ID: 1083631362

View in Genome Browser
Species Human (GRCh38)
Location 11:64097163-64097185
Sequence CAGGCTCAGGATGCTGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 361}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083631362_1083631375 19 Left 1083631362 11:64097163-64097185 CCCTCTGCAGCATCCTGAGCCTG 0: 1
1: 0
2: 4
3: 38
4: 361
Right 1083631375 11:64097205-64097227 CCCCCCAGAAAGTACAGGGAGGG 0: 1
1: 0
2: 0
3: 22
4: 176
1083631362_1083631381 28 Left 1083631362 11:64097163-64097185 CCCTCTGCAGCATCCTGAGCCTG 0: 1
1: 0
2: 4
3: 38
4: 361
Right 1083631381 11:64097214-64097236 AAGTACAGGGAGGGACTGCTGGG 0: 1
1: 0
2: 2
3: 21
4: 206
1083631362_1083631373 18 Left 1083631362 11:64097163-64097185 CCCTCTGCAGCATCCTGAGCCTG 0: 1
1: 0
2: 4
3: 38
4: 361
Right 1083631373 11:64097204-64097226 ACCCCCCAGAAAGTACAGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 122
1083631362_1083631380 27 Left 1083631362 11:64097163-64097185 CCCTCTGCAGCATCCTGAGCCTG 0: 1
1: 0
2: 4
3: 38
4: 361
Right 1083631380 11:64097213-64097235 AAAGTACAGGGAGGGACTGCTGG 0: 1
1: 0
2: 2
3: 16
4: 263
1083631362_1083631371 14 Left 1083631362 11:64097163-64097185 CCCTCTGCAGCATCCTGAGCCTG 0: 1
1: 0
2: 4
3: 38
4: 361
Right 1083631371 11:64097200-64097222 CCAGACCCCCCAGAAAGTACAGG 0: 1
1: 0
2: 2
3: 16
4: 127
1083631362_1083631372 15 Left 1083631362 11:64097163-64097185 CCCTCTGCAGCATCCTGAGCCTG 0: 1
1: 0
2: 4
3: 38
4: 361
Right 1083631372 11:64097201-64097223 CAGACCCCCCAGAAAGTACAGGG 0: 1
1: 0
2: 0
3: 12
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083631362 Original CRISPR CAGGCTCAGGATGCTGCAGA GGG (reversed) Intronic
900462315 1:2807592-2807614 GAGGCTCAGGGTGCAGGAGAGGG - Intergenic
900926433 1:5709183-5709205 CAGGCTCAGGTTGGGGCAGGTGG + Intergenic
900940134 1:5793286-5793308 CAGCCTCAGGCTGTTGGAGATGG - Intergenic
901230552 1:7639657-7639679 CAGCCTCAGGAGGCTGAAGTGGG + Intronic
901364518 1:8734508-8734530 CAGGCTCATGAGGCAGCACAAGG + Intronic
902558935 1:17264895-17264917 CAGCCTCAGGAGGCTGAAGTGGG + Intronic
903194401 1:21674011-21674033 CAGACCAAGGTTGCTGCAGAAGG - Intergenic
903391316 1:22965351-22965373 CAGGCAGAAGAAGCTGCAGATGG + Intergenic
903486377 1:23692057-23692079 CACGGTCAGGAGGCTGCAGCGGG + Intronic
904034256 1:27550604-27550626 CACGCTCAGGCTGCTGCTCAAGG + Exonic
904368446 1:30033598-30033620 CAGGCTCTGCAAGCTTCAGAGGG - Intergenic
904770289 1:32877425-32877447 CCCGCTCAGGATGATGCAGCTGG + Intergenic
905035935 1:34918436-34918458 CAGACTCAGCCTGGTGCAGATGG + Intronic
905418170 1:37819070-37819092 CTGCCTCAGGACTCTGCAGAGGG + Intronic
905656147 1:39687207-39687229 CAGCCTCAGGTTCCTGAAGATGG - Intronic
905961360 1:42045124-42045146 CAGGCTCAAGATCATGGAGATGG + Intergenic
906511587 1:46413199-46413221 CTGGGACAAGATGCTGCAGAAGG + Exonic
907177491 1:52538533-52538555 CAGTCTCAGGAGGCTGAAGTGGG + Intronic
907333032 1:53683807-53683829 CTTGCTGGGGATGCTGCAGAAGG + Intronic
908094277 1:60720857-60720879 CAGGCTGAGGATGTCTCAGAGGG + Intergenic
911491041 1:98566413-98566435 CAAGATCAGAATGCTTCAGAGGG - Intergenic
915062029 1:153194057-153194079 CAAGCTCAAGATGATGCAGAAGG - Intergenic
915903145 1:159860695-159860717 CAGCCTCAGGATCTGGCAGATGG - Intronic
917165468 1:172107458-172107480 CAGGCTGAGACTGCTGCACAGGG + Intronic
917740958 1:177961689-177961711 CAGACTCACGCTGCTGGAGAAGG + Exonic
917838499 1:178959228-178959250 CAGGACCGGGATGCTGCGGAGGG + Intergenic
920095615 1:203484604-203484626 CAGGGGCAGGTTTCTGCAGAGGG - Intronic
920229127 1:204458903-204458925 CAAGCACAGGCTGCTGGAGAAGG + Intronic
920573162 1:207033263-207033285 CAGGCTAGGGATGCTGTAGTTGG + Intronic
922482738 1:225950501-225950523 CAGGAGCAGGTTCCTGCAGATGG - Intergenic
923264126 1:232296812-232296834 CGGGCTCAGATTGCTGGAGAAGG + Intergenic
923712916 1:236401314-236401336 CTGGCTCAGGATGCTTGGGAAGG + Intronic
924602968 1:245507526-245507548 AAGCCACAGAATGCTGCAGAAGG - Intronic
1063639028 10:7813197-7813219 CTGGCTCAGGACACTGCAAAGGG + Intergenic
1067055086 10:43045446-43045468 CAGGCCCTGGATGCTGCCGGGGG - Intergenic
1067267965 10:44763499-44763521 CAGCAGCAGGATGCTGCAGTTGG + Intergenic
1067427029 10:46218214-46218236 CAACCTCTGGCTGCTGCAGATGG + Intergenic
1069510117 10:69035937-69035959 CAGCCTCTGGAGGCTGGAGAAGG - Intergenic
1069512274 10:69051344-69051366 CAGGGTCATGCTGCTGCTGAAGG + Intergenic
1070248649 10:74754247-74754269 CCGGCTCTGGGTGCTGCAGGGGG + Intergenic
1070494073 10:77005401-77005423 CAGTCTCAGGAAGCTGCAGCAGG - Intronic
1070835355 10:79444428-79444450 CCGGCCCAGGTTTCTGCAGAAGG + Intronic
1070892054 10:79948329-79948351 CAGGCTCAAGATGGCACAGAAGG + Intronic
1075596140 10:123730619-123730641 CGGGCACAGGAAGCTGTAGATGG + Intronic
1075777520 10:124998094-124998116 CAGGTTGAGGATGTGGCAGATGG + Exonic
1075787793 10:125061692-125061714 CAGGTCCAGGATGCTGCACGGGG - Intronic
1076230566 10:128817070-128817092 CAGGCTTAGGGGGCTGCTGAGGG - Intergenic
1076311665 10:129512078-129512100 CAGATGCAGGATGCTGGAGATGG + Intronic
1076562869 10:131378317-131378339 CAGGCTCAGTAGGCTGGAGAGGG - Intergenic
1077503196 11:2918435-2918457 CAGGGCCAGCATGCTGCAGAAGG - Intronic
1078849270 11:15149290-15149312 CAGCCTCAGGATGCTGGAACTGG - Intronic
1080287951 11:30638473-30638495 CATTCTCAGGATGGTGCATATGG + Intergenic
1080585192 11:33675391-33675413 CAGGCACAGGAAGCTGGAAAAGG + Intergenic
1081109714 11:39120282-39120304 CAGGCTTAGGATGTTTCAGATGG - Intergenic
1081167185 11:39820843-39820865 CAGGCTCAGGTGGTTTCAGATGG - Intergenic
1081747907 11:45485904-45485926 CAGGCCCAGGCTGCTGGAGGTGG - Intergenic
1082020924 11:47532473-47532495 CCTGCCCAGGATGCTGTAGAAGG + Intronic
1082775032 11:57237920-57237942 AAGGCACAGGATGCTTTAGAAGG + Intergenic
1083162678 11:60864974-60864996 CAGGCTGAGGGTGCTGGCGAGGG - Intergenic
1083366714 11:62145730-62145752 TAGGCTCAGGTGGCTGCAGCAGG + Exonic
1083583059 11:63837680-63837702 CTGGCTCAAGATGCTGTAGCTGG + Intergenic
1083631362 11:64097163-64097185 CAGGCTCAGGATGCTGCAGAGGG - Intronic
1083735071 11:64675522-64675544 CAGGCTGGGGACCCTGCAGATGG - Intronic
1083902501 11:65650446-65650468 CATGCTCAGGAAGCTGCAGGAGG + Exonic
1084639832 11:70418672-70418694 TAAGCTCAGGAGGCAGCAGAAGG - Intronic
1085755782 11:79200247-79200269 CAGTCTCAGAATCCTTCAGAAGG + Intronic
1088719776 11:112581924-112581946 CAAGCTCAGTATGATTCAGAAGG - Intergenic
1088927160 11:114314027-114314049 CAGCCTGAGGATGCTGGAAAGGG + Intergenic
1088989355 11:114938447-114938469 CAGGCTGAGGAGGCCTCAGATGG + Intergenic
1089192026 11:116660304-116660326 CAGGCCCTGCATGCTGCTGAGGG + Intergenic
1089398673 11:118152283-118152305 GAGGTTCAGGATGCTGGAGGAGG - Intronic
1090914519 11:131151423-131151445 CAGGTTCAGGGCTCTGCAGAAGG + Intergenic
1090955617 11:131510890-131510912 GAGGCACTGGCTGCTGCAGAGGG - Intronic
1090987433 11:131781864-131781886 GAGGCTGAGGAGACTGCAGAAGG + Intronic
1091327614 11:134703009-134703031 CAGGCTCAGGCTGCTGAGGAAGG + Intergenic
1091770944 12:3150975-3150997 GAGGCTGGGGACGCTGCAGAGGG - Intronic
1092294713 12:7189198-7189220 CAGGCCTAGGAGGCTGAAGAAGG + Intronic
1093053630 12:14532856-14532878 CAGTCTCAGGATGCTGGAGGGGG + Intronic
1094549079 12:31433181-31433203 CATGCTCAGAATGCTGGCGAAGG + Exonic
1095240636 12:39854749-39854771 CAGGCACAGGATGATGCAGAAGG - Intronic
1097023956 12:56040374-56040396 CAGACCCAGGATGGTACAGATGG - Intergenic
1097493464 12:60298189-60298211 AAGTCTAAGCATGCTGCAGATGG + Intergenic
1099694015 12:85995346-85995368 GAGACTCAGAATTCTGCAGACGG + Intronic
1099800481 12:87451132-87451154 CAGGCTGAGGAGGCCTCAGATGG + Intergenic
1101016678 12:100508233-100508255 CAGGCTCAGGAAGCAGCAGGTGG + Intronic
1101881828 12:108630901-108630923 CAGGCCCAGGATTCAGCCGATGG + Intronic
1102068063 12:109995806-109995828 CAGCCTCTGGAGGCTGCAGCCGG + Intronic
1102366643 12:112342343-112342365 CAGGCTCAGGAGGCTGAGGTGGG + Intronic
1104837435 12:131800559-131800581 CAGGCCCTGGATGAGGCAGAGGG + Intergenic
1105014433 12:132777494-132777516 GAGGCTCAGGATTCTGGAGACGG + Intronic
1106454277 13:29913029-29913051 CATGCTCAGACTCCTGCAGATGG - Intergenic
1106624776 13:31409325-31409347 CATGCTGAGGATGCAGCATAGGG + Intergenic
1107979507 13:45720992-45721014 CAGGGTCAGGCTTCTGGAGATGG + Intergenic
1109145214 13:58771748-58771770 AAGGCTCAGGAGGCTGCAGGTGG - Intergenic
1109342130 13:61075647-61075669 CAGGCTGAGGAGGCTGCAGATGG + Intergenic
1112242629 13:97696924-97696946 CAGTCTCAGGACTCTTCAGATGG - Intergenic
1112862526 13:103850207-103850229 CAGACTCATGCTGCAGCAGAGGG - Intergenic
1113413309 13:110109030-110109052 CAGGGCCTGGATGCTGCAGCGGG + Intergenic
1114665272 14:24373945-24373967 AGGGCACAGGACGCTGCAGAGGG - Intronic
1115955878 14:38778470-38778492 CAGGCAGAGGATGCAGCAGTGGG + Intergenic
1117071715 14:52063405-52063427 CAGGCTCTGGTTTCTGCAGAGGG - Intronic
1118002013 14:61532003-61532025 CAGCCTCATCGTGCTGCAGACGG + Intronic
1120648856 14:87106546-87106568 CAGACTCAGAAGGCTGCAGTAGG + Intergenic
1121336273 14:93079365-93079387 CACCCTCATGAGGCTGCAGAAGG - Intronic
1121445075 14:93973665-93973687 CAGGGCCAGGAGGCAGCAGAAGG - Intronic
1121729941 14:96179494-96179516 AAGGCTCTGGATGGCGCAGAGGG - Intergenic
1122482162 14:102054316-102054338 CAGGCCCTGGATGTGGCAGAGGG - Intergenic
1122804714 14:104250530-104250552 CAGGGTCATGGTGCTGCAGAGGG + Intergenic
1122821158 14:104345883-104345905 CAGGCTCATGAAGCCACAGATGG - Intergenic
1124151366 15:27181418-27181440 ATGGCTGCGGATGCTGCAGATGG + Intronic
1124342749 15:28900738-28900760 CAGGGTGAAGAGGCTGCAGATGG - Intronic
1124409776 15:29427533-29427555 CAGTCTCTGGAAGCTGGAGAAGG - Intronic
1125717914 15:41830163-41830185 GAGGTTCAGGCTGCAGCAGAGGG - Intronic
1126504011 15:49381431-49381453 CATGCTAAGGATGCTGAAGCAGG + Intronic
1126663758 15:51056842-51056864 CAGGTTGATGATCCTGCAGAGGG - Exonic
1127933103 15:63610684-63610706 CAGCCTCAGGAGGCAGCACAGGG + Intronic
1128676362 15:69611967-69611989 CAGGTTCAGGATGCTGCCTTAGG - Intergenic
1128907209 15:71477783-71477805 CAGGTTCAGCATGGTGAAGAGGG - Intronic
1129048447 15:72757588-72757610 CAGACACAGCATGATGCAGAAGG - Intronic
1129796682 15:78382936-78382958 AAGGCTGAGTTTGCTGCAGAAGG + Intergenic
1130669428 15:85898572-85898594 GAGCCACAGGATGCTGCAGAAGG - Intergenic
1132551973 16:557245-557267 CAGCCTCAGGCTGGTGCCGAGGG + Intergenic
1132598216 16:762730-762752 CAGGAACAGGAGGCTGCCGAGGG - Exonic
1132600388 16:770363-770385 CAGACCCAGGATGGGGCAGATGG + Intronic
1132890620 16:2202622-2202644 CAGGCCCAGGAGTCTGGAGAGGG + Intergenic
1135106658 16:19655599-19655621 CTGGCGCAGGATGCTGATGAGGG + Intronic
1136284501 16:29233208-29233230 GAGGCTGAGGATGCTGCACAGGG - Intergenic
1136287468 16:29252940-29252962 CAGACACAGGCTGCAGCAGAGGG - Intergenic
1137830513 16:51539213-51539235 CAGGCACAGGATGGGGGAGAGGG + Intergenic
1139871197 16:70110012-70110034 CCAGCTCAGGAGGCTGAAGAAGG + Intergenic
1139957699 16:70700954-70700976 CAGGCTGAGGAGGGTGCGGAGGG + Intronic
1139964778 16:70739269-70739291 CAGCCTCAGGAAGCAGCAGTAGG - Intronic
1140375669 16:74443878-74443900 CCAGCTCAGGAGGCTGAAGAAGG - Intergenic
1141468458 16:84222451-84222473 CCCGCTCAGGATGCTGCTGAGGG + Exonic
1141744021 16:85913900-85913922 CAGGCCCAGGCTTCTGCAGCCGG + Intronic
1141821344 16:86448118-86448140 CACGCTCAGGAGGCGGGAGAAGG + Intergenic
1141910432 16:87054880-87054902 CAGCCTCTGGAAGCTGGAGAAGG + Intergenic
1142089537 16:88202721-88202743 GAGGCTGAGGATGCAGCACACGG - Intergenic
1142093085 16:88225569-88225591 CAGACACAGGCTGCGGCAGAGGG - Intergenic
1142117538 16:88367703-88367725 GAGGCTCAGGATGGTGCCCAAGG - Intergenic
1142148913 16:88504179-88504201 CAGGGTCTGGATGCCGCTGAGGG - Intronic
1142305028 16:89280090-89280112 CAGACTAAAGATGCCGCAGATGG - Exonic
1142747316 17:1966392-1966414 CAGGCAGAAGATGCTTCAGATGG + Intronic
1143659864 17:8318238-8318260 CTTGCTCAGGGTTCTGCAGATGG + Intronic
1144036152 17:11367728-11367750 GAGGCTGAGGATGCTGAGGATGG + Intronic
1144060737 17:11581780-11581802 CTGGCTCAGGGTTCTCCAGAAGG + Intergenic
1146659955 17:34659057-34659079 CAGGCCCAGGATGCTGGACCGGG + Intergenic
1147511053 17:41069216-41069238 CAGGCACAGGTTGCTGCTGGGGG - Intergenic
1147910881 17:43855284-43855306 CAGGAGCAGGTGGCTGCAGAAGG - Exonic
1148544116 17:48503888-48503910 CAGGCTCAAGCTGCTGCAGTGGG - Intergenic
1148816301 17:50330385-50330407 AAGGCTCAAGGGGCTGCAGACGG - Intergenic
1148891548 17:50811200-50811222 CATGCTCAGCCTCCTGCAGATGG - Intergenic
1149549637 17:57530883-57530905 CATTCTGAGGATGCTGTAGAGGG - Intronic
1149907708 17:60541811-60541833 CTGCCTCAGGACTCTGCAGAGGG + Intergenic
1150699301 17:67433747-67433769 CAGGCTCAGGAGGCTGACGCAGG + Intronic
1152646813 17:81472978-81473000 AAGGCTCAGGAAGCTGCTGGAGG + Intergenic
1153257219 18:3183716-3183738 CAGGCCCAGGAAGCTGCAATTGG + Intronic
1153566271 18:6421033-6421055 CAGGCTCAGGAGGCTGATGTGGG - Intergenic
1153893308 18:9537813-9537835 CAAGCCCATGCTGCTGCAGAGGG + Exonic
1154221812 18:12461737-12461759 GCTACTCAGGATGCTGCAGAGGG - Intronic
1154269056 18:12903581-12903603 GAGCTTCAGGATGCTGAAGAGGG - Intronic
1155443037 18:25882002-25882024 CAGGAGCTGGAGGCTGCAGAGGG + Intergenic
1155636614 18:27963485-27963507 CAGTGTCAGGCTGCTGCAGCTGG + Exonic
1156964663 18:43076689-43076711 CTAGCTCACGATGCTGAAGAAGG + Intronic
1157105191 18:44767669-44767691 CAGGATTATAATGCTGCAGATGG - Intronic
1157475235 18:48019811-48019833 CAGGCTCAGGCAGGTGCAGTGGG - Intergenic
1157558415 18:48628831-48628853 GAGGGACAGGATGCTGCTGATGG - Intronic
1157570726 18:48710335-48710357 CATGCTCAGGTCGCTGCAGGTGG + Intronic
1157677890 18:49580733-49580755 CAGCCACAGAATGCTGCAAATGG - Intronic
1157692805 18:49697805-49697827 CAGCCTCAGAAGGCAGCAGAGGG - Intergenic
1157984255 18:52419228-52419250 CATGTTCAGGATGCAGCACAGGG + Intronic
1158782048 18:60663453-60663475 CAGACTGAGGATGTGGCAGATGG - Intergenic
1159218411 18:65427826-65427848 CAGGCTGAGGAGGCCTCAGATGG + Intergenic
1159633208 18:70773819-70773841 CAGGATAGGGATGCAGCAGAAGG + Intergenic
1160020931 18:75180705-75180727 CAGGCTCAGGGTGCAGTGGAGGG - Intergenic
1161158684 19:2749293-2749315 CTGGCCCAGGTGGCTGCAGAAGG + Intergenic
1161313144 19:3606226-3606248 CAGACTCAGGGGGCTGCAGCCGG - Intronic
1164011376 19:21205957-21205979 CAGACCTAGGATGCTGCATACGG - Intergenic
1164015643 19:21254007-21254029 CAGACCCAGGATACTGCATATGG + Intronic
1165139921 19:33692724-33692746 CTGGCTCTGGGGGCTGCAGAAGG + Intronic
1166751143 19:45164501-45164523 CCGGCCCAGGAAGATGCAGAAGG + Intronic
1166863805 19:45824271-45824293 CAGGCTCAGGAAGCAGCAGCAGG - Intronic
1166997241 19:46725489-46725511 CAAGCTCTGGAACCTGCAGAAGG - Exonic
1167149842 19:47702243-47702265 CAGGTTCAGGATGCTGTCGATGG - Exonic
1167421120 19:49403995-49404017 CTGTCTCAGGTTACTGCAGAAGG + Intronic
1168270486 19:55247228-55247250 CGGGCTCAGCATGAGGCAGAGGG - Intronic
1168398644 19:56069738-56069760 CAGGCACAGGAAGATACAGATGG + Intergenic
925468818 2:4136482-4136504 GAGGCTGAGGATGCTGCAGCAGG + Intergenic
925516712 2:4691233-4691255 CAGGCTGAGGAGGTTTCAGATGG - Intergenic
926134334 2:10326026-10326048 GAGGCCCACGAGGCTGCAGAGGG + Intronic
927150529 2:20192844-20192866 CAGACCCAGGAGGCAGCAGATGG - Intergenic
930053972 2:47238006-47238028 CAGCCTAAGGATGCTTTAGATGG - Intergenic
930129590 2:47835943-47835965 CAGGTTCAGGATGCATCATAGGG + Exonic
930561015 2:52959908-52959930 CAGGCTCAGGATGCGGTGGGTGG + Intergenic
932607075 2:73172510-73172532 CAGGCTCAGGACAGTTCAGAAGG - Intergenic
932700133 2:73985989-73986011 CAGGGTCTGGACGCTGGAGAAGG - Intergenic
933070805 2:77856418-77856440 CAGGCTGAGGAGGTCGCAGATGG + Intergenic
933991920 2:87640004-87640026 CAAGCTCAGAAGTCTGCAGAAGG - Intergenic
934272612 2:91548245-91548267 CAGGCTCAGGAGGCCGCATGAGG + Intergenic
934544172 2:95200900-95200922 CAGGCTGAGGAAGAGGCAGAGGG + Intergenic
935179020 2:100673973-100673995 CTGGCCCAGGATGCTACAGAAGG - Intergenic
935292241 2:101620509-101620531 CAGGCTGAGGATGGTGAGGAAGG - Intergenic
936005251 2:108881310-108881332 AAGGCTGAGGAAGCTGCAGAAGG - Intronic
936374748 2:111930775-111930797 ATGTCTCAGAATGCTGCAGACGG + Intronic
936450026 2:112626943-112626965 TAGTCTCAGGATGCTACAGAGGG - Intergenic
936643671 2:114344754-114344776 CAGGTTCCAGAAGCTGCAGAAGG - Intergenic
937882225 2:126877005-126877027 AAGGCTCAGGAAGCTGCTCAGGG - Intergenic
938271503 2:129976054-129976076 GAGGCTCAGGAGCCTGCAGTGGG - Intergenic
938293775 2:130164107-130164129 GGGGCTCAGGAAGCTGCACAGGG + Intronic
938308188 2:130268532-130268554 CAGGCTCGGGAAGGAGCAGAGGG - Intergenic
938447144 2:131388304-131388326 CAGGCTCGGGAAGGGGCAGAGGG + Intergenic
938462768 2:131508855-131508877 GGGGCTCAGGAAGCTGCACAGGG - Intergenic
938801761 2:134770422-134770444 CAGGCTCTGGAAGCTGGAAAAGG - Intergenic
940637163 2:156312122-156312144 CAGGGTGTGCATGCTGCAGAAGG - Intergenic
944491430 2:200262184-200262206 CAGGCTAAGGAGGGTTCAGATGG + Intergenic
944665340 2:201954680-201954702 CAGGGTGAACATGCTGCAGATGG + Intergenic
945617963 2:212097228-212097250 AATGTACAGGATGCTGCAGAAGG + Intronic
946182676 2:217958386-217958408 CATGCTCAGGATGCAGACGACGG - Intronic
946189272 2:217999201-217999223 CTGGCAGAGGATGCAGCAGATGG + Intronic
946374472 2:219299774-219299796 CAGGCTCAGGGGCCTGGAGATGG + Exonic
948604043 2:239123516-239123538 CAGGCTCAGGATTGAGGAGATGG - Intronic
948735170 2:239998980-239999002 CAGGCTCAGGATGCTGCACCAGG + Intronic
1168829986 20:840643-840665 CAGGCTCAGCCTGTTCCAGAGGG + Intronic
1170891582 20:20380711-20380733 CAGCCCCAGCATGCTGGAGAAGG - Intergenic
1171257098 20:23697761-23697783 CACGCTCTGGAGCCTGCAGATGG + Intergenic
1171274255 20:23842266-23842288 CACGCTCTGGAGCCTGCAGATGG + Intergenic
1171386690 20:24774235-24774257 CAGGCTGGAGATGCTGAAGATGG - Intergenic
1171464266 20:25316813-25316835 CAGTCTCAGGAGGCTGAAGCAGG + Intronic
1172446225 20:34994837-34994859 CAGGCTCAGGCTAGTGCAGGAGG + Intronic
1172738576 20:37147812-37147834 GTGGCTGAGGAGGCTGCAGAGGG - Exonic
1172952898 20:38733298-38733320 AAGGCTGAGGATGCTATAGAGGG + Intergenic
1173178316 20:40782339-40782361 CAGGCTCAGGGTGCGTCGGAGGG + Intergenic
1173670185 20:44793519-44793541 CACCCTCAGGATACTGCTGATGG + Intronic
1173745313 20:45432222-45432244 CTGCCTCAGGACTCTGCAGAGGG + Intergenic
1174404146 20:50292845-50292867 CGGGATCAGGAAGCTGCAGGGGG - Intergenic
1175508588 20:59505453-59505475 CAGGGTTGGGGTGCTGCAGAAGG - Intergenic
1175692129 20:61073156-61073178 GGGGCTCTGGAAGCTGCAGAAGG - Intergenic
1175715107 20:61250280-61250302 CAGGCAGAGGAGGGTGCAGAGGG - Intergenic
1175785376 20:61708607-61708629 CAGGCACAGGAGGGTGGAGAGGG - Intronic
1176265611 20:64207785-64207807 CTGCTTCAGGAGGCTGCAGAGGG + Exonic
1176784250 21:13235505-13235527 AGGGGTCAGGATGATGCAGATGG - Intergenic
1177812458 21:25938932-25938954 CAGACTCAGGCTCCTACAGAGGG + Intronic
1178820772 21:35973118-35973140 CAGGCTAAGGATTCAGCACAGGG + Intronic
1179415524 21:41195344-41195366 CTGTGTCAGGAAGCTGCAGATGG + Intronic
1179416034 21:41199413-41199435 GATGCTGAGGATGCTGCAGGGGG + Intronic
1179785572 21:43728024-43728046 CAGGCTCACAGTGCCGCAGAGGG - Intronic
1180127285 21:45801118-45801140 CAGGCTGTGGGTGCTGCAGGTGG - Intronic
1181046210 22:20215518-20215540 CAGGCTCAGGAGGCTGCTCCAGG + Intergenic
1182632250 22:31695659-31695681 CAAGATAAGGCTGCTGCAGACGG - Intronic
1183734256 22:39635319-39635341 GGGGCTCAGGATGCGGCAGAAGG + Intronic
1184129034 22:42506373-42506395 CAGGCACTGGCTGCTGCACAGGG + Intergenic
1184138981 22:42566687-42566709 CAGGCACTGGCTGCTGCACAGGG + Intronic
1184158200 22:42682748-42682770 CAGCCTCAGGATCTTGGAGAAGG - Intergenic
1184596817 22:45518910-45518932 CAGGCTGCGGGTGCTGCAGTGGG + Intronic
1185334160 22:50264066-50264088 CAGCCTCAGGAAGCTGCTGTGGG + Exonic
1185370798 22:50460011-50460033 CCGGCTCAGGCTGCTGCTCAGGG + Exonic
949315388 3:2748740-2748762 AAGGCTCAAGACGATGCAGACGG - Intronic
949500016 3:4670868-4670890 TTGGCTCAGGATGCTAAAGAAGG + Exonic
950090288 3:10290142-10290164 GAGGAGCAGGAGGCTGCAGACGG + Exonic
950956027 3:17054286-17054308 CAGGCTCAGGAGGTCTCAGATGG - Intronic
952210699 3:31226538-31226560 CAGGGCCAGGAAGCTGCAGGTGG + Intergenic
952939786 3:38433681-38433703 CAGGCTGAGGTTGTTTCAGATGG - Intergenic
953664514 3:44916397-44916419 CAGCCTCAGGATGCTGAGAAAGG - Intronic
954443387 3:50533942-50533964 CAGGCCCAGGAGGCCCCAGAAGG - Intergenic
955520980 3:59775348-59775370 CAGGCTCCGGCAGATGCAGAAGG + Intronic
956911851 3:73826303-73826325 TAGGCACAAGAGGCTGCAGATGG + Intergenic
965065480 3:163841861-163841883 CAGGCTGAGGTTGTTGCAGATGG - Intergenic
965408392 3:168299365-168299387 CAGGATCAGACTGCAGCAGATGG - Intergenic
966167860 3:177041373-177041395 CAGTCTCAGCCTGGTGCAGAGGG - Intronic
966294251 3:178400399-178400421 TTGGCTCACGATTCTGCAGATGG - Intergenic
966465814 3:180230040-180230062 CTGGCTTTGGATGCTACAGAGGG + Intergenic
967513751 3:190341979-190342001 CAGGCTCAGGTGGTTTCAGATGG - Intronic
967695577 3:192527604-192527626 TAAGCCCAGGATGCTGAAGATGG - Intronic
968228951 3:196992997-196993019 GAGGCTGAGGAGGCTGCGGAAGG - Intronic
968466154 4:752492-752514 CAGGCTCTGGAAGCAGCAGCTGG - Intronic
968882536 4:3308913-3308935 CAGGCTCAGGCTGCAACATAAGG - Intronic
968964043 4:3760506-3760528 CAGGCCCAGGATGGTGGAGCAGG + Intergenic
968971981 4:3800661-3800683 AGGGCTCTGCATGCTGCAGAAGG - Intergenic
970593994 4:17583542-17583564 GACGCTCAGGCTGCTGCGGAGGG + Exonic
974812057 4:66957458-66957480 CAGGCTGAGGATGTCTCAGATGG - Intergenic
975429921 4:74277227-74277249 AAGGCTCAGGAAACTGCTGAGGG + Intronic
975664251 4:76719160-76719182 GAGGCTCAGATAGCTGCAGAGGG - Intronic
976334494 4:83869943-83869965 CAAGAGTAGGATGCTGCAGATGG - Intergenic
978284685 4:107061998-107062020 CAGGCTCAGGAGGCTGAGGCAGG + Intronic
980765635 4:137300411-137300433 CAGCCTCAGGCTGTTGCAGGTGG - Intergenic
981231751 4:142364740-142364762 CAGATTCAGGAGACTGCAGAAGG + Intronic
982790657 4:159587475-159587497 CAGGCTGAGGAGGTTTCAGATGG - Intergenic
984995910 4:185429780-185429802 TAGACTCAGGAGGCTGAAGATGG - Intronic
985063351 4:186099207-186099229 CGGGCTCAGGATTCTACTGAGGG - Intergenic
985695249 5:1336476-1336498 CAGGGGCAGGCAGCTGCAGAAGG - Intronic
985775151 5:1837564-1837586 CAGGCCCAGGAAGTTGCAGGGGG - Intergenic
985850316 5:2383788-2383810 CAGGCTCTGGGTCCTGCAGTAGG + Intergenic
986328912 5:6703116-6703138 CAGGCTCAGGAGGCTGCAGTGGG - Intergenic
986331912 5:6723327-6723349 CAGGTTAATGATGGTGCAGACGG + Intronic
986835422 5:11631741-11631763 TAGTCTCAGCATGCTGCAGCAGG - Intronic
987488516 5:18549386-18549408 CAGGCTGAGGAGGTTTCAGATGG - Intergenic
988366694 5:30309784-30309806 CAGGCTGAGGAGGTTTCAGATGG + Intergenic
989673503 5:43947033-43947055 CAGGCTGAGGTGGTTGCAGATGG - Intergenic
990491313 5:56305668-56305690 CAGGATCAGGAAGCTGCTGCTGG - Intergenic
991021871 5:61987831-61987853 CAGGCTCATGATGAGGTAGAAGG - Intergenic
992074363 5:73177178-73177200 CAGGCTGAGGATGGAGGAGAGGG - Intergenic
992150646 5:73899332-73899354 CGGGCTCGGGCAGCTGCAGAGGG - Intronic
997197042 5:131987311-131987333 CATGCTCAGGATGCAGCAGCTGG + Intronic
997458655 5:134037038-134037060 CAGGCTGATGAGGATGCAGAAGG + Intergenic
997617036 5:135253972-135253994 CAGACTCAGGAAGCAGCACATGG + Intronic
997895577 5:137713216-137713238 GATGCTCAGGAGGCTGCAGCAGG + Intronic
998105821 5:139468573-139468595 CAGGCTGAGGAGTCTGCAGAGGG - Intergenic
998182631 5:139956067-139956089 CAGGCTCTGGAGGCTGGTGAAGG + Intronic
998558801 5:143151842-143151864 CAGGCTCAGGAGGCTGAGGCAGG + Intronic
999401716 5:151269379-151269401 CAAGCTCAAGCTCCTGCAGAAGG - Exonic
1000527227 5:162372390-162372412 AGGGCCCAGCATGCTGCAGAAGG + Intergenic
1002701374 5:181127592-181127614 CAGGCCCAGGACCCTGGAGATGG + Intergenic
1002759672 6:191827-191849 CTGTCTGAGGCTGCTGCAGACGG - Intergenic
1005268097 6:24134361-24134383 CAGGCACAGGCTGCAGCTGAGGG + Exonic
1005634654 6:27741707-27741729 CACGCTCAGCCTCCTGCAGAGGG - Intergenic
1005742020 6:28800937-28800959 CAGGATCAGGTGGCTGCTGAGGG - Intergenic
1005857414 6:29873054-29873076 CAGCCTCTGGATGGTCCAGATGG - Intergenic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1006079806 6:31558644-31558666 CAGCCTCAGGATGAGGCAGAAGG + Exonic
1006794350 6:36722310-36722332 CAGGCTCAGGTGGAAGCAGAAGG + Exonic
1006824571 6:36925212-36925234 CAGGGTAAGGACACTGCAGAAGG - Intronic
1007111659 6:39316372-39316394 CAGGCCCAGGAGGATCCAGATGG + Intronic
1007418979 6:41707943-41707965 CAGCCTCAGGATGCTAGAGTTGG + Intronic
1007476917 6:42125097-42125119 CAGGCCCAGGCTGCTGGACAGGG + Intronic
1008777783 6:55062050-55062072 CAGGCACAGGTTATTGCAGATGG + Intergenic
1009027089 6:58013289-58013311 CAGGTTGAGGATGATACAGAAGG - Intergenic
1009202634 6:60764757-60764779 CAGGTTGAGGATGATACAGAAGG - Intergenic
1009780382 6:68261146-68261168 CAGGCTGAGGAGGCCTCAGATGG - Intergenic
1010865216 6:80967939-80967961 CAGGCTCATGATGCTGGTGATGG - Intergenic
1012342474 6:98143822-98143844 CAGGCTGAGGAGGCTTCAGATGG - Intergenic
1013177645 6:107691043-107691065 TTGGCTCAGAAAGCTGCAGAGGG - Intergenic
1013746849 6:113355912-113355934 CAGGCTTAGGATCCTGAAAAAGG + Intergenic
1015606117 6:134956105-134956127 CTGGCTCAGCATCCAGCAGAGGG - Intergenic
1015819931 6:137249931-137249953 AAGGCAAAGGAGGCTGCAGATGG - Intergenic
1017113682 6:150955899-150955921 GATGCTCAGGAAGTTGCAGAGGG - Intronic
1017541585 6:155408422-155408444 CAGGGTCAGGATGAGTCAGAGGG - Intronic
1018462021 6:164007467-164007489 CTGTCTCCAGATGCTGCAGATGG - Intergenic
1019015116 6:168874374-168874396 CATGCTGGGGAGGCTGCAGAAGG + Intergenic
1020550213 7:9594931-9594953 CAGGCTGAGGGGGTTGCAGATGG + Intergenic
1020806450 7:12795698-12795720 CAGGGTCAGGTTTCTGCTGATGG - Intergenic
1022498596 7:30868627-30868649 AAGGCTCAGAATTTTGCAGAAGG - Intronic
1023831310 7:44040331-44040353 CAGGCACAGGAAGCTGGTGACGG + Intergenic
1024226931 7:47332497-47332519 CAGCCACAGGCTGCTTCAGAAGG + Intronic
1024773242 7:52750459-52750481 CAGGGTGAGCATGCTTCAGAGGG - Intergenic
1026128107 7:67597293-67597315 CAGGAGCAGGCTGGTGCAGAGGG - Intergenic
1026618360 7:71928014-71928036 AAGCCTTAGGATGCTGGAGAAGG - Intronic
1029508930 7:100981214-100981236 CAGGGTCAGGGTGCTCCACAAGG - Intronic
1029741640 7:102494637-102494659 CAGGCACAGGAAGCTGGTGACGG + Exonic
1029759631 7:102593806-102593828 CAGGCACAGGAAGCTGGTGACGG + Exonic
1029776999 7:102689716-102689738 CAGGCACAGGAAGCTGGTGACGG + Intergenic
1030312720 7:108084211-108084233 CAGCCTCTGGCTGCTGCAGTTGG - Intronic
1031146503 7:118002939-118002961 CTGGCTTAGGATGCTAGAGAAGG + Intergenic
1031923663 7:127619362-127619384 CAGTCTGAGGATGCTGGAGGAGG - Intergenic
1032074007 7:128827706-128827728 CAGGCTCAGGTTTCTGAGGACGG + Intergenic
1034267504 7:149788382-149788404 CGGGCTCAGGATGCTGCTCATGG - Intergenic
1034267673 7:149789123-149789145 CAGGCTCAGGACGCTGCTGTAGG - Intergenic
1034282527 7:149864113-149864135 CAGGCTCAGGAAGGAGGAGATGG + Exonic
1036179663 8:6573352-6573374 CAGGCTCATGATGTTAAAGAGGG + Intronic
1036618017 8:10403761-10403783 CAGGCTCAGGCTGAGGCAGACGG + Intronic
1038223459 8:25632541-25632563 CAGGCTGAGGAAGATGGAGAAGG + Intergenic
1038730937 8:30127208-30127230 CAAGCTCAGGATGCTGGCAAAGG - Intronic
1038746509 8:30259615-30259637 CAGGCGTAGGATGCTGGAGATGG + Intergenic
1038864522 8:31424994-31425016 GAGGCTGAGGATGAGGCAGAAGG + Intergenic
1041007021 8:53505225-53505247 CCCGCTCAGGAAGCTGCAGTGGG + Intergenic
1041953876 8:63536266-63536288 CAGACTCGGGAAGCTGCAGTGGG + Intergenic
1042102080 8:65284650-65284672 CAGGCTCAGGAAGCTCCACCTGG + Intergenic
1042786340 8:72550943-72550965 TAGGCTCAGAATGCTGCTGCTGG + Intronic
1046257760 8:111722830-111722852 CAGGCTGAGGTGGTTGCAGATGG - Intergenic
1047191158 8:122680144-122680166 CAGGCTCTAGAAGGTGCAGAGGG - Intergenic
1047574264 8:126135720-126135742 CAGATACAGGATGCAGCAGAGGG - Intergenic
1049196200 8:141316997-141317019 AAGGCTCAGGCTGCTGCTGAGGG + Intergenic
1049706596 8:144046017-144046039 CAGGCCCAGGAGGACGCAGATGG + Intronic
1050451337 9:5784662-5784684 CTGTCTCAGGAAGCTGTAGAAGG - Exonic
1051371075 9:16359780-16359802 CAGGCTCAGTAACCTGCAGTTGG + Intergenic
1053016012 9:34662595-34662617 CAGCAGCAGGAGGCTGCAGAAGG + Exonic
1053222794 9:36325921-36325943 CAGGCCCAGGGTCCTGAAGAAGG + Intergenic
1055914303 9:81385068-81385090 CAGGCTCAGAATGATAAAGAGGG + Intergenic
1057902083 9:98957285-98957307 CAGCCTCTGGAAGCTGCAAAAGG + Intronic
1058167003 9:101631596-101631618 CAGGCTCAGAATTCTGCTGGAGG + Intronic
1059449242 9:114359924-114359946 CAGGCACAAGGAGCTGCAGATGG - Exonic
1060110314 9:120902149-120902171 CAGGGTGAGGATGCTTCAGTTGG - Intergenic
1060110954 9:120905863-120905885 CAGGGTGAGGATGCTTCAGTTGG - Intronic
1060909984 9:127341837-127341859 CAGGCTCAAGGTGATGGAGAGGG + Intronic
1061106760 9:128536849-128536871 CAAGCTCAGAAAGCTGCAGCTGG + Intronic
1062118538 9:134821951-134821973 CAGCCACAGGAGGCTGCTGAGGG + Intronic
1062399886 9:136367651-136367673 CAGGCTCAGGCGGCAGCAGCTGG - Exonic
1062564557 9:137158456-137158478 CAGGTTCATGATGCTGTAGTTGG - Exonic
1062571235 9:137186331-137186353 CAGGCTCAGTCTGCTGGAGCGGG - Exonic
1203574851 Un_KI270744v1:167802-167824 CTGGCTCTGGAAGATGCAGAAGG + Intergenic
1189007275 X:37009292-37009314 CAGTCTCAGGAGGCTCCCGATGG - Exonic
1189007380 X:37009796-37009818 CAGTCTCAGGAGGCTCCAGGTGG - Exonic
1190361553 X:49654339-49654361 CAGTCTCAGGTGGTTGCAGATGG + Intergenic
1190933014 X:54966377-54966399 CAGGCTCAGGATACTGAATGGGG - Intronic
1191873253 X:65768446-65768468 CAGGCTCAGGAGGTTTCAGATGG + Intergenic
1191877646 X:65812405-65812427 CAGGCTCAGGAGGTTTCAGATGG + Intergenic
1193793111 X:85840940-85840962 CAGGCTCCTGATGGTGCACACGG - Intergenic
1194939800 X:99995909-99995931 CAGGATCAGAAACCTGCAGAAGG - Intergenic
1195935843 X:110125058-110125080 CAGGCTATTGATGCTGTAGAAGG - Intronic
1196007052 X:110848047-110848069 CAGGCTCAGGATGATTCCAAGGG - Intergenic
1196915551 X:120531380-120531402 CAGTTTCAGGATGCTGCAGTTGG + Intronic
1197524692 X:127547083-127547105 CAGGCTCAGGAGGTCTCAGATGG + Intergenic
1197734747 X:129842731-129842753 CGGACTCAGGAAGTTGCAGAGGG - Intronic
1202344586 Y:23908073-23908095 CATGCTCAGGAGGCTGAAGTGGG + Intergenic
1202526182 Y:25762010-25762032 CATGCTCAGGAGGCTGAAGTGGG - Intergenic