ID: 1083624139

View in Genome Browser
Species Human (GRCh38)
Location 11:64063448-64063470
Sequence GCGAATTGTGCTTTTCTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 107}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083624130_1083624139 19 Left 1083624130 11:64063406-64063428 CCAAGGAGCGATGGAGGGAGAGG 0: 1
1: 0
2: 1
3: 28
4: 370
Right 1083624139 11:64063448-64063470 GCGAATTGTGCTTTTCTTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 107
1083624129_1083624139 20 Left 1083624129 11:64063405-64063427 CCCAAGGAGCGATGGAGGGAGAG 0: 1
1: 0
2: 1
3: 27
4: 235
Right 1083624139 11:64063448-64063470 GCGAATTGTGCTTTTCTTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083624139 Original CRISPR GCGAATTGTGCTTTTCTTGA AGG Intronic
904699505 1:32350060-32350082 GGGACTTGGTCTTTTCTTGAGGG - Intergenic
905734992 1:40318596-40318618 GCAAATTGTCCTTATCTTAAAGG + Intergenic
905803104 1:40858359-40858381 GGAAATTATACTTTTCTTGAAGG + Intergenic
907992135 1:59593322-59593344 TAGAATTCTGTTTTTCTTGAAGG - Intronic
911190473 1:94943566-94943588 GCGAAGGACGCTTTTCTTGATGG - Intergenic
913353762 1:117894631-117894653 TCAAATAGTGCTTTTCTTCAAGG - Intronic
915529284 1:156494118-156494140 GTGTATTGTGCTTTTGGTGAGGG - Intronic
916322088 1:163515834-163515856 GTGAAGTGTGTTTTTCTTGTAGG - Intergenic
917365640 1:174229492-174229514 GTGACCTGTGCTTTTCTAGAGGG + Intronic
1062869200 10:884596-884618 GTGAAATGTGCATTTCTTGGTGG - Intronic
1064292316 10:14047212-14047234 TGGAATTTTGCTTTTATTGATGG + Intronic
1078356212 11:10633613-10633635 GTGATTTATGCTTTTCTTAAAGG + Intronic
1078869471 11:15330030-15330052 GCAAACAGTGCTTATCTTGAAGG - Intergenic
1081145122 11:39553847-39553869 GATAATTATGCTTTTCTCGAAGG + Intergenic
1081289426 11:41306499-41306521 GCGCAGTGTGTATTTCTTGAGGG - Intronic
1083624139 11:64063448-64063470 GCGAATTGTGCTTTTCTTGAAGG + Intronic
1086016031 11:82168532-82168554 GCCAATTAGGATTTTCTTGAGGG - Intergenic
1092551942 12:9512147-9512169 GAGAATTGTGTTTTTATAGAAGG + Intergenic
1092768330 12:11872950-11872972 GCAATATGTGCTTTTCTTGATGG + Intronic
1094520179 12:31178476-31178498 GAGAATTGTGTTTTTATAGAAGG - Intergenic
1095872139 12:47040328-47040350 GCAAATTGATTTTTTCTTGAAGG + Intergenic
1098301313 12:69056693-69056715 GAAAATTGTGATTTTATTGATGG - Intergenic
1098497406 12:71152058-71152080 GTTAATTGTGCTATTATTGATGG + Intronic
1099075382 12:78101578-78101600 ATGACTTGTGCTTTTCTTCATGG + Intronic
1100420533 12:94428815-94428837 GAGAAGTGTGCTTGACTTGATGG - Intronic
1106699910 13:32218317-32218339 GCCAATGGTGCTTTTCTTAAAGG - Intronic
1106711319 13:32336888-32336910 TTGAATTGTACCTTTCTTGAAGG - Exonic
1109498378 13:63205882-63205904 CTGAATCCTGCTTTTCTTGATGG - Intergenic
1110948286 13:81452132-81452154 TAGATTTTTGCTTTTCTTGAAGG + Intergenic
1113874614 13:113586189-113586211 GCGAATCCTGCATTTCTTGGGGG + Intronic
1115223598 14:31081451-31081473 GCAAATCGTGCTTGTTTTGAGGG - Intronic
1120727147 14:87957107-87957129 GGGATTTGTGTTTTTCTTGCTGG + Intronic
1127546951 15:60000949-60000971 GCGAATTGTGGATTTATGGAGGG + Intergenic
1131408522 15:92186396-92186418 GCTATTTTTTCTTTTCTTGAGGG - Intergenic
1131662704 15:94535574-94535596 GAGCATTGTCCTTTTCATGATGG - Intergenic
1131876426 15:96811691-96811713 GAGAAGTGTGCTCTTCTTGCTGG + Intergenic
1133512281 16:6471729-6471751 GGGTATTTTGCTTTTCTTCAAGG + Intronic
1154499400 18:14987662-14987684 GTGCACTGTGCTTTCCTTGAGGG + Intergenic
1167579950 19:50335347-50335369 GGAAATGGTGCTTTTCTTGATGG + Intronic
928050707 2:27992107-27992129 TTGATTTGTGCTTTTTTTGATGG + Intronic
928861870 2:35867964-35867986 GCAACTTGTGTTTTTCTTGATGG - Intergenic
930403425 2:50922061-50922083 GGGAATTCTGCCTTTTTTGAAGG + Intronic
932006257 2:67930129-67930151 GCGAATTCTCTGTTTCTTGAAGG - Intergenic
935286936 2:101573190-101573212 GCCACTTGTGGCTTTCTTGAGGG + Intergenic
937981698 2:127619646-127619668 GTGAATTGGGCTTTTCTTCTTGG + Intronic
938498605 2:131818030-131818052 GTGTACTGTGCTTTTCTTGAGGG + Intergenic
939534423 2:143409293-143409315 GCAAATGGTGCTATTTTTGATGG + Intronic
941387291 2:164868931-164868953 GGGAGTTGTGCTATTCTCGATGG + Intergenic
941544499 2:166831762-166831784 GGGAGTTGTGCTTTTACTGAGGG + Intergenic
941770654 2:169341922-169341944 GCCAATAGTTCTTTTGTTGAGGG - Intronic
942088444 2:172464355-172464377 GAGATTTGTGGGTTTCTTGATGG + Intronic
942266993 2:174238194-174238216 GCCAATTGGTGTTTTCTTGATGG - Intronic
942988717 2:182173800-182173822 GTGAACTGTGCTTTACATGAAGG + Intronic
1173379948 20:42531155-42531177 GCCAATGGTGGTTTTCTTCAGGG + Intronic
1180499751 22:15921226-15921248 GTGCAGTGTGCTTTCCTTGAGGG + Intergenic
1181904921 22:26186723-26186745 GCCAATTGTGCACTTCTTTATGG - Intronic
1184520371 22:44990268-44990290 GGGACTTGTGCTTTTCTTCCTGG - Intronic
949737433 3:7190037-7190059 GCAAATTGTTCTTTTCTGCAAGG + Intronic
950900307 3:16491536-16491558 GTGCATTGTGCTGTCCTTGATGG - Intronic
955637925 3:61050430-61050452 CCTAATTGTTCTTTTGTTGATGG - Intronic
955855750 3:63271355-63271377 GTGAATTTTACTTTTCTTAAAGG + Intronic
960102848 3:113763011-113763033 CCAAATTGACCTTTTCTTGATGG + Intronic
964310252 3:155384828-155384850 GGGTATTGTGCTTGGCTTGATGG - Intronic
964389914 3:156186139-156186161 ACGGATGGTCCTTTTCTTGAAGG + Intronic
964446962 3:156769123-156769145 GCTAATATTGCCTTTCTTGAAGG + Intergenic
965338850 3:167461454-167461476 GCAAATTGTTCTTTTGTTTAGGG + Intronic
965976461 3:174629714-174629736 TCTATTTGAGCTTTTCTTGAGGG + Intronic
966954071 3:184855100-184855122 GCGAATTGAGATTTTTTTCATGG + Intronic
967094712 3:186167861-186167883 GCAAAATGTTCTATTCTTGAAGG + Intronic
969851500 4:9960697-9960719 TTGAATTAGGCTTTTCTTGAAGG + Intronic
969967803 4:11014752-11014774 GCAAATTGTTCCTTTCTTAAAGG + Intergenic
970710350 4:18854886-18854908 GCAAATCTTGCTTTTCATGATGG - Intergenic
971828551 4:31660020-31660042 GCCAGCTGTGCTTTTCTTTATGG + Intergenic
974153973 4:58046580-58046602 GTGAAATCTACTTTTCTTGAAGG + Intergenic
974338904 4:60588274-60588296 GCTATTTGAGCTTTCCTTGAGGG - Intergenic
979959747 4:127003395-127003417 GAGAATTATACTTTTCTTAATGG + Intergenic
980841606 4:138268154-138268176 GCCTTTTGTGCTGTTCTTGAGGG + Intergenic
981953891 4:150446676-150446698 GTGGATTTTGCTTTCCTTGAGGG - Intronic
982672960 4:158344269-158344291 GGGCATTGTGCTTTTGTTTATGG - Intronic
984678536 4:182578880-182578902 GCTAACTGTGCTTCTCTTCAAGG + Intronic
989400686 5:41004860-41004882 GCGAAATGTGCTGATCTTGATGG - Exonic
995027700 5:107443421-107443443 TCTAATTATGCTGTTCTTGAGGG - Intronic
997037341 5:130208660-130208682 GCAATTCGTCCTTTTCTTGAGGG + Intergenic
1000678660 5:164156129-164156151 GGCATTTGTGCTTTTCCTGAAGG + Intergenic
1007142104 6:39586371-39586393 GCGAACGGTGCTTTTCTGAAAGG + Exonic
1008753509 6:54765763-54765785 AAGAATCGGGCTTTTCTTGATGG + Intergenic
1010734003 6:79422100-79422122 GAGAATTTTTCTTTTCTTCATGG + Intergenic
1013954701 6:115827547-115827569 CAAAATTGTGCTTTTCTTCAAGG - Intergenic
1014830112 6:126092888-126092910 GTGAGTTCTGCTTATCTTGATGG + Intergenic
1019779673 7:2931884-2931906 GCCAAATGTGCCCTTCTTGATGG + Intronic
1021945372 7:25720981-25721003 CCCAATTGTGTTTTTGTTGAGGG - Intergenic
1024004956 7:45218487-45218509 GAGAATTGTGCATTTATTGTGGG + Intergenic
1024295412 7:47837928-47837950 GCGAATTGAGCGTTGCTTGTTGG - Intronic
1024764468 7:52640735-52640757 GGGAATTGTCCTTTCTTTGAAGG - Intergenic
1034022875 7:147664534-147664556 GCCAAATGTGCTTATTTTGAAGG - Intronic
1035304199 7:157920286-157920308 GGGCCTTGTGCTTTTCTGGAAGG - Intronic
1036812473 8:11876967-11876989 GTGAATTTTGCTTTGGTTGAGGG + Intergenic
1039844958 8:41319515-41319537 ACAAATTGTGCTTTTCTGGGTGG - Intergenic
1041723449 8:60997108-60997130 GCAATTTTTGATTTTCTTGATGG + Intergenic
1041724946 8:61009607-61009629 GCCAATTGTGTTTTTCTTATTGG + Intergenic
1047950348 8:129928343-129928365 GTGACTTGTCCTTTTCTTAATGG - Intronic
1050186437 9:2980071-2980093 GGGAAATGTGTTTTTCTTCAGGG - Intergenic
1050722719 9:8609055-8609077 GAGAATTTTGTTTTTGTTGATGG - Intronic
1050844878 9:10203191-10203213 GTGAATTGTGAGTTTCTGGAAGG + Intronic
1050851182 9:10288255-10288277 ACAAATTTTGCTTTTCTTGGTGG - Intronic
1055248220 9:74272779-74272801 CCGAATTGTCCTTTTATTTATGG + Intergenic
1059726450 9:117013054-117013076 TCAGATTGTGCATTTCTTGAAGG + Intronic
1060787065 9:126459314-126459336 GCCAATTGTGTTTTTCTTAGGGG + Intronic
1061413339 9:130432584-130432606 GAAAAATGTGCTTTTCCTGAGGG - Intronic
1187119067 X:16385662-16385684 GTCAATTGTGCTTATTTTGAGGG - Intergenic
1188532238 X:31154652-31154674 ACATATTTTGCTTTTCTTGAAGG + Intronic
1194486610 X:94494005-94494027 TCGAATTGTGTTTTACTTAAAGG - Intergenic
1198715164 X:139550843-139550865 GCCAAATGTTCTTTTCATGAAGG + Intronic
1200019325 X:153188584-153188606 GGGAACTGTGCATTTCTTTATGG + Intergenic