ID: 1083626276

View in Genome Browser
Species Human (GRCh38)
Location 11:64073715-64073737
Sequence CCTCCCAAACACACTCCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 249}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083626276 Original CRISPR CCTCCCAAACACACTCCTTG GGG Intronic
901609616 1:10487308-10487330 ACTGCCAAACTCACTCCATGAGG - Intronic
901815589 1:11791636-11791658 CAAGCCAAACACACTCCTGGAGG - Intronic
902168520 1:14592241-14592263 CCTCCAAGAGACAGTCCTTGGGG - Intergenic
902208437 1:14887024-14887046 CCTCACAACCACACTCGTGGGGG - Intronic
902538410 1:17135260-17135282 CCTCCCTGACATACTCTTTGTGG + Intergenic
903814939 1:26058041-26058063 CCTCCCCAACAAGCTCTTTGAGG + Intronic
904324573 1:29719976-29719998 CTTCCCACATACACTCCCTGGGG + Intergenic
904954401 1:34270992-34271014 CACACCAACCACACTCCTTGAGG - Intergenic
904979823 1:34489838-34489860 CCTCCCTAACTCATTCCATGAGG + Intergenic
904986470 1:34553587-34553609 CCTCCCCAACTCACTCTATGAGG + Intergenic
904999409 1:34656672-34656694 CCTCCCACAAACCCTCCTTAAGG - Intergenic
905144867 1:35880291-35880313 CCTCCCAAAGACTCTTCTTATGG - Intronic
906753572 1:48288299-48288321 CCTCCCAAACTCACTTTATGAGG - Intergenic
906997216 1:50809752-50809774 CCTCCCTAACTCACTGTTTGAGG + Intronic
911170085 1:94762102-94762124 CCTCCCTAACTCATTTCTTGAGG + Intergenic
911675193 1:100650760-100650782 CCTCCCAAACTCATTCTATGAGG + Intergenic
912435536 1:109658551-109658573 CCTCCCAACCACCCTCCTCTGGG - Intronic
916627227 1:166571531-166571553 ACTACCATGCACACTCCTTGAGG - Intergenic
916890861 1:169111161-169111183 CCTCCCATACACACTGCAAGTGG + Intronic
917998226 1:180463689-180463711 CCTCCCTAACTCATTCCATGAGG + Intronic
918273170 1:182923349-182923371 CCTCCCTAACTCATTCTTTGAGG + Intronic
918309053 1:183272554-183272576 CACCCCAAACACATCCCTTGTGG - Intronic
919235023 1:194829712-194829734 CCTCCCTAACACATTCCATAAGG - Intergenic
919262762 1:195218747-195218769 CACCCCACACTCACTCCTTGGGG + Intergenic
922386450 1:225089090-225089112 CCTCCCTAACACATTCTATGAGG + Intronic
923275388 1:232390940-232390962 CCTCACAAACTCACTCATTCAGG + Intergenic
923686228 1:236155511-236155533 CCTCCCACCCACACCCTTTGCGG - Intronic
923928105 1:238659044-238659066 ACTGACAAACACACTCCTTATGG - Intergenic
1062772765 10:116056-116078 CCTCACAAAACCACTCCTTCTGG + Intergenic
1064225060 10:13475438-13475460 ACTCCCAAACTCTTTCCTTGTGG + Intronic
1064286935 10:13999692-13999714 CTTCCCAATCACAACCCTTGTGG - Intronic
1065059647 10:21886461-21886483 CCTCCCAAACTCATTCTATGAGG + Intronic
1065142457 10:22732226-22732248 TCTTCCAAACACATTCCATGAGG - Intergenic
1066511983 10:36110337-36110359 CCTACCAAACTCACTGGTTGAGG + Intergenic
1067346389 10:45441713-45441735 CCTCTGGAACACACTCCTTATGG + Intronic
1067924257 10:50491800-50491822 CCTCCCAAACTCATTCTATGAGG + Intronic
1068999510 10:63247886-63247908 ACTTCCAAACTCATTCCTTGAGG + Intronic
1071787781 10:88921815-88921837 CCTGCCTAACACACCACTTGAGG - Intronic
1072270655 10:93773388-93773410 GCTACCAAACACTTTCCTTGAGG - Intronic
1074717504 10:116233570-116233592 CCTCCCCAACACTCTCCTTGTGG + Intronic
1076933259 10:133548712-133548734 CCTCCCTAACTCATTCCATGAGG + Intronic
1077323061 11:1951013-1951035 CCTCCCGGACTCACTCCATGGGG - Exonic
1079248129 11:18768369-18768391 GCTCTCAAACACAATCCCTGTGG - Intronic
1081307924 11:41536216-41536238 CCTCCCACACACACAGCTAGAGG + Intergenic
1081961254 11:47139285-47139307 ACTCCCACACACACCCCTAGAGG + Intronic
1083626276 11:64073715-64073737 CCTCCCAAACACACTCCTTGGGG + Intronic
1084690651 11:70724002-70724024 CCTCCAGAACACACCTCTTGAGG - Intronic
1084818142 11:71663086-71663108 CCTCCCAAACCCATCCCTAGGGG - Intergenic
1085222390 11:74885694-74885716 CCTCCCTAACTCATTCTTTGAGG + Intronic
1086806762 11:91253468-91253490 CCTCCCTAACTCACTCTATGAGG - Intergenic
1086995121 11:93347524-93347546 CCTCCCAAACTCATTCTATGAGG - Intronic
1090085667 11:123648765-123648787 CATGACAAACACACTCCTTTGGG - Intronic
1202806046 11_KI270721v1_random:6208-6230 CCTCCCGGACTCACTCCATGGGG - Intergenic
1092002635 12:5044567-5044589 GTTCCCCAACACACTCCTGGGGG + Exonic
1094812385 12:34151246-34151268 ACTTCCAAGCACACTCATTGTGG - Intergenic
1095298390 12:40553444-40553466 CCTCCCTAACACATTCTATGAGG - Intronic
1096675239 12:53222528-53222550 CCTCCCAACCCCCCTCCCTGTGG - Intronic
1098892408 12:76023102-76023124 GTTCCCAAAAACACTACTTGGGG - Intergenic
1099129993 12:78816576-78816598 CCTCCCCAACACATTCTATGAGG + Intergenic
1103011426 12:117461289-117461311 CCTAACAAACAAACTCATTGGGG + Exonic
1103325172 12:120115735-120115757 CCACACACACACACTGCTTGAGG - Intronic
1103838219 12:123841138-123841160 CATCCCAAAGACACTTATTGGGG - Intronic
1106002608 13:25738346-25738368 CCCCCCACACACACTTCTTCTGG + Intronic
1108804738 13:54140563-54140585 CATAACAAACACACTCCTTGTGG + Intergenic
1108848239 13:54700222-54700244 CCACACACACACACACCTTGGGG - Intergenic
1109203140 13:59453050-59453072 CCTTCCAAACAAACTCCCAGAGG - Intergenic
1109331953 13:60941543-60941565 CTTCCTAAACACACTGCATGTGG + Intergenic
1109403703 13:61869828-61869850 CCTCCCTAACACATTCTATGAGG - Intergenic
1110908468 13:80923030-80923052 TCACCCATACCCACTCCTTGGGG - Intergenic
1112062960 13:95760033-95760055 CATCCCAAACACAAACCTTGAGG - Exonic
1112154080 13:96798249-96798271 CCTCCCAAAGACAGTGTTTGGGG - Intronic
1112177871 13:97045904-97045926 CCACCTTTACACACTCCTTGTGG - Intergenic
1112261816 13:97884328-97884350 CCTGCCCAACTCACTCCTTCTGG - Intergenic
1112314593 13:98350193-98350215 CCTCCCAGACTCTCTGCTTGAGG - Intronic
1113559774 13:111269471-111269493 CCTGACAAACACACTCATTAAGG - Intronic
1115132900 14:30074299-30074321 CCTCCCAAACTCATTCTGTGAGG + Intronic
1116648643 14:47562237-47562259 CCTCCCTAACTCACTCTATGAGG - Intronic
1117968842 14:61232676-61232698 CCTCCCCAACCCAGTCCTTTTGG + Intronic
1118723493 14:68610143-68610165 CCTCCCCAAACCTCTCCTTGAGG + Intronic
1119571158 14:75673973-75673995 CCCCCCAAACATACTTCTTTTGG + Intronic
1120074481 14:80140056-80140078 CCTCCCAAACACACTGCCTCAGG + Intergenic
1121612782 14:95293016-95293038 TCTCCCAAATACATTCCTAGTGG - Intronic
1125182772 15:36896352-36896374 GCTCACAAACACGCTGCTTGTGG + Intronic
1125586764 15:40826150-40826172 CCTCCCAAGCCCACTCACTGAGG - Intronic
1126533767 15:49738287-49738309 CCTCCCTAACACACTCCATGAGG + Intergenic
1127512587 15:59657389-59657411 CCTCCCTAACCCACTACCTGTGG + Exonic
1127616665 15:60692932-60692954 CCTCCCTAACACATTCTATGAGG + Intronic
1132170293 15:99644825-99644847 CCACCCAACAACCCTCCTTGGGG - Intronic
1133331977 16:4980517-4980539 CCTCCCTGACACCCTCCTTGAGG + Intronic
1134892873 16:17856469-17856491 CTTCCCAAACACTCTTCTTTAGG - Intergenic
1136178933 16:28537926-28537948 CCACCCAATCACACACCTTCCGG + Intronic
1136779460 16:32887217-32887239 CCAACCACACACACCCCTTGAGG - Intergenic
1136891156 16:33974301-33974323 CCAACCACACACACCCCTTGAGG + Intergenic
1139494121 16:67303506-67303528 ACTCCCTACCACACTCCTTAGGG - Intronic
1141104800 16:81224636-81224658 CCCCCCAAATAGACTCCTTGAGG - Intergenic
1141241525 16:82269498-82269520 CATCCCAAACAAAAGCCTTGAGG + Intergenic
1142413465 16:89927994-89928016 CCTCCCTAACACTCTCTTTGAGG - Intronic
1203081876 16_KI270728v1_random:1149305-1149327 CCAACCACACACACCCCTTGAGG - Intergenic
1143299570 17:5899646-5899668 CCTCCCAAGCACACACGCTGTGG + Intronic
1143693461 17:8590836-8590858 CTTCCCAAACACTCTCCCTCAGG + Intronic
1145755662 17:27388456-27388478 CCTTCCAAAAAAACTCCTTGAGG - Intergenic
1146521912 17:33531965-33531987 CTTCCCATACACACTCCTCTTGG - Intronic
1146939724 17:36836127-36836149 CCTCACACACACACTCCTCAGGG - Intergenic
1147357997 17:39912549-39912571 TCTCCAAAACACCCTCCCTGGGG + Intronic
1147632458 17:41940913-41940935 CCTCCCAAACTTACTTCTTGAGG + Intronic
1147982267 17:44281813-44281835 CCTGCCAAACACACACAGTGGGG - Intergenic
1148107065 17:45124412-45124434 CCCCCCAAACACACACCCAGTGG + Intronic
1148118179 17:45190352-45190374 CCTCCCAAACTCACTCCCCTGGG - Intergenic
1149284197 17:55143759-55143781 CTTCCAAAACACACCCTTTGGGG - Intronic
1152467195 17:80473073-80473095 CCTGGCAAACACTTTCCTTGGGG + Intronic
1153950567 18:10054539-10054561 CCACCCCCTCACACTCCTTGTGG + Intergenic
1154019813 18:10653583-10653605 CCTCCCTAACACACTTTATGAGG + Intergenic
1154182859 18:12152218-12152240 CCTCCCAAACACATTCTATGAGG + Intergenic
1154204897 18:12328017-12328039 CCTCCCAAAAACACCCTATGAGG + Intronic
1157007930 18:43608683-43608705 CCTCCCAACCGCCCTCCTTTTGG + Intergenic
1157202599 18:45671867-45671889 CCTCCAAAACACAGTCCCTGTGG + Intronic
1157565088 18:48674485-48674507 CCTCCTAAAACCACTCATTGTGG - Intronic
1158795622 18:60842673-60842695 CCTCCCTAACTCATTCTTTGAGG + Intergenic
1159229429 18:65587000-65587022 CCTCCCAAACTCATTCTATGAGG - Intergenic
1160138162 18:76292613-76292635 ACTTCCAAACTCATTCCTTGAGG - Intergenic
1160920973 19:1520397-1520419 CCTCCCCAGCACCCTCCTTCCGG - Intergenic
1164306034 19:24004245-24004267 CCTCCCAAGTACAGGCCTTGTGG - Intergenic
1164391761 19:27829218-27829240 CCTCCCCAACTCATTCCATGAGG - Intergenic
1165148719 19:33748937-33748959 CTTCCCAGCCTCACTCCTTGAGG - Intronic
1166557946 19:43713925-43713947 CCTCGCAAACACACACATTCCGG - Intergenic
1166654905 19:44603877-44603899 GCTCCTAACCTCACTCCTTGTGG - Intergenic
1167453128 19:49583906-49583928 TCTCCCAAAAGCGCTCCTTGAGG - Exonic
1167502999 19:49857822-49857844 CCTCCCAGCCACAGTCCGTGAGG - Intronic
926454198 2:13043928-13043950 CCTCCCTAACACATTCTATGAGG + Intergenic
926747954 2:16175313-16175335 TCTCCCATACAGCCTCCTTGGGG + Intergenic
934655537 2:96115279-96115301 CCCCACAAACACCCTCCTTCTGG + Exonic
937876195 2:126827231-126827253 CTTCCCTAACAAACTCCTTGAGG + Intergenic
940150597 2:150596198-150596220 GCTCCCATACACACTTCTTCTGG + Intergenic
940393085 2:153155233-153155255 CCTCCCTAACACATTCTATGAGG - Intergenic
940396585 2:153197633-153197655 CCACTCAAACACACTGCCTGGGG - Intergenic
942385772 2:175441243-175441265 CCTCCCAAGCACCCTCCTTGTGG + Intergenic
943368653 2:186988472-186988494 CCTCCCTAACACATTCTATGAGG - Intergenic
944809280 2:203312152-203312174 TCTCCAAAACAGACTGCTTGTGG + Intergenic
945968893 2:216217358-216217380 CTGACCAAACACACTCTTTGTGG - Intergenic
948099843 2:235365019-235365041 ACTCTCAAAGACACTCCCTGGGG - Intergenic
948698670 2:239747260-239747282 CCTCCAAAACCCACTGCTTAGGG + Intergenic
948862344 2:240758725-240758747 CCTCCCAAACTCCCTCCAGGGGG + Intronic
949017824 2:241723413-241723435 CCAGCCAGCCACACTCCTTGAGG - Intronic
1169047493 20:2546087-2546109 CCTCCATAAAACACTACTTGGGG - Intronic
1170299467 20:14867079-14867101 CCACCTAAACACGATCCTTGAGG - Intronic
1171475284 20:25403871-25403893 ACTCACAAACACACTCTTTGTGG + Intergenic
1171747941 20:29017879-29017901 CCTCCCAAACTCATTCTATGAGG + Intergenic
1172368424 20:34367550-34367572 CCTTCCAAACACAGTGCTTCTGG - Intronic
1173412933 20:42830079-42830101 CCTCCCCAACTCATTCCATGAGG + Intronic
1173809992 20:45949732-45949754 CCTCCCAAAGACCTACCTTGGGG - Intronic
1173965968 20:47113218-47113240 CCTCCCAATCAATTTCCTTGTGG - Intronic
1174748794 20:53091001-53091023 CCTCCAAAACACACTCCTGAGGG - Intronic
1175982020 20:62743442-62743464 CCTCCCAGACAGACTCCAGGTGG - Intronic
1176668899 21:9713559-9713581 CCACCCCGACACCCTCCTTGCGG - Intergenic
1177241552 21:18464892-18464914 CCTCCCTAACTCATTTCTTGAGG + Intronic
1177764675 21:25443633-25443655 CCTCCCCAACTCATTCCATGAGG + Intergenic
1179148392 21:38789211-38789233 CCTCCCATATAAACTCCATGAGG + Intergenic
1179631306 21:42680264-42680286 GCTCCCAATCACACTCTTTTGGG - Intronic
1181648717 22:24247391-24247413 CCTTCCAAACCCACTCCCTCTGG + Intergenic
1182057911 22:27374683-27374705 CATCACAAAGATACTCCTTGAGG + Intergenic
1182993336 22:34789410-34789432 CCTCCCAGACAGGCTACTTGGGG - Intergenic
1185322415 22:50207899-50207921 CCTGCCGAAAACACTCCTCGTGG + Intronic
949944257 3:9177748-9177770 CCTCCCATTCTTACTCCTTGTGG + Intronic
950751800 3:15134921-15134943 CCCCCCAAACCCATTCCTAGGGG - Intergenic
953700019 3:45188185-45188207 CCTGGCAAACACAGTCCTTGAGG - Intergenic
953851498 3:46468628-46468650 CCTTCCCAACACTCTTCTTGGGG - Intronic
954411893 3:50374438-50374460 CCTGCCCCACACACTCCTGGGGG - Intronic
954609063 3:51934637-51934659 CCTCCTCAACACAGACCTTGTGG - Exonic
954724122 3:52592665-52592687 CCTCCCCAACTCATTCTTTGAGG - Intronic
954766594 3:52923197-52923219 CCCCCCACACACACACCTTTTGG - Intronic
957339325 3:78873119-78873141 CCTCCCAAAAACAGTCTTGGGGG + Intronic
959113398 3:102148401-102148423 CCTCCCCAACTCATTCCATGAGG - Intronic
959483832 3:106905813-106905835 CCTCTCCAACAGCCTCCTTGAGG - Intergenic
959821881 3:110745068-110745090 CCTCCCTTACACATTCTTTGAGG + Intergenic
961557906 3:127709250-127709272 CCTCCCAAACCTACATCTTGGGG - Intronic
962001392 3:131301864-131301886 CCTCCCTAACTCACTCTATGAGG - Intronic
962349323 3:134645040-134645062 CCAGCCAATCACCCTCCTTGAGG - Intronic
962472805 3:135728193-135728215 CCTCCCTAACTCACTCTGTGAGG - Intergenic
966505223 3:180693079-180693101 CCTAACAACCACACTCCTTAAGG + Intronic
966596078 3:181725874-181725896 TTTCCCAAATGCACTCCTTGTGG - Intergenic
966713811 3:182995960-182995982 CCTCCCTAACTCATTCTTTGAGG - Intergenic
968684377 4:1947164-1947186 CCTCCCCAGCACACTCCCTGTGG + Intronic
977678954 4:99777818-99777840 CCTCCCTAACTCATTCATTGAGG + Intergenic
978368382 4:108006173-108006195 CCTCCCCCACACACTCCCTAAGG - Intronic
980090581 4:128438979-128439001 CCTCCCTAACTCACTCTATGAGG - Intergenic
980099988 4:128532392-128532414 CCTCCCTAACTCACTCTATGAGG - Intergenic
981061717 4:140432018-140432040 CCCCCCACACAGAGTCCTTGTGG + Intergenic
981944478 4:150325213-150325235 CCTCACTCACACACTGCTTGGGG - Intronic
982190045 4:152844193-152844215 TCTCCCAAACACACTCCCACTGG - Intronic
985405884 4:189637954-189637976 CCACCCCAACACCCTCCTTGCGG + Intergenic
985514969 5:337721-337743 CCTTCCAAGCGCACTCCTTAGGG - Intronic
986559701 5:9048197-9048219 CCTCCCGAACACAATGCTTTTGG + Intronic
986655715 5:10009647-10009669 CCTCCCTAACTCACTCTATGAGG + Intergenic
987418210 5:17687323-17687345 CCTCCCAGACCTACTCCTGGTGG - Intergenic
988879236 5:35482445-35482467 CCTCCCAGCCTCACTGCTTGTGG + Intergenic
989389144 5:40882438-40882460 CCTCCCAATCACAGGCCTGGAGG + Intergenic
989411723 5:41127056-41127078 CCTCCCAAACACGCTGCCAGAGG + Intergenic
990048424 5:51464070-51464092 CCTCCATAACACATACCTTGAGG + Intergenic
993623254 5:90192718-90192740 GCTCCAAAAGAGACTCCTTGAGG + Intergenic
996084677 5:119292268-119292290 CCTCCCAGAAACACTCCTCCTGG - Intronic
996178315 5:120387467-120387489 CCTCCCAAAGACCCCTCTTGGGG + Intergenic
996454734 5:123667696-123667718 CCTCCCTAACTCATTCTTTGAGG + Intergenic
997005799 5:129814884-129814906 CTTCCCAAACACAGTCATTTTGG + Intergenic
997183914 5:131861959-131861981 CCTCCCTAACTCACTCTTTGCGG - Intronic
998127838 5:139636177-139636199 CCTCCCAAATAAACTCCTTAAGG - Intergenic
998934875 5:147224428-147224450 TCTCCCAAGCACCCTTCTTGTGG + Intergenic
1000194129 5:158941445-158941467 CCTCCTAAACACACTCTATAGGG + Intronic
1003378873 6:5604273-5604295 ACTCCCATCTACACTCCTTGAGG + Intronic
1003902327 6:10666357-10666379 CCTCCCTAACTCATTCCATGAGG - Intergenic
1003928123 6:10896404-10896426 CCTCCCAAATATACTGGTTGAGG - Intronic
1004611421 6:17244348-17244370 CCTCCCTAACTCATTCCATGAGG + Intergenic
1005097087 6:22128820-22128842 CCTCCCTAACACATTCAATGAGG - Intergenic
1006085552 6:31592634-31592656 CCTCCCACCCACACTCCTTGGGG + Intronic
1007075766 6:39065235-39065257 CCTCCCTCCCACACTCCTTGGGG - Intronic
1007596275 6:43053153-43053175 CCTCCCAAACATACCCCTCTGGG - Intronic
1008635063 6:53402578-53402600 CCTCCCAAACTCATTTCATGAGG - Intergenic
1010654799 6:78499653-78499675 CCTCCCTAAATCACTCTTTGAGG - Intergenic
1010728744 6:79365405-79365427 CCTCCCAAACTCATTTCATGAGG - Intergenic
1016227659 6:141759893-141759915 CCTCCCTAACTCATTCTTTGAGG - Intergenic
1016453316 6:144206235-144206257 CCTCCCCAACTCACTCTATGAGG - Intergenic
1017601601 6:156089168-156089190 CCTCCCAAACTCATTCTATGAGG + Intergenic
1018348441 6:162928034-162928056 TCTCCCAAACACATTCTATGAGG - Intronic
1020224433 7:6269018-6269040 CCTGCCAGAGACACTCCCTGAGG + Intronic
1023672787 7:42596834-42596856 CTCCCCAAACACACTCTTTTTGG - Intergenic
1024055570 7:45658030-45658052 CCTGCCAACCAGACTCCCTGTGG + Intronic
1024301786 7:47892546-47892568 CCTCCCAACCTCCCTCCTTTTGG - Intronic
1027778807 7:82498521-82498543 CTTCCCAAACATACTCTTGGTGG + Intergenic
1028380959 7:90197915-90197937 ACTCCAAAACTCAATCCTTGGGG + Intronic
1031669215 7:124522150-124522172 CCTCCCTAACACACTCTATGAGG - Intergenic
1032077440 7:128842709-128842731 CCTCCCAGACCCACCCCTTCCGG - Intronic
1032468931 7:132164273-132164295 GCTCCCCAGCACACTCCTGGAGG + Exonic
1032965879 7:137096859-137096881 CCTCCCTAACTCACTCTATGAGG + Intergenic
1033244534 7:139707062-139707084 CTTCCCAGGCACACTCCTGGAGG + Intronic
1033412248 7:141128677-141128699 CCTCCCTACCACACTCATCGTGG - Intronic
1033484902 7:141779078-141779100 CCTTGCTAATACACTCCTTGAGG + Exonic
1035385371 7:158468771-158468793 CCACCCACACACACTCCCGGTGG + Intronic
1035385414 7:158469053-158469075 ACACCCACACACACTCCTGGTGG + Intronic
1035543433 8:459688-459710 CCTCTCAGACACACTCCGTGAGG - Intronic
1037155302 8:15692332-15692354 CCTCCCAAACTCATTCTATGAGG - Intronic
1037687055 8:21149712-21149734 TCTCCCAAACTCATTCCATGAGG + Intergenic
1039417663 8:37409483-37409505 CCTCCCAAACACCCTCATAGAGG - Intergenic
1039524198 8:38198959-38198981 CCTCCCAAAGGACCTCCTTGTGG + Intronic
1040355278 8:46611495-46611517 CCTCCCAAACTCATTCTATGAGG + Intergenic
1044344944 8:91094551-91094573 CATCTTAAACACACTCCTTATGG - Intergenic
1045423761 8:102042672-102042694 ACTACCAACCAGACTCCTTGGGG + Intronic
1045928047 8:107593789-107593811 CCTCCCTAACTCATTTCTTGAGG - Intergenic
1049410206 8:142470639-142470661 CCTCCCATACCCACTCCCTGTGG - Intronic
1049606986 8:143534392-143534414 CCTCCCAAACCCACTCTTCCTGG + Intronic
1050659229 9:7864655-7864677 CCTCCCTAACTCACTCTATGAGG - Intronic
1054796781 9:69309604-69309626 TTTACCAAACATACTCCTTGTGG - Intergenic
1055401702 9:75930886-75930908 CCTCCTTAAAACACTCCTGGAGG + Intronic
1055478317 9:76685473-76685495 ATTTCCAAACACACACCTTGAGG - Intronic
1055755630 9:79554754-79554776 CCTCCCAAAACCACTGCTTTGGG - Intergenic
1055841956 9:80515941-80515963 CCTCCCTAACACATTCTATGAGG - Intergenic
1056660235 9:88537780-88537802 CTCACCAAACACACTCCCTGGGG - Intronic
1057304474 9:93904295-93904317 CCTGCCAGGCACACTCCTGGCGG - Intergenic
1057720367 9:97527538-97527560 CCTACACAACACTCTCCTTGCGG - Intronic
1058967409 9:110049929-110049951 CCTCCCAGACGCCCTCTTTGTGG - Intronic
1060963783 9:127700300-127700322 CCTCCCACCCACACCCCTTATGG + Intronic
1061185878 9:129052917-129052939 CCTCACCAACACACTCCTACAGG - Intronic
1061611816 9:131751776-131751798 CCTCCCACTCACACCCCCTGTGG + Intergenic
1062323676 9:136002773-136002795 CCTACCACACACACACATTGAGG - Intergenic
1203371073 Un_KI270442v1:305607-305629 CCTCCCTAACTCACTTCATGAGG + Intergenic
1203656967 Un_KI270753v1:7376-7398 CCACCCCGACACCCTCCTTGCGG + Intergenic
1186461916 X:9754646-9754668 ACTCCCAAATACTATCCTTGGGG + Intronic
1186964109 X:14769171-14769193 CCTCCCTAACTCACTCTATGAGG - Intergenic
1188983318 X:36748203-36748225 CCTCCCAAACTCATTCTATGAGG - Intergenic
1189949537 X:46214439-46214461 CTTCCCAAACCCAGTCCTTTGGG - Intergenic
1190689921 X:52905102-52905124 CCTGCCAATCAGAATCCTTGAGG - Intronic
1190696062 X:52950690-52950712 CCTGCCAATCAGAATCCTTGAGG + Intronic
1191950300 X:66584002-66584024 CCTCCCTAACTCATTCATTGAGG + Intergenic
1192262569 X:69515224-69515246 CCTCCCAATCCCACTGCCTGAGG + Intronic
1194948376 X:100095204-100095226 CCTCCCAAACTCATTCTATGAGG + Intergenic
1197886029 X:131219432-131219454 CCTGCAGAACACACTCCTTGTGG - Intergenic
1198219342 X:134585615-134585637 CATCATAAACACACTCCCTGGGG - Intronic
1199441349 X:147871545-147871567 CATCCCAAACACATTCTATGAGG + Intergenic
1199570670 X:149264160-149264182 CATCCCAAACCCACTCTTTGTGG + Intergenic
1200100295 X:153686781-153686803 CCAACCACACACACCCCTTGAGG + Intronic
1201971729 Y:19805082-19805104 CCTCCCTAACTCATTTCTTGAGG + Intergenic