ID: 1083627357

View in Genome Browser
Species Human (GRCh38)
Location 11:64078512-64078534
Sequence CATCGGAGGGATACCCGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 142}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083627343_1083627357 -1 Left 1083627343 11:64078490-64078512 CCACCCCGGCCTCCCCTTGCAGC 0: 1
1: 0
2: 3
3: 60
4: 672
Right 1083627357 11:64078512-64078534 CATCGGAGGGATACCCGGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 142
1083627349_1083627357 -10 Left 1083627349 11:64078499-64078521 CCTCCCCTTGCAGCATCGGAGGG 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1083627357 11:64078512-64078534 CATCGGAGGGATACCCGGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 142
1083627345_1083627357 -5 Left 1083627345 11:64078494-64078516 CCCGGCCTCCCCTTGCAGCATCG 0: 1
1: 0
2: 2
3: 22
4: 167
Right 1083627357 11:64078512-64078534 CATCGGAGGGATACCCGGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 142
1083627344_1083627357 -4 Left 1083627344 11:64078493-64078515 CCCCGGCCTCCCCTTGCAGCATC 0: 1
1: 0
2: 3
3: 25
4: 279
Right 1083627357 11:64078512-64078534 CATCGGAGGGATACCCGGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 142
1083627346_1083627357 -6 Left 1083627346 11:64078495-64078517 CCGGCCTCCCCTTGCAGCATCGG 0: 1
1: 0
2: 1
3: 15
4: 187
Right 1083627357 11:64078512-64078534 CATCGGAGGGATACCCGGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 142
1083627341_1083627357 22 Left 1083627341 11:64078467-64078489 CCACTTAGGCTAATCTGGTTATT 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1083627357 11:64078512-64078534 CATCGGAGGGATACCCGGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083627357 Original CRISPR CATCGGAGGGATACCCGGGA GGG Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
908370037 1:63472494-63472516 CATCAGAGGGAGACCATGGAAGG - Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
919887101 1:201942509-201942531 CCTTGGAGGGAGACCCTGGAGGG + Intronic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
924280977 1:242437182-242437204 CACTGGAGGGATACCAGTGATGG + Intronic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069687265 10:70326238-70326260 CACTGTAGGGATACCTGGGAGGG - Intronic
1070827267 10:79398559-79398581 GATGGGAGGGAAACCTGGGAGGG + Intronic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1077229118 11:1450706-1450728 CGTCGGAGGGGTGCCCTGGAGGG + Exonic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1083627357 11:64078512-64078534 CATCGGAGGGATACCCGGGAGGG + Intronic
1083807586 11:65084232-65084254 CAGCGGAGGGATAATCGGGGCGG + Exonic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088367197 11:109052255-109052277 CATGGGAGGGAGTCCAGGGATGG - Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1101302220 12:103494865-103494887 AATGGGAGGGTTTCCCGGGAGGG + Intronic
1102516503 12:113452184-113452206 GATGGGAGGGGTACCCGGCAAGG - Intergenic
1107305248 13:39012158-39012180 AAACCCAGGGATACCCGGGAGGG + Exonic
1108228603 13:48316337-48316359 CATCTGAGCGATTCCCGGGGAGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114427501 14:22636434-22636456 CATCAGAGGGAGACCCTGGAGGG - Intergenic
1115640498 14:35332734-35332756 CATTGCAGGGAGACCTGGGAAGG + Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1118359075 14:65040811-65040833 CATTGGCGGGGTACCAGGGATGG + Exonic
1120359982 14:83487057-83487079 CATCTGATGGATAACCGAGAAGG - Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1125868324 15:43075998-43076020 CATCAGAGGGAGACCATGGAAGG - Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1128154921 15:65386045-65386067 CCTGGGAGGGATTCCCTGGAAGG + Exonic
1132357797 15:101185567-101185589 CATGGGAGGGCTACCTGGGAAGG - Intronic
1132375768 15:101327307-101327329 CATCTCTGGGATACCTGGGAAGG - Intronic
1133711342 16:8404393-8404415 CATCGGATGGATATGAGGGAGGG - Intergenic
1135963188 16:27014737-27014759 CATGGGAGGGATACACAGCAGGG - Intergenic
1136364599 16:29803927-29803949 AATCGAAGGGCTACCAGGGAGGG + Intronic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137287993 16:47032048-47032070 CACCGGAGGGGTAATCGGGAGGG + Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1142735507 17:1896316-1896338 GAACGGAGTGATACCCAGGAAGG - Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1146183431 17:30710666-30710688 CACTGGAGAGATACCTGGGAGGG - Intergenic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1151341789 17:73476360-73476382 TTTGGGAGAGATACCCGGGATGG + Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1160431440 18:78815711-78815733 CATCAGAGGGCTGCCTGGGATGG - Intergenic
1162113630 19:8414898-8414920 CATCGGTGGCATAGCCAGGAGGG + Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1162975358 19:14205094-14205116 CACTGGAGAGATACCTGGGAGGG + Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
927168577 2:20350298-20350320 AATCGGAGGGAGAACCGGGTCGG + Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928025450 2:27735633-27735655 CGTCGCCGGGATATCCGGGAAGG + Intergenic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
935289593 2:101598852-101598874 CATCTGAGGTATCCCAGGGAAGG + Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
937452181 2:122010750-122010772 CAGCGGAGGCAAACCCTGGAGGG + Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938954138 2:136282869-136282891 CATCGGAGGCTTGCCCGGGCTGG - Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
945177146 2:207054182-207054204 CATGGCAGGGATACCTGGGAGGG + Intergenic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
947722978 2:232380507-232380529 CATCTGAGGGATGCCAGGGCAGG - Intronic
947727328 2:232408588-232408610 CATCTGAGGGATGCCAGGGCAGG - Intronic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169228943 20:3874269-3874291 CAGGGGAGGGATACTGGGGAGGG + Exonic
1180145949 21:45918953-45918975 CATCGGAGGGGAACCCTGGGCGG + Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973862617 4:55080075-55080097 CATCGGAGTGATATCCGGACTGG + Exonic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
985002802 4:185502675-185502697 CATCAGAGAGAAACACGGGATGG - Intronic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
996762301 5:126998676-126998698 CATCTGTGGGCTACCTGGGAAGG - Intronic
1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1002634425 5:180600088-180600110 GATCAGAGGGACCCCCGGGAGGG - Intergenic
1003319629 6:5038849-5038871 CATCAGAGGGAGACCGCGGAAGG + Intergenic
1005854499 6:29850528-29850550 CACCGGAGGGACAACCTGGAGGG - Intergenic
1006985585 6:38173448-38173470 CATCAGAGGGCTACCGGGGCAGG - Exonic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1013530951 6:111018185-111018207 CATCAGGGGGAGACCGGGGAGGG + Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1027357542 7:77372967-77372989 CAGCTGAGGGATACCTGGGATGG + Intronic
1030303999 7:108001981-108002003 CGTCGGTGGGTTTCCCGGGAGGG - Intronic
1032513114 7:132487717-132487739 CATGAGAGGAAGACCCGGGAAGG + Intronic
1033151208 7:138916430-138916452 CATCAGAGGCATGCACGGGATGG - Intronic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1034496887 7:151428486-151428508 CATGGGAGGGAGGCCCAGGAAGG + Intergenic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035171455 7:157019547-157019569 GAGCCGAGGGATACCTGGGAGGG - Intergenic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1046932625 8:119856161-119856183 CATCGGCTGGAAACCAGGGACGG - Intergenic
1049285808 8:141774624-141774646 CATGGGAGTGAATCCCGGGAGGG + Intergenic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189329107 X:40132185-40132207 CATCGGAAGGATATCCGAGATGG - Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190778799 X:53577542-53577564 CATCAGAGGGAGACCATGGAAGG - Intronic
1191835201 X:65456462-65456484 CATCAGAGGGAGACCATGGAAGG - Intronic
1198870835 X:141176302-141176324 CAGGGGAGGGATCCCGGGGATGG + Exonic