 2:113217190-113217212 CAACGTGAATTAAAGGCAGAGGG + Exonic
937305395 2:120867575-120867597 CAGCGTGCGGGGAGGGCGGAGGG - Intronic
937583942 2:123523646-123523668 CAGCATGCAGGAAGGGCCAATGG - Intergenic
937657649 2:124394775-124394797 AAGGGTGAAGGAAAAGCAGATGG - Intronic
939754247 2:146090056-146090078 CAGGGTGAAGGAAGGGAGAAGGG - Intergenic
941005072 2:160239597-160239619 AAGCCTGGAGGAAGGGCTGAGGG + Intronic
941110509 2:161415324-161415346 CAGAGAGAAGGAAATGCAGAGGG + Intergenic
942076363 2:172360190-172360212 CAGGGTGTATGAAGGGCAGGGGG - Intergenic
942528262 2:176879669-176879691 CAGCCTGAAGCGAGGGGAGAAGG - Intergenic
942893184 2:181017172-181017194 AAGCCTGAAGGAAGGACATAGGG + Intronic
943482016 2:188430637-188430659 CTGAGTGACAGAAGGGCAGAAGG - Intronic
945906295 2:215597307-215597329 GGGTGTGGAGGAAGGGCAGAGGG - Intergenic
946015709 2:216602513-216602535 CAACCTGACAGAAGGGCAGAGGG + Intergenic
946193868 2:218021955-218021977 CAGAGCGGGGGAAGGGCAGAGGG + Intergenic
946194886 2:218027018-218027040 CAGGGAGGAGGAAGGGCAGCCGG + Intergenic
946394471 2:219436195-219436217 CAGTGTGAAGAAAAGGCTGAGGG + Intronic
946704346 2:222443577-222443599 CAGCGAGAAGAAATGGCAGAGGG - Intronic
946708596 2:222484254-222484276 CAGCAGGAAGGAAGGAGAGAGGG - Intronic
947029915 2:225782522-225782544 CAGAAGGAAGGAAGGACAGAGGG - Intergenic
947634707 2:231674126-231674148 AAGGGAGAAGGAGGGGCAGATGG - Intergenic
947736547 2:232458198-232458220 CCGCCTGCAGGAAGGCCAGAGGG - Exonic
948257001 2:236575983-236576005 CAGGGGGAAGGAAGGGGAGGGGG - Intronic
1168956244 20:1836460-1836482 CAGAGTGAAGGAGGTGGAGAGGG - Intergenic
1170734833 20:19005716-19005738 CTGCCTGAAGGAAAGGCAGCTGG - Intergenic
1170765329 20:19285039-19285061 AAGGGAGAAGGCAGGGCAGAGGG - Intronic
1170768742 20:19313916-19313938 CATCTTAAAGGATGGGCAGAGGG + Intronic
1171245162 20:23604827-23604849 GAGCCTGAAAGAAAGGCAGAGGG - Intronic
1171484829 20:25479095-25479117 CAGCGTGCTGGAGGGTCAGAAGG - Exonic
1171771471 20:29325835-29325857 CAGAGGGAAGGATGGACAGAGGG + Intergenic
1171905037 20:30893643-30893665 CAGAGGGAAGGATGGACAGAGGG - Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172728538 20:37066892-37066914 GACAGTGTAGGAAGGGCAGAGGG + Intronic
1172829910 20:37824875-37824897 TGGGGAGAAGGAAGGGCAGAAGG + Intronic
1172836952 20:37879214-37879236 CAGAGTGGAGGCAGGGCTGAGGG - Intergenic
1173220041 20:41125151-41125173 CAGGGAGCAGGAAGGCCAGAAGG + Intergenic
1173305199 20:41841241-41841263 CAGAGGGAGGGAAGGACAGAGGG - Intergenic
1173546555 20:43902497-43902519 AAGAGTGAAGGGAAGGCAGAAGG - Intergenic
1173580146 20:44141384-44141406 CAGAGGGAGGGAAAGGCAGATGG + Intronic
1173607400 20:44341323-44341345 CTGAGTGAAGGAAGGGCAGAGGG - Intronic
1173687074 20:44931183-44931205 CCCCGTGAAGGAAGGGAGGAAGG - Intronic
1173705158 20:45104799-45104821 CAGGGTAAAGAAAGGGCAGGAGG - Intergenic
1173767756 20:45629722-45629744 GAGAGTGAAGGAAGGAAAGAAGG - Exonic
1173929143 20:46804042-46804064 AGGCAGGAAGGAAGGGCAGAAGG + Intergenic
1175020206 20:55838942-55838964 GAGTATGGAGGAAGGGCAGATGG - Intergenic
1175322186 20:58096984-58097006 CAGGATGAATGAGGGGCAGAAGG - Intergenic
1175365533 20:58452543-58452565 CAGAGTGAAGTAAGGTCAAAGGG + Intergenic
1175598639 20:60255270-60255292 CAGTGAGAGGGATGGGCAGAGGG + Intergenic
1178050672 21:28743559-28743581 GAGAGTGAAGGAAGGAGAGAAGG + Intergenic
1178063525 21:28877428-28877450 GAGAGAGAAGGAAGGACAGATGG + Intronic
1178810000 21:35872810-35872832 CATGGCAAAGGAAGGGCAGAAGG + Intronic
1179628630 21:42663429-42663451 CAGCTCGGAGGGAGGGCAGAAGG + Intronic
1180092135 21:45538610-45538632 CACAGTGAGGGAAGGGCAGAGGG + Intronic
1180316859 22:11283687-11283709 CAGAGGGAAGGATGGACAGAGGG + Intergenic
1180338470 22:11599828-11599850 CAGAGGGAAGGATGGACAGAGGG - Intergenic
1180711304 22:17841493-17841515 CAGAGGGAAGGACGGGCACACGG - Intronic
1180716456 22:17875855-17875877 CAGCCTGCAGGAAGGGCAGGGGG + Intronic
1181169107 22:20998343-20998365 CAGGGGCAAGGCAGGGCAGAAGG - Exonic
1181406009 22:22685647-22685669 GAGCTGGAAGGAAAGGCAGAGGG - Intergenic
1181413985 22:22746350-22746372 GAGCTGGAAGGAAAGGCAGAGGG - Intronic
1181419630 22:22788873-22788895 GAGCTGGAAGGAAAGGCAGAGGG - Intronic
1181519280 22:23436148-23436170 CAGCGTGCAGGGAGAGCAGAGGG + Intergenic
1181820894 22:25474815-25474837 CAGCGACTAGGAAGGGTAGATGG + Intergenic
1182242357 22:28926126-28926148 CAAGATGAAGGAAGGGCAGTAGG - Intronic
1182755219 22:32673680-32673702 TAGGATGAAGGAGGGGCAGAGGG + Intronic
1183043151 22:35198381-35198403 CAGGGTGAAGAAGGGGGAGAGGG - Intergenic
1183062688 22:35345705-35345727 GATCTGGAAGGAAGGGCAGAGGG - Exonic
1183640353 22:39088946-39088968 GAGGGAGAAGGCAGGGCAGAGGG - Intergenic
1183951431 22:41355129-41355151 AAGAGTGGAGGAAGGGCAGCGGG + Intronic
1184431303 22:44442744-44442766 CAGTTTGAAGCAAGGGCTGATGG - Intergenic
1184590702 22:45480977-45480999 AATCGTGGAGGAAGGGCAAAGGG - Intergenic
1184609503 22:45593793-45593815 GAGAGTGAAGGAAGGAGAGAAGG - Intronic
1185149813 22:49157803-49157825 CAGGATGCAGGAAGGGCAGAAGG + Intergenic
949457096 3:4250274-4250296 AAGGGGGAAGGAAGGGAAGAGGG + Intronic
949525494 3:4899285-4899307 CAGAGTAAAGAAAGTGCAGAAGG + Intergenic
950406740 3:12809710-12809732 CAGCGAGGAGGATGGACAGAAGG + Intronic
950975892 3:17244465-17244487 TAGGAGGAAGGAAGGGCAGAAGG - Intronic
951558581 3:23945113-23945135 CAAGGAGAAGGAAGGGGAGAAGG + Intronic
953644499 3:44741670-44741692 CAGGGAGAAGCAAGGGCAAAGGG + Intronic
953878035 3:46677377-46677399 CAGCTGTAAGGGAGGGCAGAGGG - Intronic
954132024 3:48565703-48565725 CAGAGAGAAGGATGGGAAGATGG + Intronic
954393189 3:50278231-50278253 CACTGGGAAGGAAGGGCACAGGG + Intergenic
954952547 3:54488275-54488297 CAGAGGGAAGCAAGGGTAGAAGG + Intronic
956587743 3:70882415-70882437 CAGTCTGAAACAAGGGCAGAAGG - Intergenic
957955532 3:87181806-87181828 CAGTGTTAAGCAAGAGCAGATGG - Intergenic
958005176 3:87801567-87801589 CATCTTGAAGCAAGGGCAGGAGG + Intergenic
959591432 3:108086275-108086297 CAGTGTAAAGGAAGGACTGAGGG + Intronic
960965752 3:123103614-123103636 GAGGGAGAAGGAAGGGCAGAGGG - Intronic
961046669 3:123713195-123713217 CAGCAAGAAAGAAGGGAAGATGG + Intronic
961669802 3:128520742-128520764 CAGCCAGTAGGAAGGGGAGAAGG - Intergenic
961848786 3:129794202-129794224 CAGCGCTAAGGAGGGGCTGAGGG - Intronic
962878013 3:139550700-139550722 CAGTTGGAAGGAAGGACAGAAGG - Intergenic
964379838 3:156087359-156087381 CAGTGTGAAGGAAAAGTAGAGGG - Intronic
965490295 3:169326851-169326873 TATCATCAAGGAAGGGCAGAGGG + Intronic
966155257 3:176909547-176909569 CATAGTGTGGGAAGGGCAGAGGG - Intergenic
966746150 3:183279516-183279538 CAGGGTGAAGGAAGGGAAAAAGG - Intronic
969456696 4:7304346-7304368 AAGAGGGAGGGAAGGGCAGAAGG - Intronic
970369620 4:15393961-15393983 AAGGGGGAAGTAAGGGCAGAGGG + Intronic
970922911 4:21415869-21415891 CAGAGTGAATGAAGAGGAGATGG + Intronic
971759459 4:30746401-30746423 CAGCGTGAAGGGAGAGCAGGGGG + Intronic
972228917 4:37047771-37047793 TAAGATGAAGGAAGGGCAGAAGG - Intergenic
972296233 4:37741742-37741764 CTGAGTGAAGGAAAGGCTGAAGG + Intergenic
972439244 4:39069343-39069365 CAGAGTGCAGGAAGTGAAGATGG + Intronic
972726250 4:41748425-41748447 CGGCGTGAGGGAAGGGCAGCCGG + Exonic
972938483 4:44168065-44168087 CAGGGTGGCGGCAGGGCAGAGGG - Intergenic
973573189 4:52261139-52261161 CAGAGTGCAGGGAGGCCAGACGG - Intergenic
973646572 4:52956428-52956450 CAGGCTGAGGGAAGGGCAGGTGG + Intronic
975397907 4:73898901-73898923 CAGCAGGAAGGAAAGGAAGATGG + Intergenic
979419990 4:120492060-120492082 CAGAGAGAAGGAAGGACAGGAGG - Intergenic
983843322 4:172483346-172483368 CATTGTGAAGGGAGTGCAGAGGG + Intronic
984507380 4:180636770-180636792 CAGTGTGGAGGAAGGGGAAAGGG - Intergenic
984949183 4:184994124-184994146 AGTCGTGAAGGAAGGGCAGTGGG + Intergenic
985709410 5:1419915-1419937 AAGTGGGAAGGAAGGGGAGAAGG - Intronic
986044318 5:4022788-4022810 CAGGGAGAAGGAAGCTCAGAAGG - Intergenic
986789667 5:11147461-11147483 CATGGTGAATGAAGAGCAGAGGG + Intronic
988059409 5:26148418-26148440 CAGAGAGAAGGAAGGGCATGTGG + Intergenic
990539216 5:56755675-56755697 GAGGGTGAAGGATGGGAAGAGGG + Intergenic
991096318 5:62743721-62743743 GAGAGAGAAGGAATGGCAGATGG - Intergenic
991453088 5:66773408-66773430 AAGCCTGAAGGGAGAGCAGAGGG + Intronic
995308729 5:110687101-110687123 CAGGGGGAAGAAAGGTCAGAAGG - Intronic
995565599 5:113430787-113430809 CAGCGTGAAGAGACTGCAGATGG + Intronic
995673338 5:114633129-114633151 CAGCATGAGGGAAGGACAAAGGG - Intergenic
996538912 5:124608555-124608577 CAGAGTGAAGAGAAGGCAGATGG + Intergenic
996589483 5:125129905-125129927 CTGCCTGAAGGTAGGGCACAGGG - Intergenic
996595049 5:125191067-125191089 CGGAGTGATGGAAGGGCTGAAGG + Intergenic
997693760 5:135845477-135845499 CAGCCAGAAGGAAGGAAAGAAGG - Intronic
997705864 5:135951938-135951960 CAGCGGGAAGCAAGAGCTGAGGG - Intronic
998238324 5:140419901-140419923 GAGGGGGAAGGAAGGACAGACGG - Intronic
1000209932 5:159099418-159099440 CAGCATGAAGGAAGAGCCGCTGG - Exonic
1001776694 5:174334208-174334230 GAGCATGCAGAAAGGGCAGAAGG - Intergenic
1002440624 5:179262563-179262585 CAGCGTGACCAAGGGGCAGAAGG - Intronic
1004073629 6:12325367-12325389 CAGCCTGAAGGAAACGCACAAGG + Intergenic
1005898335 6:30196750-30196772 CAGGGGGCAGGAAGGGGAGAAGG + Intronic
1006143318 6:31943919-31943941 CATCGTGCAGGGAAGGCAGATGG - Exonic
1006431511 6:34000176-34000198 CAGAGGGAAGGAAGGGGAGGGGG + Intergenic
1006727620 6:36211231-36211253 CAGGGAGAAGGGAGGACAGAAGG - Intronic
1006831458 6:36970614-36970636 CAGTGGGAAGGAAGGACAGCTGG + Intronic
1008556685 6:52679330-52679352 CAGAGTGAAAGAGGGCCAGATGG + Intronic
1011643217 6:89433693-89433715 CAGTTTGAAGGAAGGGCGGTGGG + Intronic
1012286444 6:97395448-97395470 CATTGTCAAGGAAGGGCAGATGG - Intergenic
1012338751 6:98092055-98092077 CAGCGTGAGTGAAAGACAGAGGG + Intergenic
1013635667 6:112027117-112027139 CAGAGTTCAGGTAGGGCAGAGGG - Intergenic
1013941452 6:115667913-115667935 CAGCGTGGATGAAGAGCAGTTGG - Intergenic
1014283390 6:119466512-119466534 AAGCGTAAAGGATGTGCAGATGG + Intergenic
1014732137 6:125045188-125045210 CTGCATGATGGAAGAGCAGATGG - Intronic
1016286080 6:142474563-142474585 CAGCTAGAGGGAAGGGGAGACGG - Intergenic
1016314522 6:142771414-142771436 GAGCGTGAAGCAAGAGCAGCTGG - Exonic
1017239174 6:152147997-152148019 CAGCTTAAAGGAAAGTCAGAGGG - Intronic
1017603845 6:156112090-156112112 CAGCCTGGCGGAAGAGCAGATGG - Intergenic
1017820125 6:158043198-158043220 CAGCCAGAATGAAGGGCGGACGG - Intronic
1018095860 6:160386578-160386600 CAGAGTGAGGGAAGGGGAGTGGG + Intronic
1018114859 6:160573560-160573582 CAGAGGGAAGGTAGGGCTGAAGG + Intronic
1018888726 6:167965429-167965451 GAGCGTGGAGGAAGGAAAGAAGG + Intronic
1019385473 7:753338-753360 CAGAGTGAAAGAAGCGGAGAAGG + Intronic
1019483495 7:1277054-1277076 GAGGGAGAAGGAAGGGAAGAGGG - Intergenic
1019592000 7:1840183-1840205 CAGCGTGCAGGGAGAGCAGAGGG - Intronic
1019666961 7:2256802-2256824 GGGCTTGAAGGAAGGGCGGAGGG + Intronic
1021598357 7:22340630-22340652 CAGTGTGGAGGAAGGGCTGTGGG - Intronic
1021971184 7:25967363-25967385 GAGAGGGAAGGAAGGGAAGAAGG + Intergenic
1024097602 7:45996396-45996418 CAGCAAGCATGAAGGGCAGAAGG + Intergenic
1024555600 7:50600581-50600603 CAGAGGGAAGGAAGGAGAGAGGG + Intronic
1026127011 7:67587898-67587920 CAGCAGGAAGGAAGGAAAGAGGG - Intergenic
1028520849 7:91729045-91729067 CAGAGGGAAGGAAGGGAGGAAGG + Intronic
1029974699 7:104822040-104822062 AAGCGGAAAGGAGGGGCAGAGGG + Intronic
1030006336 7:105124273-105124295 CAGCGGGAAGGAAGGAAAGAGGG - Intronic
1030913719 7:115285543-115285565 CAGAGTGAAGGAAGGGAAGATGG + Intergenic
1031049959 7:116934994-116935016 CAGGGAGGAAGAAGGGCAGAGGG - Intergenic
1031133549 7:117861241-117861263 CAGCGTGATGGAAGGGGAGCTGG - Exonic
1031327649 7:120421978-120422000 CAGGATGGAGGAAGGGCAGAAGG + Intronic
1032015664 7:128379037-128379059 CAGAGCGAAGGGAAGGCAGAGGG + Intergenic
1032419516 7:131766498-131766520 CAGCGTGAACCCAGGACAGAGGG + Intergenic
1032434286 7:131887548-131887570 CAGGGTGAGGGAAAGCCAGATGG - Intergenic
1032468964 7:132164442-132164464 CAGCCTGAAGGATGAGGAGATGG - Intronic
1032892037 7:136207352-136207374 GAACATGAAGGAAGAGCAGAGGG - Intergenic
1033242308 7:139690282-139690304 CAGAGTCAGGGGAGGGCAGAGGG + Intronic
1034547892 7:151800935-151800957 CAGGGTCAGGGAGGGGCAGATGG + Intronic
1034756338 7:153624260-153624282 CAGGGAGATGGAAGTGCAGAAGG - Intergenic
1034970859 7:155418294-155418316 CAGCCTGAAGGAGGGACAGCTGG + Intergenic
1035412746 7:158658197-158658219 CAGGGAGAGGGAAGGGCAGAAGG + Intronic
1036154166 8:6326242-6326264 CAGGAGGAAGGAAGGGAAGAAGG + Intergenic
1036200767 8:6769822-6769844 CAGAGTCTAGGAAGGGTAGATGG - Intergenic
1037788841 8:21919475-21919497 GAGCGCGAAGGAGGGGCAGCTGG - Intergenic
1037837254 8:22221523-22221545 CAGCGTGGAGGATGGGGAGCTGG - Exonic
1037964533 8:23123794-23123816 GTGCGTGAAGGAAGGACAGACGG + Intergenic
1038163304 8:25061173-25061195 CAGCTTGCAGCAAGTGCAGAAGG - Intergenic
1040670611 8:49685610-49685632 CAGCTCCAAGGAAGGGCAGTTGG + Intergenic
1041066334 8:54085900-54085922 CAGGGTGGAGGCCGGGCAGAGGG - Intronic
1042566425 8:70116775-70116797 CAGCATGAAGAAAGTGCAGGTGG + Intronic
1042581626 8:70285563-70285585 TAGAGTGCAGGAAGGGCAGTGGG - Intronic
1042929366 8:73998020-73998042 CATCCTGCAGGAAGGGGAGAAGG - Intronic
1044665516 8:94630579-94630601 CACAGAGAAGGAAGGGCAGTAGG - Intergenic
1044839022 8:96322386-96322408 CCCCATGATGGAAGGGCAGAAGG + Intronic
1045056065 8:98369462-98369484 GAGTGTGAAGGCTGGGCAGAAGG + Intergenic
1045955222 8:107898140-107898162 GAGCCTGAGGGAAGGGCAGCGGG - Intergenic
1047208724 8:122823406-122823428 CAGCGTGAATCCAGGGCAGCTGG + Intronic
1047255294 8:123209288-123209310 CAGAGGGATGGATGGGCAGAGGG - Exonic
1047722832 8:127657676-127657698 CAGAGGGAAGGCAGGGAAGAAGG + Intergenic
1047732983 8:127741635-127741657 CAGTTAGAAGGAATGGCAGAAGG + Intergenic
1047846697 8:128813960-128813982 GAGTGTGAAGGGAGGACAGAGGG - Intergenic
1048157135 8:131967412-131967434 CAGCCTGAAAACAGGGCAGAGGG + Intronic
1048303054 8:133265533-133265555 CAACAAGAAGGAAGGGCAGGAGG - Intronic
1048334292 8:133491481-133491503 CAGCATAAAGGAAGGGCTGGAGG + Intronic
1048738398 8:137527346-137527368 CAGCCACAAGGAAAGGCAGAGGG + Intergenic
1049053477 8:140217145-140217167 CAGAGTGAGGGAGGGTCAGAAGG + Intronic
1051924536 9:22307808-22307830 CAGCATGAAACAATGGCAGAGGG + Intergenic
1053350411 9:37410321-37410343 CAGAGTGAGGGAGGGGGAGAAGG + Intergenic
1055796081 9:79976151-79976173 TGGCGTGGAGGAAGGGCAGAGGG + Intergenic
1056088824 9:83184560-83184582 CAGAGTGAAGGATGGTGAGAAGG - Intergenic
1056683536 9:88740980-88741002 CAGTGTGAGTGAAGGGCAGTGGG + Intergenic
1057546695 9:96024315-96024337 CAGAGTGAATGAAGGGAAGTAGG + Intergenic
1059160413 9:112029324-112029346 AAGAGTGGTGGAAGGGCAGAGGG + Intergenic
1059628754 9:116096573-116096595 TAGAGTGAAGGAAGTGTAGAAGG - Intergenic
1060468688 9:123930003-123930025 CAGCCTGAGGGAAGGGAGGAAGG - Exonic
1060806955 9:126583738-126583760 CAGCTGGGAAGAAGGGCAGACGG + Intergenic
1061597198 9:131639118-131639140 CAGCTAGAAGGAGGGGAAGATGG - Intronic
1061911770 9:133728809-133728831 GATGCTGAAGGAAGGGCAGAGGG + Intronic
1203365162 Un_KI270442v1:249625-249647 CAGAGGGAAGGATGGACAGAGGG + Intergenic
1185492537 X:528790-528812 CAGAGGGAAGGAAGGAAAGAAGG - Intergenic
1186638595 X:11431494-11431516 CAGAGTGTAGGAAGAGCTGAGGG + Intronic
1187251329 X:17600801-17600823 GAGCGAGAAGGAAGGAGAGAAGG + Intronic
1187476156 X:19612912-19612934 GAGCGTAAAGGAAGAGAAGAGGG + Intronic
1190699779 X:52979161-52979183 CACCGTAAGGGTAGGGCAGAGGG + Intronic
1191943334 X:66503140-66503162 TAGAGTGAAAGAAGGGCAGGAGG - Intergenic
1192168087 X:68838475-68838497 GAGGATGGAGGAAGGGCAGAAGG + Intronic
1192204223 X:69085645-69085667 CAGCAGGGAGGAAGGCCAGAGGG + Intergenic
1194639945 X:96391758-96391780 AAGCCTGAAGGAAGGGCAGAAGG + Intergenic
1194828986 X:98597186-98597208 CAGCTGGAAAAAAGGGCAGAGGG + Intergenic
1195282447 X:103349002-103349024 CAGGGTGAAGGAAGAGTGGAGGG - Intergenic
1195679492 X:107533568-107533590 CAGTCAGGAGGAAGGGCAGATGG - Intronic
1197722033 X:129751784-129751806 CAGCGTGTAGGAATAGAAGAAGG - Exonic
1197873523 X:131082244-131082266 GAGCGAGACGGAAGCGCAGAGGG + Intronic
1198807942 X:140507884-140507906 CTGCGGGAAGGCAGGGCAGCTGG + Intergenic
1199659698 X:150036657-150036679 CAGTGTGAAGGAAGTGCCAAGGG + Intergenic
1200409194 Y:2844856-2844878 GAGGGTGGAGGAGGGGCAGAAGG + Intronic
1201073576 Y:10170801-10170823 CAGAGGGAAGGAGGGACAGAAGG - Intergenic
1201452987 Y:14136206-14136228 CAGAGGGAAGGAAGGAGAGAGGG - Intergenic