ID: 1083624337

View in Genome Browser
Species Human (GRCh38)
Location 11:64064424-64064446
Sequence ATTGCCTGCCCAGTGCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 249}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083624337_1083624338 -7 Left 1083624337 11:64064424-64064446 CCTCTGGGCACTGGGCAGGCAAT 0: 1
1: 0
2: 2
3: 23
4: 249
Right 1083624338 11:64064440-64064462 AGGCAATCTCTGTTTTCTCTTGG 0: 1
1: 0
2: 2
3: 40
4: 284
1083624337_1083624346 30 Left 1083624337 11:64064424-64064446 CCTCTGGGCACTGGGCAGGCAAT 0: 1
1: 0
2: 2
3: 23
4: 249
Right 1083624346 11:64064477-64064499 GCCTCAGGCCTGCCCCGGATGGG 0: 1
1: 0
2: 2
3: 7
4: 139
1083624337_1083624339 5 Left 1083624337 11:64064424-64064446 CCTCTGGGCACTGGGCAGGCAAT 0: 1
1: 0
2: 2
3: 23
4: 249
Right 1083624339 11:64064452-64064474 TTTTCTCTTGGCCAAAGAACCGG 0: 1
1: 0
2: 1
3: 24
4: 230
1083624337_1083624340 8 Left 1083624337 11:64064424-64064446 CCTCTGGGCACTGGGCAGGCAAT 0: 1
1: 0
2: 2
3: 23
4: 249
Right 1083624340 11:64064455-64064477 TCTCTTGGCCAAAGAACCGGAGG 0: 1
1: 0
2: 0
3: 6
4: 55
1083624337_1083624345 29 Left 1083624337 11:64064424-64064446 CCTCTGGGCACTGGGCAGGCAAT 0: 1
1: 0
2: 2
3: 23
4: 249
Right 1083624345 11:64064476-64064498 GGCCTCAGGCCTGCCCCGGATGG 0: 1
1: 0
2: 1
3: 27
4: 257
1083624337_1083624344 25 Left 1083624337 11:64064424-64064446 CCTCTGGGCACTGGGCAGGCAAT 0: 1
1: 0
2: 2
3: 23
4: 249
Right 1083624344 11:64064472-64064494 CGGAGGCCTCAGGCCTGCCCCGG 0: 1
1: 0
2: 5
3: 47
4: 480
1083624337_1083624341 15 Left 1083624337 11:64064424-64064446 CCTCTGGGCACTGGGCAGGCAAT 0: 1
1: 0
2: 2
3: 23
4: 249
Right 1083624341 11:64064462-64064484 GCCAAAGAACCGGAGGCCTCAGG 0: 1
1: 0
2: 1
3: 7
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083624337 Original CRISPR ATTGCCTGCCCAGTGCCCAG AGG (reversed) Intronic
900458418 1:2788589-2788611 TTTGCCAGCCCAAAGCCCAGTGG - Intronic
900604235 1:3516710-3516732 TTTGCCTTCTCAGGGCCCAGAGG - Intronic
900956189 1:5887732-5887754 TATGCCTTCCCAGGGCCCAGTGG - Intronic
901170065 1:7250417-7250439 AATGCCTTCCCTGTTCCCAGGGG - Intronic
901750345 1:11403015-11403037 ATTGCCTGGCCAGCAACCAGGGG + Intergenic
902212034 1:14911403-14911425 CTAGCTTGCCCAGTGCCCAGGGG + Intronic
902301549 1:15505955-15505977 AATGCCTGCCCAGGGAACAGTGG + Intronic
902673440 1:17992098-17992120 CTTCCCTGCCCGGTGTCCAGGGG + Intergenic
903137615 1:21319615-21319637 CTTTCCTGCCCAGTTCACAGAGG - Intronic
903231686 1:21926215-21926237 AATGCCTGGCAAGAGCCCAGTGG + Intronic
903558434 1:24210317-24210339 GCTGCCTGCCCATTGCCCATGGG + Intergenic
904210421 1:28883555-28883577 ATTGTATGCCCAGAGCCCAGAGG - Intergenic
904474451 1:30755972-30755994 ATGGCCTGCCCAGACCCTAGAGG + Intronic
905850754 1:41272856-41272878 AGGCCCTGCCTAGTGCCCAGTGG - Intergenic
906810847 1:48825562-48825584 ATTGTATTCCCAGTGCCCAGAGG + Intronic
907892641 1:58650158-58650180 CTTCTCTGCCCAGGGCCCAGCGG - Intergenic
913566922 1:120081499-120081521 GTTTCCTGCCCAGTCCCCACAGG - Intergenic
913631207 1:120712050-120712072 GTTTCCTGCCCAGTCCCCACAGG + Intergenic
914287676 1:146242206-146242228 GTTTCCTGCCCAGTCCCCACAGG - Intergenic
914548707 1:148692949-148692971 GTTTCCTGCCCAGTCCCCACAGG - Intergenic
914617973 1:149378762-149378784 GTTTCCTGCCCAGTCCCCACAGG + Intergenic
914831205 1:151172221-151172243 ACTGCCTGCCCAGAGCCCTGGGG + Intronic
915216814 1:154345976-154345998 ACTGCCTTCCCAGTGGCCACAGG - Intronic
915313849 1:155017417-155017439 ATTCCCTGCCCAGGGCCGTGGGG - Exonic
916248562 1:162712543-162712565 ATGGCCTGTCCAGATCCCAGTGG + Intronic
918360875 1:183756485-183756507 ATTGACTGCACAGTGCCCACAGG - Intronic
920932751 1:210404339-210404361 ATTGCCTTCCCAGAGCCCCCTGG + Intronic
924141243 1:241026175-241026197 TTTGCCTTCCCAGTGTCTAGTGG + Intronic
1062848771 10:727450-727472 GCTGCCTGCCCAGCTCCCAGGGG - Intergenic
1064253592 10:13725671-13725693 ATGGCCTTCCCAGGGCCCTGTGG + Intronic
1064985531 10:21206555-21206577 ATTGCCTGCCCATTGCTTATGGG + Intergenic
1065051774 10:21799872-21799894 AGTGCCTTCACAGTGCTCAGGGG - Intronic
1066732506 10:38448706-38448728 AGTTCCTGCCCAGCTCCCAGCGG + Intergenic
1067465806 10:46497910-46497932 AATGCCAGACCAGTGTCCAGGGG - Intergenic
1067621381 10:47886696-47886718 AATGCCAGACCAGTGTCCAGGGG + Intergenic
1067684277 10:48457632-48457654 ACTGACAGCCCAGTGCCCAGGGG + Intronic
1067877214 10:50017535-50017557 CTTGCCTGGCCAGTCACCAGAGG - Intergenic
1070633942 10:78108844-78108866 AATGCATGCCAAGTGCCTAGTGG - Intergenic
1070793097 10:79201421-79201443 ATTTCCTGCCCTCAGCCCAGTGG + Intronic
1070850131 10:79556782-79556804 ACTGCCTGCCCAGTGCCATCAGG - Exonic
1071299781 10:84247800-84247822 CCTGGCTGCCCAGGGCCCAGGGG - Intronic
1074565017 10:114569697-114569719 GTTACCTTCCCAGTGACCAGAGG + Intronic
1074776868 10:116773465-116773487 ATTGCCTTCGCAGCTCCCAGCGG + Intergenic
1074948950 10:118309537-118309559 CCTCCCTGCTCAGTGCCCAGCGG - Exonic
1077295151 11:1823052-1823074 CTTGTTTGCCCAGTGCCCACAGG - Intergenic
1077323797 11:1954643-1954665 ATTGACTGCCCGCTGCCCCGAGG + Intronic
1077832739 11:5892984-5893006 ATTCCCTGCACAGGTCCCAGGGG - Intronic
1078794861 11:14582433-14582455 TTTGCTTGCCCTGTGTCCAGAGG - Intronic
1080684243 11:34502374-34502396 GTTGGCTGAGCAGTGCCCAGAGG + Intronic
1081378682 11:42389008-42389030 ATTACCTGCCCAATGCTCTGAGG + Intergenic
1081976774 11:47240247-47240269 CTTGCCTCCCCCATGCCCAGAGG - Exonic
1083624337 11:64064424-64064446 ATTGCCTGCCCAGTGCCCAGAGG - Intronic
1084174298 11:67415617-67415639 GGGGCATGCCCAGTGCCCAGCGG - Intronic
1084189062 11:67490753-67490775 CTTGCATGCCCACTGCCCACTGG + Intronic
1088524568 11:110738789-110738811 CTTGTTTGCCCAGTGGCCAGAGG + Intergenic
1088720475 11:112587851-112587873 ATTTCATACCCATTGCCCAGGGG + Intergenic
1088912112 11:114199449-114199471 GTGTCCTGCCCACTGCCCAGCGG - Intronic
1090237423 11:125159847-125159869 ATTGCCTATCGTGTGCCCAGAGG + Intergenic
1202806784 11_KI270721v1_random:9838-9860 ATTGACTGCCCGCTGCCCCGAGG + Intergenic
1091744256 12:2981224-2981246 GTCGCCTGCCCAGTGCACAGGGG + Intronic
1091826339 12:3515579-3515601 ATTGCTGGCCCCGTCCCCAGAGG - Intronic
1092045080 12:5425980-5426002 ATTGACTGCCCAGTGCTAATGGG + Intergenic
1092075659 12:5671262-5671284 AATGCCTGCCCAGTGCTTTGGGG - Intronic
1096741905 12:53699658-53699680 ATAGCCTGCACAGTGCCCAGAGG + Intergenic
1098068857 12:66650110-66650132 ATTTCCTTCCAAGTGCCCAACGG + Intronic
1099896383 12:88653007-88653029 ATTGTCTGCACTGTTCCCAGTGG - Intergenic
1101179047 12:102190587-102190609 AGTGCCAGCCCAGTGCCCAGGGG + Intronic
1101485797 12:105158004-105158026 ATTGTCTCCCCCTTGCCCAGGGG - Intronic
1103042362 12:117705996-117706018 AGTGCCTGCCCTGTGCGGAGTGG + Intronic
1103437215 12:120936317-120936339 AGTGGCTCCCCAGTGCCCTGAGG + Intergenic
1103656576 12:122475771-122475793 AGTGCCTGCCCAGACCCCACAGG + Intronic
1104270859 12:127281000-127281022 CAGCCCTGCCCAGTGCCCAGGGG - Intergenic
1106363992 13:29059972-29059994 ATTGCCTGCCTGGCTCCCAGTGG + Intronic
1110231612 13:73173195-73173217 ATTGATTGCCCAGTGCCCCGTGG + Intergenic
1112129360 13:96504321-96504343 TTTGCCTCCCTAGTGGCCAGTGG + Intronic
1113295295 13:108953029-108953051 ATGGACTTCCCAGTGGCCAGTGG - Intronic
1113749899 13:112769731-112769753 CGAGCCTGCCCAGTGCCCTGTGG + Intronic
1114337017 14:21700328-21700350 AGTACCAGCCCAGAGCCCAGTGG + Intergenic
1114532879 14:23406361-23406383 TTTGCCTGCACAGTGACTAGCGG + Intronic
1118426499 14:65669463-65669485 CTTACCTGACCAGTGTCCAGTGG - Exonic
1119599157 14:75963261-75963283 ACTGCCTGCCTACTGCCCAATGG - Intronic
1121123786 14:91393066-91393088 ATGCCCAGCCCAGTGCCCAGGGG - Intronic
1121219446 14:92274801-92274823 AGAGCCAGCCCCGTGCCCAGGGG - Intergenic
1121254274 14:92519861-92519883 AATGCCTTCCCACTGCCCTGTGG - Intronic
1121818909 14:96950029-96950051 AATGTCAGCCCAGTGCCTAGGGG - Intergenic
1122599339 14:102913568-102913590 AGTCCCTGCCCAATGCCCTGGGG - Intergenic
1122635067 14:103125971-103125993 ATTGCCTGCTTCCTGCCCAGAGG + Intronic
1123586517 15:21765271-21765293 AATGCCTGCCCAGTGCTTTGGGG + Intergenic
1123623156 15:22207836-22207858 AATGCCTGCCCAGTGCTTTGGGG + Intergenic
1124373206 15:29115129-29115151 ATTCCCTGCCCGGTCCCCAGCGG - Intronic
1124930487 15:34114900-34114922 AATTCTTGTCCAGTGCCCAGGGG - Intergenic
1127291155 15:57572662-57572684 ATTGGATTCCCAGTGTCCAGTGG + Intergenic
1129184616 15:73898257-73898279 ATGACCTGCCCTGTGGCCAGAGG - Intergenic
1130217562 15:81986681-81986703 AGTGCATGCCCAGTACCAAGTGG + Intergenic
1130397875 15:83520193-83520215 CTTGCCTGACCTTTGCCCAGAGG + Intronic
1131092542 15:89633349-89633371 AGTGCCTGCCCACTCCCAAGAGG + Intronic
1131554684 15:93386825-93386847 ATAGTCTGCCCAGAGCCCTGGGG + Intergenic
1132373890 15:101315911-101315933 GTTGCCTGCCAAGTGCACTGGGG + Intronic
1132426650 15:101723961-101723983 AGTGCCCTCCCAGTGCCCTGCGG - Intronic
1133288276 16:4701467-4701489 AGGGCCTGGCCAGAGCCCAGGGG - Exonic
1136542756 16:30937484-30937506 TTTGCCTCCTCCGTGCCCAGTGG + Intronic
1138841627 16:60515946-60515968 ATTCCATACCCACTGCCCAGGGG + Intergenic
1139555291 16:67705040-67705062 GTAGCATACCCAGTGCCCAGTGG - Intronic
1141909723 16:87050422-87050444 AGTGCCTGCCCAGTACTCGGGGG - Intergenic
1144890705 17:18492524-18492546 CTGTCCTGCCCAGTGCTCAGAGG + Exonic
1145141513 17:20451794-20451816 CTGTCCTGCCCAGTGCTCAGAGG - Exonic
1145794390 17:27647097-27647119 CTGTCCTGCCCAGTGCTCAGAGG + Exonic
1145809190 17:27754663-27754685 CTGTCCTGCCCAGTGCTCAGAGG + Intergenic
1146054824 17:29575783-29575805 TTTCCATGCCCAGTGCCCACAGG - Intronic
1146133498 17:30297941-30297963 ATTGCATGCTCAGCCCCCAGTGG - Intergenic
1146265595 17:31450670-31450692 CCTGCCTGCCCACTCCCCAGGGG + Intronic
1146981368 17:37164906-37164928 TTTGCCTGCCCAGTGCCACATGG - Intronic
1148791313 17:50174771-50174793 GGTGCCTGCTCAGTGCCCAGTGG - Intronic
1151712224 17:75813331-75813353 ATCGCAAGCCCAGGGCCCAGGGG + Intronic
1152089283 17:78237996-78238018 TTTGGCTGGGCAGTGCCCAGAGG + Intronic
1152105168 17:78324493-78324515 ATTGGCAGCCCTGTGCCCACAGG + Intergenic
1152383678 17:79956020-79956042 CTTGCCTGCACTGTGCCAAGAGG - Intronic
1152638618 17:81440298-81440320 CTGGCCGGCCCACTGCCCAGAGG - Intronic
1154304598 18:13220974-13220996 AATTCCTGCCCAGGGCCCTGAGG - Intronic
1155365089 18:25041824-25041846 ATTTCTCCCCCAGTGCCCAGTGG + Intergenic
1156006608 18:32449933-32449955 TTTGCCTGCCCAATGTCCATAGG - Intronic
1159050346 18:63415876-63415898 AGTGTCTTCCCAGTGCCTAGAGG + Intronic
1159142735 18:64417456-64417478 ACTGCCTTTCCAGTGCCAAGTGG - Intergenic
1160131691 18:76231065-76231087 ACAGGCTGCCCAGTGACCAGTGG + Intergenic
1161238980 19:3211364-3211386 ATTCCATCCCCAGTGGCCAGCGG - Intergenic
1161239000 19:3211424-3211446 ATTCCATCCCCAGTGGCCAGCGG - Intergenic
1162932648 19:13964956-13964978 AGTCCCTGCCCTGTGCCCAGCGG + Intronic
1163404627 19:17114392-17114414 ATTGCCCACCCAGAGCCCAGGGG + Intronic
1163683641 19:18697804-18697826 AATGCCTGCCCAGTGCCAACTGG - Intronic
1163872452 19:19833525-19833547 ATTGCCTGGACACTGCACAGTGG + Intergenic
1163876913 19:19878533-19878555 ATTGCCTGGACACTGCACAGCGG + Exonic
1163880354 19:19915332-19915354 ATTGCCTGGACACTGCACAGCGG + Exonic
1163895641 19:20056520-20056542 ATTGCCTGGACACTGCACAGTGG - Intergenic
1163903750 19:20132513-20132535 ATTGCCTGGACACTGCACAGCGG - Intergenic
1163912270 19:20206883-20206905 ATTGCCTGGACACTGCACAGTGG - Intergenic
1163917036 19:20249110-20249132 ATTGCCTGGACACTGCACAGTGG + Intergenic
1163932455 19:20409882-20409904 ATTGCCTGGACACTGCACAGCGG - Intergenic
1163947580 19:20553761-20553783 ATTGCCTGGACACTGCACAGCGG - Exonic
1163956406 19:20646331-20646353 ATTGCCTGGACACTGCACAGCGG - Exonic
1164181878 19:22826229-22826251 ATTTCTGGTCCAGTGCCCAGGGG + Intergenic
1164325218 19:24185301-24185323 ACTGCCTGCTCATTGCCCACAGG - Intergenic
1165096641 19:33413332-33413354 ATGGCCTGCCCACTGCAGAGGGG - Intronic
1166630540 19:44402518-44402540 ATTTCCTGCCCATTGCGTAGAGG - Intergenic
1166674568 19:44732186-44732208 CTTGACAGCCCCGTGCCCAGAGG + Intergenic
1167280300 19:48563636-48563658 AGTCCCTGCCCTGTCCCCAGAGG - Intronic
1167648104 19:50716639-50716661 AGTACCTGCCCACTGGCCAGCGG - Intronic
1167745217 19:51346830-51346852 ATTGCCAGCCCAGTGCCCCCCGG - Intronic
1168351451 19:55678465-55678487 ATGGCCTGCCCAGAGCCCTCAGG - Intronic
926109889 2:10175185-10175207 AGAGCATGGCCAGTGCCCAGAGG + Intronic
926316465 2:11714102-11714124 AATGGCTCCCCAGTGCCAAGAGG + Intronic
926991090 2:18681109-18681131 ATTGCTTCCCTAGTGCCTAGAGG + Intergenic
927152766 2:20205271-20205293 ACTGCCTGACCACTGCCCACAGG + Intronic
927481119 2:23454900-23454922 ATTCCATGCCAAGTGCCAAGGGG - Intronic
927521049 2:23698317-23698339 CTTGCATGCACACTGCCCAGGGG - Intronic
928373429 2:30757347-30757369 AATGCCAGCCCAGTTCCCTGGGG + Intronic
929865336 2:45712642-45712664 ATGGCCTGTCCAGGCCCCAGAGG - Intronic
932816430 2:74865677-74865699 ATTTCCTGCCCAGTGACTAGAGG - Intronic
934515394 2:94982897-94982919 ATTGCCAGCCCAGTCCCCTTGGG - Intergenic
935359664 2:102236754-102236776 ATTGCCTCCCCATTGCTCTGAGG + Intronic
935875363 2:107500569-107500591 ATTATTTGCCCAGTTCCCAGAGG - Intergenic
936263864 2:110984837-110984859 ATGTACTGCCCAGAGCCCAGAGG - Intronic
937350268 2:121156017-121156039 GTCACCTGCCCAGTGCCCAACGG + Intergenic
937826657 2:126374112-126374134 AGTGACTGCCCAGTGTCAAGAGG - Intergenic
938543128 2:132303190-132303212 ATTTCCTGCCCATTGCCTAGAGG + Intergenic
938575419 2:132598756-132598778 ATTGACTGCCCAGTGCCTCTAGG - Intronic
938689834 2:133777277-133777299 CCTGCCTTCCCAGTGTCCAGCGG + Intergenic
938855707 2:135308258-135308280 GTTTCCTGCCCACTCCCCAGGGG + Intronic
940391930 2:153142309-153142331 TTTATTTGCCCAGTGCCCAGTGG + Intergenic
942616390 2:177795614-177795636 ATTCCCTGCCCAGTGGAAAGAGG - Intronic
946516025 2:220412425-220412447 ATTGCCTGCCTGGTTACCAGTGG + Intergenic
947359899 2:229336028-229336050 ATAGGCTGCTCAGTGCCCTGGGG - Intergenic
1170750107 20:19137886-19137908 ATTGCAGGCACAGAGCCCAGTGG - Intergenic
1171860032 20:30391003-30391025 ATTGCCTTCCCAAAGCACAGAGG + Intronic
1171872012 20:30536024-30536046 ATTTCCTGCCCATTGCCTAGAGG + Intergenic
1172949815 20:38715716-38715738 ACTGCCTGCCAAGTACCGAGGGG - Intergenic
1175839773 20:62019617-62019639 AAAGCCTGGCCAGTGGCCAGTGG + Intronic
1176073426 20:63238105-63238127 AGGGCCTCCCCAGTGCCCTGTGG - Intronic
1177444968 21:21182725-21182747 ATTGCCTTTCCAGTGCACTGGGG - Intronic
1179265747 21:39801376-39801398 ATTGTCAGCCAAGTGCTCAGTGG - Exonic
1179810997 21:43869675-43869697 ACAGCCAGCCCAGTGCCAAGTGG + Intronic
1183063426 22:35348854-35348876 GCTGCCTGCCCACTGCCCATGGG - Intergenic
1183730753 22:39617278-39617300 GCTGCCTTCCCAGAGCCCAGAGG - Intronic
1184465793 22:44668497-44668519 ACAGCCTGCGCAGTGCTCAGGGG + Intergenic
1184792545 22:46708931-46708953 GGTGCCTGCCCATTCCCCAGTGG + Intronic
1185258893 22:49850609-49850631 TGTGCCTCCCCAGTGACCAGTGG + Intergenic
950150780 3:10685608-10685630 ATTGCTTGGCCAGTGGACAGTGG - Intronic
950174008 3:10859321-10859343 CTTGAGTGCCCAGTGCTCAGTGG + Intronic
952042413 3:29277012-29277034 ATTGCTTCCCCATTTCCCAGTGG + Intergenic
952667250 3:35922066-35922088 AGTGGCTGCCAAGTACCCAGAGG + Intergenic
953417805 3:42732898-42732920 CTTCCCTGCCCAGTCCCCACAGG - Exonic
953771923 3:45784104-45784126 TCTGACTGCCCAGTGCCCATGGG + Intronic
954794568 3:53155002-53155024 GATGCCTGCCCAGTACCCACGGG + Intergenic
959035403 3:101357303-101357325 ATTGCCTGGACACTGCACAGTGG + Intronic
962814703 3:138987706-138987728 AATGCATGCCAAGTGCCCTGAGG - Intergenic
962970331 3:140394924-140394946 ATGGTCTGCCTGGTGCCCAGTGG - Intronic
964319601 3:155481318-155481340 ACTTCCTGACCAGTGCCCGGGGG + Exonic
964512603 3:157469398-157469420 ATTTCCTGACCTGTGCTCAGTGG + Intronic
966554469 3:181243548-181243570 ATTTCCTGCCCTCTGCCCACTGG - Intergenic
967284302 3:187853552-187853574 ATTACCTCACCAGTCCCCAGAGG + Intergenic
968054982 3:195684343-195684365 TCTGCTTGCTCAGTGCCCAGGGG - Intergenic
968100931 3:195964933-195964955 TCTGCTTGCTCAGTGCCCAGGGG + Intergenic
968596476 4:1488629-1488651 AGGGCCTGCCTAGTGCCCACAGG - Intergenic
968734523 4:2288465-2288487 ATTGCCAGCCCAGAGCCCCTCGG - Intronic
969256658 4:6007132-6007154 GCTGCCTGACCAGTGGCCAGAGG + Intergenic
969308406 4:6338577-6338599 CTTGGCTCCCCAGTGCCCACAGG + Intronic
969528173 4:7714752-7714774 TGTGACTGCCCAGTGCCCACAGG + Intronic
970487404 4:16538322-16538344 AATCCCTGCTCTGTGCCCAGAGG + Intronic
971416684 4:26438372-26438394 GTTCTCTGCCCAGTGGCCAGCGG - Intergenic
972177606 4:36427464-36427486 ATTGCCCACCCAGTTACCAGTGG - Intergenic
975559599 4:75696611-75696633 TTTTACTTCCCAGTGCCCAGTGG + Intronic
975712755 4:77176745-77176767 TTTGCCTGCCCAGGCCCAAGGGG - Intronic
976079038 4:81333961-81333983 ATGGACTGCCCAAGGCCCAGTGG - Intergenic
976079232 4:81336344-81336366 ATGGGCTGCCCAAGGCCCAGTGG - Intergenic
982584874 4:157222942-157222964 ATTTCCTGCCGACTGCCCTGCGG + Intronic
982934706 4:161457903-161457925 ATTGCCTGCCCAGATTCAAGAGG - Intronic
983893306 4:173054344-173054366 TTTTCCTGCCCACTGCCCAATGG - Intergenic
985471745 5:50968-50990 TTCCCCGGCCCAGTGCCCAGCGG - Intergenic
985502155 5:254982-255004 TCTGCTTGCTCAGTGCCCAGGGG - Intronic
985734866 5:1573685-1573707 TCTGCTTGCTCAGTGCCCAGGGG + Intergenic
987368056 5:17167639-17167661 CTTGACTGCCCTGTGCCAAGTGG - Intronic
987668166 5:20972606-20972628 TTTGTCTGCCCAGTGGCCAGCGG + Intergenic
988981303 5:36571904-36571926 ATTGAATGCGAAGTGCCCAGAGG + Intergenic
988994032 5:36697463-36697485 ATTTCCTGCCCAGTGTCTAAAGG + Intergenic
995525675 5:113049023-113049045 AGTGACTGCCCAGTGACCACTGG - Intronic
998143658 5:139713373-139713395 CTAGCCAGGCCAGTGCCCAGTGG - Intergenic
998202378 5:140135336-140135358 ATTGTATGCCCAGTGGCCAAGGG - Intergenic
998383936 5:141745359-141745381 CCTCCCTGCCCTGTGCCCAGGGG + Intergenic
999232402 5:150069505-150069527 AGTGCCTCCCCAGAGCTCAGAGG - Intronic
1000192776 5:158927646-158927668 ATTGGCAGCCAAGTTCCCAGAGG + Intronic
1002368054 5:178728959-178728981 ATTGCCCTCCCAGATCCCAGTGG - Intronic
1002385272 5:178861089-178861111 ATTGCCCTCCCAGATCCCAGTGG + Intronic
1005508193 6:26488724-26488746 CTTGCCTGGGCCGTGCCCAGTGG + Intergenic
1006095879 6:31656459-31656481 ATTGTCTCTCCAGTTCCCAGAGG + Exonic
1006670892 6:35729038-35729060 GGTGCCTGCGCAGTGCCCTGAGG + Intergenic
1007683705 6:43652013-43652035 CGTGCCTGGCCAATGCCCAGGGG - Intronic
1007829934 6:44630287-44630309 ATTCCATGCCCAGTGCCCTGCGG + Intergenic
1015925620 6:138307788-138307810 AAAGCATGCCCAGGGCCCAGGGG + Intronic
1016911264 6:149201364-149201386 ACTGTGTGCCCAGTCCCCAGGGG - Intergenic
1019448880 7:1086001-1086023 CTTACCCGCCCAGTGCCCACAGG + Intronic
1022334536 7:29409947-29409969 ATAGCCTGCCCAGTCCCCATAGG - Intronic
1024037990 7:45524743-45524765 TCTGCCTGCTCAGTTCCCAGAGG + Intergenic
1026257757 7:68727204-68727226 GGTGCCTGCCCAGTGCCCCCAGG + Intergenic
1026501865 7:70949393-70949415 AGTGCTTGCCTAGGGCCCAGGGG - Intergenic
1029419932 7:100467214-100467236 ATCCCCTGCCCAGTGCCTTGAGG + Intronic
1029472524 7:100763644-100763666 AGTGCCTGGCCAGGGCTCAGTGG + Intronic
1032093137 7:128922010-128922032 ACCTCCTGCCCAGTCCCCAGGGG - Intergenic
1032515640 7:132504247-132504269 CTGGCCTGCCCAGTGCTCTGTGG + Intronic
1039483211 8:37890943-37890965 ACTGCCTGCCCTGTGCCTACAGG + Intronic
1041072588 8:54139635-54139657 ATTACTTGACCAGTGCCCTGGGG - Intronic
1044591317 8:93916853-93916875 ATTGGCTGCGCAGTGACGAGTGG - Intronic
1046370972 8:113305856-113305878 CTTGCATGCCCAATGCCCAATGG + Intronic
1046491025 8:114953136-114953158 CTAGCCTGTCCAGAGCCCAGAGG + Intergenic
1047851345 8:128860900-128860922 ATTACCTGTTCAGTTCCCAGAGG - Intergenic
1049299854 8:141863742-141863764 ATTGCCTGCTCACTGCAAAGTGG + Intergenic
1049373175 8:142277348-142277370 ACTGCCTGCCCAGTGCCCTCAGG + Intronic
1049539833 8:143203338-143203360 AGTGCATTCCCAGGGCCCAGTGG + Intergenic
1049570026 8:143365308-143365330 ACTGGCTGCCCCTTGCCCAGTGG - Intergenic
1049687746 8:143945745-143945767 GTGGCCTGCCCAGTGGCCCGGGG - Intronic
1058167192 9:101633503-101633525 ATTACCTGTCCATGGCCCAGGGG - Intronic
1059292719 9:113241473-113241495 CTTGCCTGACAAGTCCCCAGAGG + Intronic
1059669447 9:116478641-116478663 CTTGCCTCCCCAGTTGCCAGGGG + Intronic
1060004305 9:119986125-119986147 ATTGCCTGCCCCATGAGCAGAGG + Intergenic
1060233243 9:121841100-121841122 ATTGCCTGCACAAGGCCCATGGG - Intronic
1060497741 9:124130504-124130526 ACTGCCAGCCCAGTTCCCAAGGG - Intergenic
1062229262 9:135472360-135472382 ATTCCAAGCCCATTGCCCAGAGG - Intergenic
1062285839 9:135772107-135772129 CCTGCCTCCCCAGTGCCCTGCGG - Intronic
1062309638 9:135928980-135929002 AGAGCCTGCCCACAGCCCAGGGG + Intergenic
1188884285 X:35531170-35531192 TAAGCCTGCCAAGTGCCCAGAGG + Intergenic
1192152912 X:68723110-68723132 AGAGCATGACCAGTGCCCAGAGG - Intronic
1192261156 X:69506420-69506442 ATTGTCAGCCCAGGGCCCTGCGG - Intronic
1193277314 X:79604595-79604617 ATTGCCTGCCCAGCTACCAGTGG - Intergenic
1193305459 X:79945118-79945140 CTAGCCTGCACAGAGCCCAGAGG - Intergenic
1198233468 X:134715283-134715305 AGTGCCTACCCAAAGCCCAGGGG + Intronic
1198624784 X:138558794-138558816 AAAGCCTGACCAGGGCCCAGTGG + Intergenic
1198678102 X:139152651-139152673 AATGACTTCCCACTGCCCAGGGG + Intronic