ID: 1083632742

View in Genome Browser
Species Human (GRCh38)
Location 11:64104150-64104172
Sequence CGCTGCCGCCCAAGACCCTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 109}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083632742_1083632745 -8 Left 1083632742 11:64104150-64104172 CCAGAGGGTCTTGGGCGGCAGCG 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1083632745 11:64104165-64104187 CGGCAGCGACGAAGGAGGTAAGG 0: 1
1: 0
2: 0
3: 1
4: 49
1083632742_1083632754 30 Left 1083632742 11:64104150-64104172 CCAGAGGGTCTTGGGCGGCAGCG 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1083632754 11:64104203-64104225 AGAGGGACGCGAATTCAGAAGGG 0: 1
1: 0
2: 0
3: 5
4: 72
1083632742_1083632748 6 Left 1083632742 11:64104150-64104172 CCAGAGGGTCTTGGGCGGCAGCG 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1083632748 11:64104179-64104201 GAGGTAAGGCCCAAGGACAAGGG 0: 1
1: 1
2: 0
3: 13
4: 188
1083632742_1083632747 5 Left 1083632742 11:64104150-64104172 CCAGAGGGTCTTGGGCGGCAGCG 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1083632747 11:64104178-64104200 GGAGGTAAGGCCCAAGGACAAGG 0: 1
1: 0
2: 0
3: 18
4: 248
1083632742_1083632749 12 Left 1083632742 11:64104150-64104172 CCAGAGGGTCTTGGGCGGCAGCG 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1083632749 11:64104185-64104207 AGGCCCAAGGACAAGGGAAGAGG 0: 1
1: 0
2: 1
3: 48
4: 422
1083632742_1083632753 29 Left 1083632742 11:64104150-64104172 CCAGAGGGTCTTGGGCGGCAGCG 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1083632753 11:64104202-64104224 AAGAGGGACGCGAATTCAGAAGG 0: 1
1: 0
2: 1
3: 1
4: 77
1083632742_1083632746 -1 Left 1083632742 11:64104150-64104172 CCAGAGGGTCTTGGGCGGCAGCG 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1083632746 11:64104172-64104194 GACGAAGGAGGTAAGGCCCAAGG 0: 1
1: 0
2: 2
3: 15
4: 185
1083632742_1083632750 13 Left 1083632742 11:64104150-64104172 CCAGAGGGTCTTGGGCGGCAGCG 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1083632750 11:64104186-64104208 GGCCCAAGGACAAGGGAAGAGGG 0: 1
1: 0
2: 2
3: 53
4: 394

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083632742 Original CRISPR CGCTGCCGCCCAAGACCCTC TGG (reversed) Exonic
900221457 1:1511610-1511632 CCCTCCCGCCCAAGACCCCGGGG - Intergenic
900952574 1:5866146-5866168 AGCTGCATCCCAAGTCCCTCAGG + Intronic
901057404 1:6455108-6455130 CGCCGCCGCCCACGGCCCGCTGG + Intronic
902476955 1:16693371-16693393 CGCCGCCGCCCACGGCCCGCTGG - Intergenic
904744634 1:32703118-32703140 CGCTGCCGCTCAGCGCCCTCTGG + Exonic
907160591 1:52366126-52366148 CGCTGCGGCCCAGGGCCCGCGGG - Exonic
909024544 1:70467737-70467759 CGCTCCCGCACCAAACCCTCTGG - Intergenic
917700372 1:177574492-177574514 GGCTACCTCCCAGGACCCTCAGG + Intergenic
920115414 1:203617369-203617391 CCCTGCTGCCCCAGACACTCAGG + Intergenic
1064110039 10:12530642-12530664 CGCTGCCTCCCCAGACCCCGAGG - Intronic
1070306064 10:75239904-75239926 CGCTGTCGCCCGAGATCCCCCGG + Intergenic
1073414324 10:103368460-103368482 CCCTGCGGCCCCCGACCCTCCGG + Exonic
1076388026 10:130073227-130073249 TGCTGCCACCCAAGGCCTTCAGG + Intergenic
1076753822 10:132557720-132557742 CCCTGCAGCCCGAGACACTCGGG - Intronic
1078729890 11:13964379-13964401 CGCTTCCGTCCAAGGCTCTCTGG - Intronic
1083632742 11:64104150-64104172 CGCTGCCGCCCAAGACCCTCTGG - Exonic
1083794675 11:65008556-65008578 CGCTGCCGCCCACCACCCCCAGG + Intergenic
1084258763 11:67960353-67960375 GGCTGGCGCTGAAGACCCTCTGG + Intergenic
1087039421 11:93784385-93784407 CGGTGCCTCAGAAGACCCTCGGG - Exonic
1091399272 12:172636-172658 CGTTGCTGGCCAAGCCCCTCTGG + Intronic
1091402404 12:188993-189015 CTCTGCTGCCCCAGACCCCCTGG - Intergenic
1092314526 12:7396377-7396399 TGCTGCCGCCCACCAGCCTCAGG + Exonic
1095417271 12:41990564-41990586 AGCTGCCCTCCATGACCCTCTGG + Intergenic
1102012911 12:109629727-109629749 AGCTGTCACCCAGGACCCTCTGG - Intergenic
1114630644 14:24157464-24157486 CGCTGCAACTCAAGGCCCTCAGG - Intronic
1116958182 14:50944627-50944649 CACTGCGGCCCCAGAGCCTCGGG - Exonic
1117478193 14:56118356-56118378 CGCCGCCGCCGAAGCCCCGCGGG - Exonic
1119411156 14:74431351-74431373 CCCTGCCTCCCCAGACCCACAGG - Intergenic
1121018157 14:90561221-90561243 AGCTGCCGGCCCAGCCCCTCGGG - Intronic
1122112411 14:99511656-99511678 CACTGCCTCCCAAGGCACTCTGG + Exonic
1123464627 15:20506151-20506173 CGCAGCCTCCCAAGAGCCGCTGG + Intergenic
1123653489 15:22494890-22494912 CGCAGCCTCCCAAGAGCCGCTGG - Intergenic
1123743910 15:23303753-23303775 CGCAGCCTCCCAAGAGCCGCTGG - Intergenic
1124275352 15:28322118-28322140 CGCAGCCTCCCAAGAGCCGCTGG + Exonic
1124307352 15:28589483-28589505 CGCAGCCTCCCAAGAGCCGCTGG - Intergenic
1125201094 15:37101222-37101244 CGCGGCCCCCAAAGACTCTCGGG - Intronic
1125719767 15:41839667-41839689 CCCTGCCACCCAAGACCAGCCGG + Intronic
1127809992 15:62557328-62557350 TGCGGCCTCCAAAGACCCTCTGG - Intronic
1140124326 16:72107423-72107445 TGCTGCTGCTCAAGTCCCTCGGG + Exonic
1142517010 17:438684-438706 CACTGCTGCCCAAGAACCTCTGG - Intergenic
1143166414 17:4899325-4899347 CGCCGCCGCCCGAGGCCCCCCGG - Exonic
1143509200 17:7386253-7386275 AGCAGCCTCCCAAGCCCCTCTGG - Intronic
1143516163 17:7420286-7420308 CGTTCACTCCCAAGACCCTCAGG + Intergenic
1144781229 17:17809636-17809658 CGCCGCCGCCGAAAACCCGCAGG + Intronic
1145274068 17:21419671-21419693 CCCCGCCCCCCAGGACCCTCTGG - Exonic
1145802090 17:27694147-27694169 CACTGCAGCCCATCACCCTCTGG - Intergenic
1147149992 17:38509120-38509142 TGCTGCCGCCCATGGCCTTCTGG - Intronic
1147150393 17:38510668-38510690 CGCTGTCGCCCGAGACCCGGCGG + Exonic
1148905638 17:50910163-50910185 TGCTGCAGCCCACGTCCCTCTGG + Intergenic
1150435833 17:65153478-65153500 CGCTGGTGACCAGGACCCTCTGG - Exonic
1152386870 17:79980003-79980025 CGGTGCCTCCCCAGACCCTCTGG + Intronic
1152740049 17:82014839-82014861 AGCTGCCGCCCAGGACACTGGGG - Intronic
1160345226 18:78127171-78127193 CGCCGCTGCCCAAGCCCCACTGG - Intergenic
1161233323 19:3186349-3186371 CCCTGCCGCCCTGGACCCCCGGG + Intronic
1161470352 19:4453987-4454009 CGCTGCCGCCCTAGCCCGGCTGG - Exonic
1161473504 19:4472720-4472742 CCCTGCAGCCCAGGACCCCCAGG - Intronic
1161766910 19:6213304-6213326 CTCTGCCGGGCAGGACCCTCAGG + Intronic
1164617158 19:29674117-29674139 CGCTGCAGGCCAAGAACCGCTGG + Exonic
1165129646 19:33623542-33623564 CACCGCCGCCCAAGGCCCCCAGG + Intronic
1202710971 1_KI270714v1_random:19197-19219 CGCCGCCGCCCACGGCCCGCTGG - Intergenic
926914466 2:17878936-17878958 CTCTGCGGCCGTAGACCCTCGGG - Intronic
927812333 2:26187088-26187110 AGCCCCAGCCCAAGACCCTCCGG - Intronic
930157968 2:48124972-48124994 CGCTGCTGCCCCAGGCCCACAGG - Intergenic
931282225 2:60804520-60804542 CCCTGCTGCCTAAGCCCCTCCGG - Intergenic
942195035 2:173508728-173508750 CTCTTCCCCCAAAGACCCTCAGG + Intergenic
948208658 2:236176991-236177013 AGCTGCAGCCCAGGACCCTCAGG - Intergenic
1170586189 20:17735825-17735847 TGCTGCCCCCCACCACCCTCTGG + Exonic
1172411186 20:34724339-34724361 CGATGCCTCACAAGAGCCTCTGG - Intronic
1174386443 20:50190706-50190728 CGCGGCCGCCCGAGACCCCCGGG - Intergenic
1175388762 20:58613580-58613602 CGCGGCCGGCCAACACCATCAGG + Intergenic
1179657351 21:42853498-42853520 AGCTGCCGCCCCACACCCCCAGG + Intronic
1181877922 22:25954642-25954664 CCCTTGCCCCCAAGACCCTCTGG - Intronic
1185278655 22:49960734-49960756 CGCCGCGGCCCAAAACCCCCGGG + Exonic
949435510 3:4024971-4024993 TGCTGCCACCCAAGACCATGAGG + Intronic
950525247 3:13519353-13519375 TGCTGCCGCCCGATACCCACAGG + Intergenic
953404666 3:42654486-42654508 AGCTGCGGCCCCAGAGCCTCGGG - Intronic
955212841 3:56958258-56958280 TCCTGCAGCCCAAGACCCTCAGG + Intronic
956979053 3:74614877-74614899 CGCCGCCGCCCAGGGCCCTGCGG - Intergenic
965404145 3:168249576-168249598 CCCTCCCGCCCCAGCCCCTCCGG - Intergenic
968540899 4:1167887-1167909 AGCTGCCGCTCAAGTCCCTGTGG + Intronic
968578912 4:1380647-1380669 CACAGCTGCCCAAGACCTTCCGG + Intronic
969586749 4:8098203-8098225 CCCTGCAGCCCCAGCCCCTCTGG + Intronic
975420518 4:74158365-74158387 CGCGGCCGCCCACGAGCCTTGGG - Intronic
989201538 5:38769191-38769213 CCCTGCAGCCCAAGAACATCTGG + Intergenic
994631867 5:102296617-102296639 CGCCTCCGCCCAAGCCCCTGCGG + Intergenic
998159166 5:139803413-139803435 TGCTGCCTCCCAAAACCTTCTGG - Intronic
1001826812 5:174751755-174751777 CGCGGCCGCCCAAGAGCCCCGGG - Intergenic
1004336931 6:14772247-14772269 TGCTTCCGCTCAAGACCTTCAGG + Intergenic
1006399022 6:33805226-33805248 CACTGCCCACCCAGACCCTCGGG - Intergenic
1016994912 6:149954733-149954755 CGCTGCCGGCCGATACCCCCGGG - Intergenic
1017003697 6:150014703-150014725 CGCTGCCGGCCGATACCCCCGGG + Intergenic
1018650320 6:165987125-165987147 GGCTGCCGCGCCAGACCCGCAGG - Intergenic
1019817805 7:3213937-3213959 CGCTGCCTCCCAGGAGCCTGGGG + Intergenic
1020016892 7:4836438-4836460 CGCTGCCGCCCAGGGCCCCGAGG - Exonic
1023773693 7:43583344-43583366 CGCCGCCGCCCCAGGCCCGCGGG + Exonic
1028987741 7:97021358-97021380 CGCCGCCGCCGAGGACACTCGGG - Intronic
1029110885 7:98212481-98212503 CGCAGGCGGCCAGGACCCTCCGG + Exonic
1035018539 7:155787325-155787347 CGCTGCCTCCTGGGACCCTCGGG - Intergenic
1038067712 8:23980527-23980549 GGCTGCAGCCCAAGTCCCTTGGG - Intergenic
1039991369 8:42490767-42490789 CGCTGCCTTCCAAGTCCCTAGGG + Intronic
1041514959 8:58690267-58690289 AGCTGCCACCCAGGACACTCGGG - Intergenic
1042040214 8:64581378-64581400 CGCCGCCGCCCAGGCCCCCCGGG - Exonic
1047970847 8:130083164-130083186 GGCTGCTGCCCAATACCCACAGG + Intronic
1049151206 8:141036623-141036645 CGCTGCCGCCAAAGGCTCTGGGG + Intergenic
1049577679 8:143397219-143397241 CCCTGCCGCCCAGCACCCTGTGG - Intergenic
1049622389 8:143604577-143604599 GGCTTCCGCCCAACAGCCTCTGG - Exonic
1050744152 9:8857774-8857796 CGCCGCCGCCGAAGCCCCCCTGG + Intronic
1053826491 9:42030362-42030384 CGCTGTCTCCCATGACACTCAGG + Intronic
1054604069 9:67157035-67157057 CGCTGTCTCCCATGACACTCAGG - Intergenic
1057311510 9:93946071-93946093 CGCTGCCGCCCCAGCCCCCGCGG - Intergenic
1060583452 9:124771341-124771363 CGCTGCCGCGCAAGGCCCTGCGG + Intergenic
1060596944 9:124854113-124854135 CACTGCCCCCCAAGAGCCTGGGG - Intronic
1060722176 9:125986572-125986594 CGATGGCTCCCAAGGCCCTCAGG - Intergenic
1062341584 9:136095802-136095824 CGCAGCCGCCCTGGACGCTCAGG + Intergenic
1188783185 X:34310316-34310338 TGCTGCTGCCCAAAACCCCCGGG - Intergenic
1197220230 X:123905180-123905202 CACTGCCTCCCAGGACCCTTGGG + Intronic
1199985449 X:152946885-152946907 CGGTGGCTCCCAAGGCCCTCAGG - Intronic
1200173523 X:154096821-154096843 CTCTGGCGCCGAAGAGCCTCGGG + Intronic