ID: 1083625984

View in Genome Browser
Species Human (GRCh38)
Location 11:64072200-64072222
Sequence GCTTCATCCTCAGCTGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 250}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083625979_1083625984 10 Left 1083625979 11:64072167-64072189 CCTGGGGGGACTTGGGGGTCGGG 0: 1
1: 0
2: 3
3: 25
4: 249
Right 1083625984 11:64072200-64072222 GCTTCATCCTCAGCTGCTGTGGG 0: 1
1: 0
2: 3
3: 26
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083625984 Original CRISPR GCTTCATCCTCAGCTGCTGT GGG Intronic
900374504 1:2347319-2347341 GCTCCATCCCCAGCTGCAGGTGG + Intronic
900676033 1:3886894-3886916 GCTTCCTCCTGAGCTGCAGGAGG - Intergenic
904673211 1:32181220-32181242 CCCTCATCCTCTCCTGCTGTAGG + Exonic
905829585 1:41054663-41054685 GCTTCCTATTCAGCTGCTGTAGG - Intronic
910092742 1:83484545-83484567 GCTTCACACTCAGCAGCTGGGGG - Intergenic
911045481 1:93624185-93624207 GCACCATCCTCAGCTCCTGGAGG + Intronic
911094742 1:94046087-94046109 GCTTCAACATCAGCTGATGAGGG - Intronic
912747041 1:112253557-112253579 GCTTCATCTGCAGCTGCTGCTGG - Intergenic
913531133 1:119735128-119735150 TCTTCCTCCTCAGATGCTCTGGG - Intronic
915511825 1:156390835-156390857 GCAGCCTCCTCAGATGCTGTTGG - Intergenic
918217766 1:182407872-182407894 GCTTCTTTCTCAGCTACTGTGGG - Intergenic
922222863 1:223621768-223621790 CCTTAATCCTCAAGTGCTGTCGG - Intronic
923434665 1:233956762-233956784 GTTTCATCCACAGCTGCTTGAGG - Intronic
923673908 1:236064566-236064588 GCTTCCTCCCCGGCGGCTGTGGG - Intronic
924038368 1:239958278-239958300 CCTTCATATTCAGCTTCTGTGGG + Intergenic
1062878945 10:962988-963010 GCTACCACCTCAGCTTCTGTAGG - Intergenic
1067439007 10:46297779-46297801 GCTGCATCCTCACCTCCTGGTGG + Intronic
1067693760 10:48520803-48520825 GCTTCATCTCCAGCTGCCTTTGG - Intronic
1068443210 10:57086523-57086545 GCTGTATTCTCTGCTGCTGTGGG - Intergenic
1069746806 10:70720293-70720315 ACTTCTTTCTCAGCTGCTGCAGG - Intronic
1074013476 10:109508241-109508263 TCTTCATCCTCACCTCCTGTTGG - Intergenic
1074754448 10:116614027-116614049 GCTTCTTCCACAGCTTCTGATGG + Intergenic
1075314957 10:121445687-121445709 GCTTCATCCGCATCTCCTGAAGG + Intergenic
1075419586 10:122290882-122290904 GCTTCAGCCTCAACTCCTTTGGG + Intronic
1075658450 10:124176733-124176755 GCTTCATCCACAGGGGCTGACGG + Intergenic
1075844444 10:125534213-125534235 GCTTCCTCCTCTCCTGCTGTGGG + Intergenic
1077378401 11:2216173-2216195 GCCCCATCCTCAGCTCCTCTGGG - Intergenic
1077600710 11:3572556-3572578 GCTCCTGCCTCAGCTGCTCTAGG - Intergenic
1078269842 11:9785064-9785086 GGTTTAGCCTCAGGTGCTGTGGG + Intronic
1078413952 11:11150040-11150062 GCTTCTTCCACCTCTGCTGTGGG - Intergenic
1078463178 11:11530811-11530833 GCTCCATGCTGAGCTTCTGTGGG - Intronic
1081758025 11:45558374-45558396 CCACCATCCTCGGCTGCTGTAGG + Intergenic
1081847614 11:46252045-46252067 CCTTGATCCACAGCTGCGGTAGG - Intergenic
1083299567 11:61733260-61733282 GCCTCATGCTCAGCTGAGGTTGG + Intronic
1083439182 11:62664958-62664980 GCTTCTTCTTCAGCTCCTGCCGG + Exonic
1083625984 11:64072200-64072222 GCTTCATCCTCAGCTGCTGTGGG + Intronic
1083637692 11:64129334-64129356 GCTCCATCCCCGACTGCTGTTGG + Intronic
1083721054 11:64603732-64603754 GCTTCAACCTCAGAGCCTGTGGG + Intergenic
1083855373 11:65390581-65390603 GCTTCCTGCTCAGCTGCTGCTGG + Intronic
1084492377 11:69485894-69485916 GCTGCATCCTTAGCTGCAGCAGG + Intergenic
1085533655 11:77205768-77205790 GCTGCATCCTGAGCAGCTGCAGG - Intronic
1088368094 11:109059967-109059989 GTGTCATCCTCAGCTGGTATAGG - Intergenic
1088734627 11:112718617-112718639 GCTTCATCCAGAGCTGCTGCTGG + Intergenic
1089517999 11:119045768-119045790 GCTCCATCCTCACCTGCTCCAGG + Exonic
1090364431 11:126193631-126193653 CCTTCATCCTCTGCTGTTCTTGG - Intergenic
1091558403 12:1593350-1593372 TCCTCAACCTCAGCTTCTGTGGG - Exonic
1091730083 12:2874143-2874165 AATTCATCCTCATCAGCTGTGGG - Exonic
1092882640 12:12899904-12899926 GATTCATTCTCAGATGCTCTGGG + Intronic
1093289314 12:17301736-17301758 GCTTCTACCTCAGTTGCTTTAGG + Intergenic
1096842275 12:54386691-54386713 GCTTCAGCCTCTGGTGCTCTGGG - Intronic
1099273802 12:80549671-80549693 GCTTCAACCTCAGCTGGTGAAGG + Exonic
1099827732 12:87799945-87799967 GCACCATCCTCAGCTGCTGTTGG + Intergenic
1100446588 12:94666378-94666400 GCATCAGCCACAGCTGATGTAGG - Intergenic
1104008217 12:124910623-124910645 GATTCATGAACAGCTGCTGTGGG - Intergenic
1104899562 12:132181666-132181688 CCGTCAGCCTCAGCTGCTGGAGG + Intergenic
1108462979 13:50685701-50685723 GCTTCAGGCCCAGCTGCTCTGGG - Intronic
1110014622 13:70385984-70386006 GGTTCACCCTCGGCAGCTGTGGG - Intergenic
1113537775 13:111081889-111081911 GCCTCATGCCCAGATGCTGTGGG - Intergenic
1113747274 13:112754115-112754137 CCTTCATCCTGAGCCGCAGTTGG + Intronic
1113877247 13:113602063-113602085 GCTTCTCCCTCGACTGCTGTGGG - Intronic
1116934868 14:50729591-50729613 GCTTCAACGCCAGCTGCTGCAGG - Exonic
1119102096 14:71889301-71889323 GCTTCTTCCTCGGTTGCTGTTGG - Intergenic
1122075654 14:99233062-99233084 GTTTCAGCCTCAGATGCTGAGGG + Intronic
1122158593 14:99766573-99766595 TAGTCTTCCTCAGCTGCTGTTGG - Intronic
1122197949 14:100103620-100103642 GCCTCATCCTCACCTGGGGTGGG - Intronic
1122290484 14:100678106-100678128 GCATTATCCTCAGCAGCTGCGGG - Intergenic
1122702697 14:103600743-103600765 GCTCCATCCTCACCTGCATTTGG - Intronic
1122839275 14:104447154-104447176 GCTTCAGCATCAGGTTCTGTGGG + Intergenic
1122893828 14:104745507-104745529 GCTTCCTCCTCAGCAGCCCTGGG + Intronic
1122974083 14:105163950-105163972 GCTTCGGCCTGAGCTGCTGCTGG - Intronic
1123496670 15:20833736-20833758 GCTTCATCTTCAGTGGCAGTTGG + Intergenic
1123553905 15:21407328-21407350 GCTTCATCTTCAGTGGCAGTTGG + Intergenic
1123590149 15:21844693-21844715 GCTTCATCTTCAGTGGCAGTTGG + Intergenic
1124204000 15:27701977-27701999 GCTTCGTTCTCAGTTGCAGTAGG + Intergenic
1124223704 15:27871062-27871084 GCTTCATCCTCTGCTGCCTTAGG + Intronic
1125321611 15:38494752-38494774 GGTCCTTCCTCAGGTGCTGTAGG + Exonic
1127272517 15:57414141-57414163 GCTCCATGCCCAGCTGATGTAGG - Intronic
1128165016 15:65456362-65456384 GTTTCTTCCTCAGGTGCAGTTGG - Exonic
1129205979 15:74037207-74037229 GCCTCACCCTCAGCTGATGGCGG + Intronic
1130633344 15:85592336-85592358 ACTTCATGCTCAGCTGCCGTGGG + Intronic
1131818749 15:96249828-96249850 CCTGCATCCTAAGATGCTGTTGG - Intergenic
1132295957 15:100734609-100734631 GCTCCTTCCTCAGCTGATCTAGG - Intergenic
1202962251 15_KI270727v1_random:134524-134546 GCTTCATCTTCAGTGGCAGTTGG + Intergenic
1133304619 16:4801502-4801524 ACTTCATCCTAGGCAGCTGTGGG - Exonic
1133933333 16:10249913-10249935 GCTACATCATCACCTTCTGTGGG + Intergenic
1135544228 16:23355046-23355068 GCCTCACCCTCAGCAGCTGGGGG + Intronic
1135719103 16:24799767-24799789 GGTTGAACCTCAGCTGCTCTTGG + Intronic
1136402293 16:30025243-30025265 GGTTCTTCCTCATCTGCCGTGGG - Exonic
1138047008 16:53735651-53735673 GCTGCTTCCTGAGCTGCTGCTGG - Intronic
1139591589 16:67936094-67936116 CCTTTTGCCTCAGCTGCTGTGGG - Exonic
1140199154 16:72880320-72880342 GCTACATCCTCAGGTACTGGAGG - Intronic
1140522886 16:75597380-75597402 GCTTCCTCCTTAGCTTCTGATGG - Intronic
1141656286 16:85418351-85418373 GCATCATCCTCTGCTTCTGAGGG - Intergenic
1141749431 16:85948299-85948321 GCATCTTCCTGAGCAGCTGTCGG + Intergenic
1141883499 16:86875361-86875383 GCTTCTTCCTCAGCCTCTGCTGG - Intergenic
1141944252 16:87298650-87298672 GCTTCATCCTCCAGTGCTCTTGG + Intronic
1141948450 16:87325571-87325593 GGGTCATCCTCAGCTGCACTGGG - Intronic
1142199617 16:88754831-88754853 GATGCAGCCTCAGCTCCTGTGGG - Intronic
1144037289 17:11378806-11378828 TTGTCAGCCTCAGCTGCTGTCGG + Intronic
1144071231 17:11672824-11672846 GCTTCAACCTGAGCTTCTGAAGG - Intronic
1144515452 17:15914596-15914618 TCTACAGCCTCAGCTCCTGTGGG + Intergenic
1145991856 17:29084082-29084104 GCTCCTTCCTCAGCAGCTCTGGG - Intronic
1146128100 17:30245038-30245060 GCTTAATTCTAAGTTGCTGTTGG - Intergenic
1146223623 17:31047952-31047974 GCTTGATCCTGACCTGGTGTTGG + Intergenic
1146272665 17:31494586-31494608 TCTACTTCCTCAGCTTCTGTGGG + Intronic
1147232781 17:39031212-39031234 GCTTGATCCTGACCTGGTGTTGG - Intergenic
1147232814 17:39031404-39031426 GCTTGATCCTGACCTGGTGTTGG - Intergenic
1147790590 17:43012232-43012254 GCTCCTTTCTCAGCTGCTGCAGG - Exonic
1147922003 17:43923426-43923448 GCTTGATCCTGACCTGGTGTTGG + Intergenic
1148173985 17:45548543-45548565 GCTTGATCCTGACCTGGTGTTGG + Intergenic
1148275282 17:46296904-46296926 GCTTGATCCTGACCTGGTGTTGG - Exonic
1148297388 17:46514483-46514505 GCTTGATCCTGACCTGGTGTTGG - Exonic
1148361942 17:47018963-47018985 GCTTGATCCTGACCTGGTGTTGG - Intronic
1149591208 17:57831118-57831140 GCTTTATCATCAGCTCCTGCTGG - Intergenic
1150285312 17:63950744-63950766 GCCTCAGCCTCAGCTGCTGGGGG + Intronic
1150405199 17:64895465-64895487 GCTTGATCCTGACCTGGTGTTGG + Exonic
1150784229 17:68150071-68150093 GCTTGATCCTGACCTGGTGTTGG + Intergenic
1150784285 17:68150428-68150450 GCTTGATCCTGACCTGGTGTTGG + Intergenic
1151402665 17:73866004-73866026 GCTTCTTTCTCGGCTGCTGTTGG + Intergenic
1151634635 17:75337462-75337484 GCCTCATCCTCAGATGCTTCTGG - Intronic
1151690301 17:75679989-75680011 GCTTCATCCACAGGAACTGTAGG - Intronic
1152260843 17:79266223-79266245 CCTCCATCCCCAGCTGATGTGGG + Intronic
1152355937 17:79807358-79807380 GTTTCTTCCGCAGCTTCTGTGGG + Intergenic
1152848544 17:82617557-82617579 GCTTCAACCTGTGGTGCTGTGGG - Intronic
1153761311 18:8334898-8334920 ACTTCATCCTCAGCTGCTGATGG + Intronic
1154454580 18:14509420-14509442 GCTTCATCTTCAGTGGCAGTTGG + Intronic
1155499516 18:26472837-26472859 GTTTCACCTGCAGCTGCTGTGGG + Intronic
1155621780 18:27787464-27787486 ACTTCCACCTCTGCTGCTGTAGG - Intergenic
1156613184 18:38751657-38751679 GCTTCATCCTGAGAAGCTGTAGG - Intergenic
1156881710 18:42088204-42088226 GCTTCCTCCTCACCTCCTCTTGG + Intergenic
1157437460 18:47682841-47682863 GCTTCAGACTCAGATGCTGACGG - Intergenic
1157712543 18:49859860-49859882 CCTTGAGCCTCGGCTGCTGTGGG - Intronic
1159027689 18:63200972-63200994 GCTGCATCCTCAGCTCCAGCAGG + Intronic
1160060855 18:75527546-75527568 TCTTCCTCCCCAACTGCTGTGGG + Intergenic
1160694391 19:475531-475553 GCTGCCTCCTCACCTGCTTTGGG - Intergenic
1163262477 19:16199549-16199571 TCTTCACTCTCAGCTGCTTTAGG - Intronic
1163586330 19:18166153-18166175 GCTTCATCTGCAGCTCCTGGAGG - Exonic
1164274426 19:23704161-23704183 CCTTCAGCCACAGCTCCTGTTGG + Intergenic
1165986018 19:39769625-39769647 GCTCTAACCTCAGCTGCTGATGG + Intergenic
1166047106 19:40236095-40236117 CCTCCATCCTCAGGTGCTGGAGG - Exonic
1168129651 19:54310125-54310147 GCTCCATCCTCAGGGGCTCTTGG + Intronic
1168130613 19:54316223-54316245 GCTTCATCCTCAGGGGCTCTTGG + Intergenic
925285373 2:2712286-2712308 GCATGAGGCTCAGCTGCTGTGGG - Intergenic
931903834 2:66821280-66821302 GCTGCACCATCTGCTGCTGTGGG - Intergenic
932449966 2:71803160-71803182 GCTTCATCCTCAGATGCTGCAGG - Intergenic
934585396 2:95488514-95488536 GCTGCAGCCCCAGCTTCTGTAGG - Intergenic
934594069 2:95588242-95588264 GCTGCAGCCCCAGCTTCTGTAGG + Intergenic
934788714 2:97037440-97037462 GCTGCAGCCCCAGCTTCTGTAGG - Intergenic
935946509 2:108291159-108291181 GGTTCATTCTCAGCTTCTGGAGG + Intronic
936977759 2:118236474-118236496 GCTTGATCATAAGCTGCTGGAGG + Intergenic
937604493 2:123781185-123781207 GCCTTATCCTCTGCTGCTGCCGG - Intergenic
938016199 2:127869341-127869363 CCCTCATTCTCAGCTGCAGTTGG + Intronic
938123048 2:128647043-128647065 TCCTCATCCCCACCTGCTGTAGG - Intergenic
938298975 2:130197003-130197025 CCTTCCTGCTCAACTGCTGTGGG + Intronic
938457748 2:131477511-131477533 CCTTCCTGCTCAACTGCTGTGGG - Intronic
940725072 2:157327770-157327792 ACATCATCCTCAGCAGCTGCAGG - Intergenic
940858553 2:158749237-158749259 GCTTCTCCCTCAACAGCTGTTGG - Intergenic
944492767 2:200274902-200274924 GCTTCATGCTCAGCAGATGCTGG - Intergenic
944893973 2:204145326-204145348 GCCTCATCCTCACCTGCTTTTGG - Intergenic
945038060 2:205721160-205721182 CCTTTATCCGCAGCTCCTGTAGG - Intronic
945163749 2:206920458-206920480 GCCTCATCCTCAGCTGAGGTAGG - Intergenic
947108780 2:226696373-226696395 GCTTGACCCTCAACTACTGTTGG + Intergenic
1169745140 20:8935727-8935749 GATGCATACTCAGCTGCTGATGG - Intronic
1170036796 20:11998112-11998134 GCTTCACCCTCAGCTTCTACAGG - Intergenic
1173333783 20:42097073-42097095 GCTTCATCATGAGCAGCTTTTGG + Intronic
1174036948 20:47674311-47674333 CCTTCGTTCTCAGCAGCTGTAGG - Intronic
1174131427 20:48346019-48346041 GCTTCAGCCTCTGTTACTGTGGG + Intergenic
1174286904 20:49480469-49480491 GCTTCCTCCTCTGAGGCTGTGGG - Intronic
1174299129 20:49568915-49568937 CCCTCATCCTCACCTGCTTTGGG + Intergenic
1175327544 20:58140230-58140252 GCTGCACCCTCAGCTCCTGGGGG + Intergenic
1176133044 20:63504867-63504889 GCTTCCTCCTCTGAAGCTGTCGG + Intergenic
1176819588 21:13643888-13643910 GCTTCATCTTCAGTGGCAGTTGG - Intergenic
1178482201 21:32989330-32989352 GTTACAACCTCAGCTCCTGTGGG - Intergenic
1179989907 21:44942403-44942425 ACTTCTCCCTCAGGTGCTGTGGG + Intronic
1179989916 21:44942441-44942463 ACTTCTCCCTCAGGTGCTGTGGG + Intronic
1180750597 22:18121760-18121782 GCTGCTTCCTTAGCTACTGTGGG - Intronic
1182119192 22:27775851-27775873 GGGGCAGCCTCAGCTGCTGTCGG - Intronic
1183029923 22:35096034-35096056 GCCTCATCCTCAGCAGTTTTAGG + Intergenic
1183089349 22:35510837-35510859 GCTTCAGCATCACCTGCTGATGG + Intergenic
1184553536 22:45218940-45218962 GCTTCATGCACAGGGGCTGTGGG + Intronic
1184968966 22:48001842-48001864 GCTTGAGGCTCGGCTGCTGTGGG + Intergenic
1184970395 22:48015976-48015998 GCTTGCTCTTCAGCTTCTGTGGG + Intergenic
1185301161 22:50081839-50081861 CCTTCAGCCTCAGCGGCTGCCGG - Intronic
952403727 3:32986973-32986995 GCATCATCAGCATCTGCTGTCGG - Intergenic
959509106 3:107189542-107189564 GCTTCACACTCAGCTGCTTCAGG - Intergenic
961259808 3:125593168-125593190 GCTTCGTCCTGACCTGCTATGGG - Intronic
962493033 3:135911889-135911911 GCTGAATCCTCAGATGCTCTAGG + Intergenic
962733204 3:138301689-138301711 GCTTCAGCCTCACCGCCTGTGGG + Intronic
964447672 3:156777282-156777304 GGTTCCTCCTCAGCTGCTGAAGG - Intergenic
964911920 3:161793323-161793345 GCTTTATCCTCACCTTCTGTTGG + Intergenic
967704204 3:192630926-192630948 GCTTTAGCCTCAGCTGTTGGGGG - Intronic
968490271 4:886405-886427 GCTCCCTCCCCAGCAGCTGTGGG - Intronic
968612843 4:1564879-1564901 GCATCATCCTCCCCAGCTGTGGG + Intergenic
971030787 4:22634913-22634935 GGTGCATCCTCCGCAGCTGTTGG - Intergenic
972327006 4:38026317-38026339 GGCTCTGCCTCAGCTGCTGTGGG + Intronic
973188341 4:47357507-47357529 GCTTCATGCTCAGCTGCAAGGGG - Intronic
973562238 4:52148809-52148831 GTGTCACCCACAGCTGCTGTAGG - Intergenic
974477449 4:62402011-62402033 GCTTGAGTCTCAGCTGCTCTCGG + Intergenic
974619238 4:64334894-64334916 GCTTCTTCCTTAGATGATGTTGG - Intronic
975300138 4:72780420-72780442 TCTTCATTCTCAGCTTCTGTGGG - Intergenic
976101058 4:81564573-81564595 GATTCATCCCCAGCTGTTTTAGG + Intronic
977331809 4:95645812-95645834 GCTTCATAAGCAGCTGCAGTTGG - Intergenic
978907326 4:114022284-114022306 GCTTCATTCTGAGGTACTGTGGG - Intergenic
979727784 4:123985063-123985085 GCATCATCAGCAGCTGCTGCAGG + Intergenic
980088739 4:128419024-128419046 GCTGCCTTCTCAGCTCCTGTGGG - Intergenic
982032719 4:151316772-151316794 CCTTGCTCCTCAGCAGCTGTTGG - Intronic
985814603 5:2117280-2117302 ACTCCATCCACAGCTTCTGTTGG - Intergenic
986573481 5:9189135-9189157 GCTTCATCATCACCTCCTGGCGG + Intronic
990986178 5:61642894-61642916 GCTTCAGCCTCGGCTGTGGTGGG - Intronic
991008476 5:61856046-61856068 GCATCATCCGCAGCTACTGAAGG + Intergenic
992751253 5:79864689-79864711 GCCTAATCCTCTGCTCCTGTGGG + Intergenic
995651060 5:114368837-114368859 GGTTTATCCTCAGCAGCAGTAGG + Intronic
996097406 5:119413531-119413553 CCATCATTCTCAGCTGCTGCGGG + Intergenic
997815963 5:137017293-137017315 GCTTCATACACAGTTGCTATTGG + Intronic
998043190 5:138966434-138966456 GCTCCATCCTCAACTCCTGGAGG + Intronic
999124251 5:149235149-149235171 GCCTCATGCTCAGCTGCTCCTGG + Intronic
999548782 5:152660921-152660943 TCTCCATCCTCAGTTTCTGTGGG - Intergenic
1000395168 5:160767177-160767199 GCTGCATTCTAAGCTGCTCTGGG + Intronic
1001182170 5:169530666-169530688 GCTTCATAACCAGCTGCTCTTGG - Intergenic
1002169611 5:177367707-177367729 GCTTCAGCTTCGGCTTCTGTGGG - Exonic
1002322322 5:178383259-178383281 GCCACATGCTCAGCTCCTGTTGG + Intronic
1002341529 5:178519334-178519356 GCTGCAAACCCAGCTGCTGTGGG + Intronic
1003568915 6:7243146-7243168 TCTCCATCCTCAGATGCTTTGGG + Intronic
1004512977 6:16297602-16297624 GCTTCATCTCCAGGTCCTGTGGG - Intergenic
1005507927 6:26485900-26485922 GGTTCATCCTCAGTAGCTGGAGG + Intergenic
1005549656 6:26899508-26899530 GCCTCAGCCACAGCTGCAGTAGG + Intergenic
1006787320 6:36677278-36677300 GCTTCTTTCTCCTCTGCTGTGGG - Intronic
1012336783 6:98069690-98069712 GCTTCATCCTAAGCTTCAGGTGG - Intergenic
1012492528 6:99798150-99798172 GCCTCGTCCTGAGCTGCGGTCGG + Intergenic
1015843129 6:137493909-137493931 TCTTCAGCCTCAACTGCTGTAGG + Exonic
1020287778 7:6698608-6698630 GCTGCATTCTGAACTGCTGTAGG - Intronic
1024992942 7:55250694-55250716 TCTTCATCCTCATTTGCTGCTGG - Intronic
1027309602 7:76941041-76941063 GCTTCACACTCAGCAGCTGGGGG - Intergenic
1029682474 7:102121274-102121296 TCTTCTGCCTCAGCTGCTGGAGG + Intronic
1031750514 7:125566404-125566426 GATTCATCCTCAGCTCCTATAGG - Intergenic
1032492433 7:132333568-132333590 GCCTGCTCCTCAGCTGCTGGAGG + Intronic
1032794568 7:135267467-135267489 GCATCATCCTCAGCTGCAGCAGG + Intergenic
1034934062 7:155187286-155187308 GTTTCCACGTCAGCTGCTGTGGG - Intergenic
1035099240 7:156382680-156382702 GCTTCCTCCTCCCCTGCTGGGGG + Intergenic
1035108127 7:156458996-156459018 GTTTCCACCACAGCTGCTGTTGG + Intergenic
1035746050 8:1962697-1962719 TCAGCATCCCCAGCTGCTGTGGG + Intergenic
1037250233 8:16884576-16884598 GCTTAGTCCCTAGCTGCTGTAGG - Intergenic
1041090349 8:54296142-54296164 ACTTCATCCTAAGCTACAGTGGG - Intergenic
1041119511 8:54571765-54571787 GCCTCTTCCTCAGCTCCTGGTGG + Intergenic
1041786359 8:61638751-61638773 GCTTCATTCTCAGGGGCTGGCGG - Intronic
1046694827 8:117328415-117328437 GCTACATTCTCAGATGCTGTAGG - Intergenic
1047582850 8:126235975-126235997 TCTTCATCCTCAGCAGCATTTGG - Intergenic
1047855943 8:128913571-128913593 GCTACATCCTCAGATGCGGAAGG + Intergenic
1049385264 8:142339970-142339992 GCTGCATCATCAGCCCCTGTTGG - Intronic
1049697777 8:143992017-143992039 TCATCGTCCTCAGCTGTTGTGGG + Exonic
1051016902 9:12488981-12489003 GCCACATCCTCAGCTGCATTTGG - Intergenic
1051525722 9:18041792-18041814 ACTTCATCCTCAGCTGATTTGGG - Intergenic
1054838178 9:69702490-69702512 CCACCATGCTCAGCTGCTGTAGG + Intergenic
1054990988 9:71326771-71326793 CCTTCATCCTCAGCAACTCTGGG + Intronic
1055561570 9:77526638-77526660 GCTTCTTCCCCAGCTTCTGGTGG - Intronic
1056793292 9:89639910-89639932 GCTGCATCCTCTGCTGTGGTGGG - Intergenic
1059277287 9:113107565-113107587 GCTTCATCCTCTTCCTCTGTGGG - Intergenic
1059278964 9:113116986-113117008 GCTTCATCCTCTTCCTCTGTGGG + Intergenic
1059491998 9:114675766-114675788 TCTTCATCCTCATCTTCTCTGGG + Intergenic
1059889437 9:118785119-118785141 ACTTTATCCTCAGCATCTGTAGG + Intergenic
1061102186 9:128500402-128500424 GCTTCACCTTCTGCTGCTTTTGG - Exonic
1061389881 9:130311573-130311595 GGTGCATCCTCAGGGGCTGTGGG + Intronic
1061491273 9:130945770-130945792 GCTTCAGCCCCAGCTGCTCTGGG + Intergenic
1061662951 9:132142430-132142452 GCTTCATCCTCACATGCTCCGGG + Intergenic
1062203833 9:135324484-135324506 GCTTCAAACCCAGTTGCTGTGGG - Intergenic
1062353690 9:136152055-136152077 GCCTCACCCTCAGCAGCTTTGGG + Intergenic
1186155090 X:6717129-6717151 GATTCATCCTCACCTTCGGTAGG + Intergenic
1187338766 X:18403034-18403056 GCCTCTTCCTCAGCTTCTGGTGG - Intergenic
1187483774 X:19682849-19682871 GCATCATCTTCTGCAGCTGTAGG - Intronic
1188113952 X:26222059-26222081 CCTTCTCCCTCAGCTGCTCTGGG - Intergenic
1189201279 X:39197694-39197716 GTTTCAGCCTCAGCTGCAATGGG - Intergenic
1192404411 X:70869915-70869937 GTTTCAGCCTCAGCTGCCTTTGG - Intronic
1193599952 X:83499306-83499328 GCTGTATCATCAGCAGCTGTAGG + Intergenic
1197055486 X:122113766-122113788 GCTGCAGCTGCAGCTGCTGTGGG + Intergenic
1199045580 X:143167434-143167456 GACTCATCCTCAGCAGGTGTTGG + Intergenic
1199642011 X:149871515-149871537 GCTTCATGCTGGGATGCTGTAGG - Intergenic
1199698135 X:150358192-150358214 GGCTAATCCTCAGCTGCAGTGGG - Intergenic
1201548907 Y:15198157-15198179 GATTCATCCTCACCTTCAGTAGG + Intergenic
1201917878 Y:19202360-19202382 CCTTCATGCTCAGCTACTCTTGG + Intergenic
1202049597 Y:20766801-20766823 GCTTAGTCCTCAGCAGCTCTAGG + Intronic