ID: 1083633402

View in Genome Browser
Species Human (GRCh38)
Location 11:64107346-64107368
Sequence AACCATTCAAGGCCAGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 494
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 455}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083633402 Original CRISPR AACCATTCAAGGCCAGGAGG GGG (reversed) Intronic
900167917 1:1251438-1251460 AATCACTCGAGTCCAGGAGGTGG - Intergenic
900735488 1:4297129-4297151 AATCAAACAAAGCCAGGAGGGGG + Intergenic
901149986 1:7094977-7094999 ACCCAGTCAAGGCCTGCAGGAGG - Intronic
901192179 1:7419240-7419262 AATCATTTAAACCCAGGAGGTGG - Intronic
901814855 1:11788200-11788222 GACCCTTCAGGGCCAGAAGGAGG - Exonic
901862486 1:12083598-12083620 AATCATTTAAGCCCAGGAGGTGG + Intronic
902367668 1:15987856-15987878 AATCACTCAAATCCAGGAGGCGG + Intergenic
902724039 1:18323506-18323528 CACCCTTCAAGGTCAGCAGGAGG + Intronic
903100737 1:21026848-21026870 AATCATTTAAACCCAGGAGGCGG + Intronic
903197411 1:21701277-21701299 AATCATTTAAACCCAGGAGGCGG + Intronic
903250023 1:22046415-22046437 AATCATTTGAGCCCAGGAGGTGG - Intergenic
903502804 1:23810938-23810960 TACAATTCAGTGCCAGGAGGAGG + Intronic
903543498 1:24109823-24109845 GTCCATTCAAGGCCAGGCCGTGG + Intronic
903874137 1:26460958-26460980 AATCGTTCAAACCCAGGAGGGGG - Intronic
903915262 1:26759287-26759309 AATCACTTAAGCCCAGGAGGAGG - Intronic
904220849 1:28967690-28967712 GATCATTTAAGCCCAGGAGGTGG - Intronic
904301052 1:29555288-29555310 AACCCTCCCAGGTCAGGAGGTGG - Intergenic
905080316 1:35313473-35313495 AATCATTTGAGCCCAGGAGGTGG - Intronic
905215678 1:36405884-36405906 AATCATTTAAGTCCAGGAGTTGG - Intergenic
905299275 1:36975379-36975401 AATCACTTAAGCCCAGGAGGTGG - Intronic
905701036 1:40014634-40014656 AAACACTTAAGCCCAGGAGGCGG - Intergenic
906013898 1:42555771-42555793 AATCACTTAAGCCCAGGAGGTGG - Intronic
906024253 1:42659328-42659350 AATCATTCAAGGCCAGCAGGTGG - Intronic
906067372 1:42991775-42991797 AATCATTTAAACCCAGGAGGCGG - Intergenic
907149645 1:52271924-52271946 AATCACTCAAGCCCAGGAGGCGG - Intronic
907698400 1:56757854-56757876 GACCGTTTAAGCCCAGGAGGTGG - Intronic
908369416 1:63466969-63466991 AATCATTTGAGCCCAGGAGGTGG - Intronic
909019798 1:70418334-70418356 AACCATTTGAACCCAGGAGGCGG - Intronic
909121645 1:71611041-71611063 TACCATTCAAAGGCTGGAGGCGG + Exonic
909337149 1:74488431-74488453 AAACTTTCACTGCCAGGAGGTGG - Intronic
909921314 1:81383865-81383887 AATCACTCAAACCCAGGAGGCGG + Intronic
911159930 1:94673812-94673834 AACCACTTAAACCCAGGAGGTGG + Intergenic
912313221 1:108643728-108643750 AGACGTTCAAGGCCAGAAGGTGG - Intronic
912435967 1:109661254-109661276 ATGCCTTGAAGGCCAGGAGGTGG + Exonic
912919922 1:113856098-113856120 AATCATTTAAGCCCTGGAGGTGG - Intronic
915328806 1:155096387-155096409 AACCACTTCAGCCCAGGAGGTGG - Intergenic
915395801 1:155583090-155583112 AATCATTTGAGGCCAGGAGTTGG - Intergenic
915413188 1:155719320-155719342 AATCATTTAAACCCAGGAGGTGG - Intronic
915441106 1:155946034-155946056 AAGCTTGCCAGGCCAGGAGGGGG - Intergenic
915441537 1:155948406-155948428 AATCACTTAAGGCCAGGAGTTGG + Intronic
915454501 1:156030614-156030636 AATCAATCAAACCCAGGAGGTGG - Intergenic
916047315 1:161009854-161009876 AACCACTTGAGCCCAGGAGGTGG + Intronic
916666734 1:166974230-166974252 AACCATTCAAATCAAGGTGGAGG - Intronic
917343916 1:174008888-174008910 AATCACTCAAACCCAGGAGGCGG + Intronic
917707295 1:177647405-177647427 AAATATTCAAGGGCAGAAGGAGG + Intergenic
918343654 1:183587505-183587527 AATCGCTCAAGCCCAGGAGGTGG + Intronic
918848505 1:189650871-189650893 AATCATTTAAACCCAGGAGGTGG + Intergenic
919649441 1:200132094-200132116 AATCACTCAAACCCAGGAGGCGG - Intronic
920372511 1:205488273-205488295 AACCTTTGGTGGCCAGGAGGTGG + Intergenic
922098791 1:222465267-222465289 AAGCAGGCAAGGGCAGGAGGAGG + Intergenic
922744078 1:228034173-228034195 AATCACTTAAGCCCAGGAGGCGG + Intronic
922813909 1:228435569-228435591 TACCATTGAGGGGCAGGAGGGGG - Intergenic
923013333 1:230106360-230106382 ATTCATTCCAGGCCAGGAGGAGG - Intronic
1063184146 10:3635248-3635270 AATCATTCAGGGCCAGGAATAGG + Intergenic
1063875791 10:10476840-10476862 AAACATTAAAGGCCAGAATGGGG - Intergenic
1064072511 10:12242853-12242875 AACCACTTGAGCCCAGGAGGAGG + Intronic
1064178748 10:13097635-13097657 AATCACTCAAACCCAGGAGGTGG + Intronic
1064285169 10:13985383-13985405 AACCACCCAAGGCCAGTGGGAGG - Intronic
1065690570 10:28329096-28329118 ATCAATTGAAGGCAAGGAGGTGG - Intronic
1065940559 10:30560705-30560727 AATCATTTGAGCCCAGGAGGTGG - Intergenic
1066141359 10:32506628-32506650 GATCACTCAAGGCCAGGAGCTGG + Intronic
1066450093 10:35521039-35521061 AACCTTTGAAGGGCAAGAGGGGG - Intronic
1068500439 10:57835940-57835962 AACCATTGAGGGCCAGGAAGTGG + Intergenic
1068733587 10:60387071-60387093 AATCATTTGAAGCCAGGAGGTGG + Intronic
1069599075 10:69691883-69691905 AATCATTCAGACCCAGGAGGTGG - Intronic
1072547776 10:96453367-96453389 AAACATTTGAGCCCAGGAGGTGG + Intronic
1072697990 10:97618349-97618371 AATCATTTAAAACCAGGAGGCGG - Intronic
1074314929 10:112352603-112352625 GATCATTCAAGGCCAGGAGTTGG - Intergenic
1074655269 10:115580419-115580441 AAACATTACAGGCCAGAAGGGGG - Intronic
1074666862 10:115737571-115737593 ATCGAGCCAAGGCCAGGAGGAGG - Intronic
1076761285 10:132607082-132607104 AGCCATTCAAACCCAAGAGGAGG - Intronic
1077027041 11:445174-445196 AATCATTCGAACCCAGGAGGCGG - Intergenic
1077039367 11:512028-512050 AATCACTTGAGGCCAGGAGGCGG - Intergenic
1077090289 11:775309-775331 ACCCATTCACGTCCAGGAGAAGG + Intronic
1078736157 11:14023035-14023057 AACCATCCAAGGCTCTGAGGTGG + Intronic
1080051806 11:27865586-27865608 AATCACTTAAGCCCAGGAGGTGG + Intergenic
1080622791 11:34001019-34001041 AATCATTCAAATCCAGGAGGTGG + Intergenic
1080834608 11:35928640-35928662 AATCACTCAAACCCAGGAGGCGG + Intergenic
1083223608 11:61269530-61269552 AACCATTTAAGCCCGGGAGGTGG - Intronic
1083476331 11:62918054-62918076 AACCCCTCAAGGGCAGGAGTAGG - Intronic
1083633402 11:64107346-64107368 AACCATTCAAGGCCAGGAGGGGG - Intronic
1085457786 11:76675014-76675036 AACGAGCCAAGGCCAGGATGAGG + Intergenic
1085464761 11:76716116-76716138 AACCATGCTGGGCCAGGAGCTGG + Intergenic
1086611087 11:88757104-88757126 AAATATTCGAGGCCAGGAGCTGG + Intronic
1087183331 11:95160308-95160330 AACGCTTAAAGGCCAGGAAGAGG - Intergenic
1087632037 11:100661415-100661437 AATCACTTAAAGCCAGGAGGTGG - Intergenic
1087642750 11:100772921-100772943 AATCACTCAAACCCAGGAGGCGG - Intronic
1089025910 11:115269450-115269472 AACCATTCAAGGACAAAATGAGG + Intronic
1089997418 11:122921895-122921917 AACCGCTCGAGCCCAGGAGGCGG + Intronic
1090152065 11:124395175-124395197 AACCACTTGAGCCCAGGAGGTGG + Intergenic
1090211709 11:124925272-124925294 AAGCATTGAAGGCCATGAGATGG - Intronic
1090744393 11:129694784-129694806 AGCCAGTCCCGGCCAGGAGGTGG + Intergenic
1091551951 12:1542352-1542374 AATCATTCGAACCCAGGAGGTGG + Intronic
1091581221 12:1791301-1791323 AACCACTAAAGGACAGCAGGTGG - Intergenic
1091834464 12:3575930-3575952 AACCACTTGAGCCCAGGAGGCGG + Intronic
1092492878 12:8961997-8962019 AATTGTTTAAGGCCAGGAGGTGG + Intronic
1092612645 12:10188370-10188392 AATCATTTGAGCCCAGGAGGCGG + Intronic
1092947134 12:13467064-13467086 AATCACTCAAACCCAGGAGGTGG - Intergenic
1094817968 12:34205231-34205253 ATCCCTCCAAGGCCAGGAGGAGG + Intergenic
1095148052 12:38754396-38754418 AACCATTCAAGGTAGGCAGGTGG + Intronic
1096706430 12:53425003-53425025 AACTTCCCAAGGCCAGGAGGAGG - Intronic
1097164684 12:57077409-57077431 AATCATTTAAACCCAGGAGGCGG + Intronic
1097555580 12:61133499-61133521 GACAACTCAAAGCCAGGAGGGGG - Intergenic
1098254413 12:68602084-68602106 AACCCTTAAAGGACAGGAAGAGG + Intergenic
1099312285 12:81041814-81041836 AATCATTTAAACCCAGGAGGTGG + Intronic
1100203831 12:92327104-92327126 AATCACTTCAGGCCAGGAGGTGG - Intergenic
1100312914 12:93414072-93414094 AATCATTTGAAGCCAGGAGGCGG + Intronic
1100516099 12:95329441-95329463 AATCATTTAAGCCCAGGAGGTGG + Intergenic
1100542213 12:95568252-95568274 AATCAGTCAAACCCAGGAGGTGG - Intergenic
1101071486 12:101080545-101080567 TACCACTTCAGGCCAGGAGGAGG + Intronic
1101221556 12:102646671-102646693 AACCACTTGAAGCCAGGAGGCGG + Intergenic
1102923935 12:116812619-116812641 AACCGTTTAAACCCAGGAGGTGG - Intronic
1103310744 12:120005458-120005480 AATCATTTAAACCCAGGAGGTGG - Intronic
1103349249 12:120271884-120271906 AATCACTCAAACCCAGGAGGTGG + Intergenic
1103505224 12:121438518-121438540 ACCCATTCAAGGCCATGACCTGG + Intronic
1104193589 12:126508225-126508247 AATCATTTGAGCCCAGGAGGCGG + Intergenic
1104715439 12:131013123-131013145 AGATATTCAGGGCCAGGAGGAGG - Intronic
1104959700 12:132482814-132482836 CAGCATTCAAAGCCAGGAGTGGG + Intergenic
1105378483 13:19864676-19864698 AACCATTCCGGACCAGGAGACGG - Intergenic
1105381025 13:19887440-19887462 AATCATTCGAACCCAGGAGGCGG + Intergenic
1105388722 13:19957666-19957688 AACCATTGAGGACCAGGAGACGG + Intergenic
1105424831 13:20285190-20285212 GTCCACTCAAGTCCAGGAGGAGG - Intergenic
1105443322 13:20432929-20432951 AATCATTTAAGCCCAGGAAGTGG + Intronic
1106420802 13:29584198-29584220 AATCACTTAAGCCCAGGAGGTGG - Intronic
1106654306 13:31725939-31725961 AATCGTTCAAACCCAGGAGGTGG + Intergenic
1106800284 13:33249463-33249485 AATCATTCAAAGAAAGGAGGTGG - Intronic
1109534423 13:63698060-63698082 AATCACTTAAGCCCAGGAGGTGG + Intergenic
1112425061 13:99290636-99290658 AATCATTTAAACCCAGGAGGTGG + Intronic
1112461196 13:99605338-99605360 AATCACTCAAGCCTAGGAGGTGG + Intergenic
1112571889 13:100600890-100600912 AACTAGTCATGGGCAGGAGGTGG - Intergenic
1112933048 13:104764879-104764901 AACCACCAAAGGCCAGGATGGGG + Intergenic
1113105536 13:106768344-106768366 AATCGTTCAAACCCAGGAGGTGG - Intergenic
1114196766 14:20485065-20485087 AACCGCTCAAACCCAGGAGGCGG - Intergenic
1115338272 14:32263760-32263782 AACCATCCAAAGCCTGGAAGAGG + Intergenic
1116976195 14:51118933-51118955 AACTAGTAAAGGCCAGGAGCAGG + Intergenic
1117322267 14:54635336-54635358 AATCACTCAAACCCAGGAGGCGG + Intronic
1117372094 14:55088054-55088076 AACCACTTGAGCCCAGGAGGTGG - Intergenic
1117438804 14:55741823-55741845 AATCATTTAAACCCAGGAGGTGG - Intergenic
1119452660 14:74725391-74725413 AATCATTTGAGCCCAGGAGGCGG + Intronic
1119551477 14:75517083-75517105 AATCACTTAAGCCCAGGAGGCGG - Intergenic
1119712663 14:76834026-76834048 CACCATTCAATGCCAAGTGGGGG - Intronic
1120392494 14:83925932-83925954 AATCATTTGAGGCCAGGAGTTGG - Intergenic
1120940675 14:89946003-89946025 AATCATTTGAGCCCAGGAGGTGG - Intronic
1121176497 14:91894633-91894655 AATCACTCAAACCCAGGAGGCGG + Intronic
1121637719 14:95465161-95465183 AAGGATTAAAGGGCAGGAGGAGG + Intronic
1122302996 14:100742321-100742343 AATCACTCAAACCCAGGAGGTGG - Intergenic
1122516311 14:102311257-102311279 AATCATTCAAACCCAGGAGGCGG + Intergenic
1122569493 14:102685635-102685657 TACAATTCAAGGCCAGGTGCAGG - Intronic
1123135029 14:106019955-106019977 ACACATTCAAGTCCAGGGGGAGG - Intergenic
1123675790 15:22709609-22709631 AACCATCCAAACCCAAGAGGCGG - Intergenic
1124058667 15:26266800-26266822 AAATATTCAAGGACAAGAGGAGG + Intergenic
1124248446 15:28091867-28091889 AATCATTTAAATCCAGGAGGCGG + Intronic
1124318583 15:28693845-28693867 AACCACCCAAACCCAGGAGGCGG - Intergenic
1125562951 15:40652674-40652696 AATCATTCGAACCCAGGAGGTGG + Intronic
1125641796 15:41237231-41237253 AATCATTTGAAGCCAGGAGGCGG - Intronic
1126409754 15:48361033-48361055 AATCATTTGAGCCCAGGAGGCGG + Intergenic
1126772334 15:52070754-52070776 AGCCATGCAAGCGCAGGAGGGGG - Intergenic
1127027182 15:54819856-54819878 AATCACTGAAGCCCAGGAGGTGG - Intergenic
1128463201 15:67887067-67887089 AACCACTTGAGCCCAGGAGGTGG - Intergenic
1128556144 15:68633083-68633105 AACCCTTCAAGGGGAGGAGCTGG + Intronic
1128969389 15:72093798-72093820 AACCACTTGAAGCCAGGAGGCGG + Intronic
1129155722 15:73716257-73716279 AATCATTTGAGCCCAGGAGGTGG + Intergenic
1129193435 15:73951070-73951092 AGCCATTCTAGGGAAGGAGGAGG + Intronic
1129384265 15:75187159-75187181 AATCATTTGAAGCCAGGAGGTGG - Intergenic
1129422227 15:75437931-75437953 GATCATTTGAGGCCAGGAGGTGG + Intronic
1130870267 15:87965989-87966011 AATCACTTAAGCCCAGGAGGTGG + Intronic
1131313302 15:91310299-91310321 AATCACTCAAATCCAGGAGGAGG - Intergenic
1132012610 15:98289272-98289294 AATCATTTGAGCCCAGGAGGTGG + Intergenic
1132432785 15:101774447-101774469 AATCACTTGAGGCCAGGAGGTGG - Intergenic
1133273332 16:4622204-4622226 GATCATTCAAGGTCAGGAGTTGG - Intronic
1133467120 16:6038266-6038288 AATCATTTGAGTCCAGGAGGCGG - Intronic
1133558946 16:6932188-6932210 AATCACTCAAGCACAGGAGGTGG - Intronic
1133721778 16:8501070-8501092 AATCACTCAAACCCAGGAGGTGG + Intergenic
1133798341 16:9064727-9064749 AATCACTTAAGCCCAGGAGGTGG + Intergenic
1133941248 16:10310871-10310893 AACCACTCGAACCCAGGAGGTGG + Intergenic
1134063031 16:11210498-11210520 AACCCTGCAAGGCCAGGACAGGG + Intergenic
1134251620 16:12578197-12578219 AACCATGACAGGCCAGGAGAGGG + Intergenic
1134257014 16:12620949-12620971 AACCATTTGAGCCTAGGAGGCGG - Intergenic
1134473010 16:14544486-14544508 AATCACTTAAAGCCAGGAGGTGG + Intronic
1134586098 16:15412341-15412363 GATCACTCAAGCCCAGGAGGTGG + Intronic
1135109960 16:19682896-19682918 AATCAATCAAGGGCAGGATGGGG - Intronic
1136465326 16:30439171-30439193 AATCACTTAAGCCCAGGAGGCGG - Intergenic
1138210273 16:55157454-55157476 GATCATTCAAGCCCAGGAGTTGG + Intergenic
1138408049 16:56814617-56814639 AGCCATTCCAGGACAGGATGGGG - Intronic
1138436835 16:57005831-57005853 AATCATATAAGCCCAGGAGGTGG + Intronic
1139345743 16:66302472-66302494 AATCACTCAAGGCCAGAAGTTGG - Intergenic
1140039156 16:71394199-71394221 AATCACTCATGGCCAGCAGGTGG + Intergenic
1141183640 16:81771868-81771890 AATCATTTGAGCCCAGGAGGTGG - Intronic
1141767060 16:86065667-86065689 GATCACTCAAGGCCAGGAGTTGG - Intergenic
1142529214 17:567652-567674 CACCATGCATGGCTAGGAGGAGG + Intronic
1142877313 17:2859520-2859542 AATCACTCGAGCCCAGGAGGCGG - Intronic
1143333409 17:6154952-6154974 AAACATACATGGCCAGGACGAGG + Intergenic
1143420597 17:6788715-6788737 GATCATTTGAGGCCAGGAGGTGG - Intronic
1143772750 17:9179001-9179023 ACCCTTTCAAGCCCAGGAGGAGG + Intronic
1144528770 17:16015539-16015561 AAACTTTCAAGGAAAGGAGGAGG - Intronic
1144558029 17:16298938-16298960 AACCATTCGAACCCAGGAGATGG + Intronic
1144581163 17:16460383-16460405 GACCAGGCAAGGCCAGGAGGAGG - Intronic
1146015758 17:29232283-29232305 AATCACTCAAACCCAGGAGGCGG - Intergenic
1146295965 17:31650422-31650444 AATCACTCGAAGCCAGGAGGTGG + Intergenic
1146316711 17:31813011-31813033 AATCACTCAAACCCAGGAGGTGG + Intergenic
1146384140 17:32354395-32354417 AATCACTTAAGCCCAGGAGGCGG - Intronic
1146490940 17:33281737-33281759 AGCCATTCAAGGCAAAGAGGAGG - Intronic
1146743307 17:35305410-35305432 GACCATTGAAGGCCAGGAAGTGG + Intergenic
1147128411 17:38390006-38390028 GATCACTTAAGGCCAGGAGGCGG - Intronic
1147199084 17:38787678-38787700 AATCACTTGAGGCCAGGAGGTGG - Intronic
1147604801 17:41768473-41768495 AATCATTCGAACCCAGGAGGTGG + Intronic
1147701376 17:42397764-42397786 AACCCTTGAACCCCAGGAGGTGG - Intergenic
1147739790 17:42664944-42664966 GACCACTCGAGGCCAGGAGTTGG - Intronic
1147796411 17:43046666-43046688 AATCATTTAAACCCAGGAGGCGG + Intronic
1148004688 17:44417116-44417138 AATCATTTGAGCCCAGGAGGTGG - Intronic
1148199716 17:45741970-45741992 AACCAGACAAGGCCAGGTGGAGG - Intergenic
1148982057 17:51585663-51585685 AACATTTCAATGCCAGGTGGCGG + Intergenic
1149605312 17:57920716-57920738 AATCACTCAAACCCAGGAGGTGG - Intronic
1149735645 17:58991086-58991108 AATCATTTAAACCCAGGAGGCGG + Intronic
1149874046 17:60212838-60212860 AATCAGTCAAGCCCAGGAGGCGG - Intronic
1150055967 17:62016323-62016345 ACCCATTCAAGCCAATGAGGTGG - Intronic
1150087824 17:62290108-62290130 AATCAGTCAAGCCCAGGAGGCGG - Intergenic
1150243842 17:63658819-63658841 AATCATTTGAAGCCAGGAGGCGG - Intronic
1150287530 17:63962435-63962457 AGCCCACCAAGGCCAGGAGGAGG - Intronic
1150332360 17:64304470-64304492 AACCATTTGAACCCAGGAGGCGG + Intergenic
1151611097 17:75175717-75175739 AACCACTCGAACCCAGGAGGCGG - Intergenic
1151852474 17:76699104-76699126 AACCATTCAATGCCTTCAGGTGG + Intronic
1151869003 17:76823952-76823974 AACCATCCAAGAGCAGGAGCGGG - Intergenic
1151881165 17:76895567-76895589 CATCAGTCAAGGCCAGGAGCAGG - Intronic
1151971807 17:77461217-77461239 AATCACTCAAATCCAGGAGGCGG + Intronic
1152090954 17:78247523-78247545 GATCATTTAAGTCCAGGAGGTGG - Intergenic
1153295825 18:3545185-3545207 AATCAGTCAAACCCAGGAGGTGG + Intronic
1153867738 18:9288669-9288691 AATCATTCGAACCCAGGAGGCGG - Intergenic
1155018386 18:21871056-21871078 AAACATTCAAGGCCAGGCGCAGG + Intergenic
1155429121 18:25737223-25737245 AAATCTTCAAAGCCAGGAGGAGG + Intergenic
1157250682 18:46093450-46093472 AATCACTCAAACCCAGGAGGTGG + Intronic
1157886229 18:51369533-51369555 AAACATTTAAAGACAGGAGGAGG - Intergenic
1159663369 18:71126964-71126986 AATCACTTAAGCCCAGGAGGCGG - Intergenic
1160235527 18:77083058-77083080 AATCGTTCAAATCCAGGAGGTGG - Intronic
1160803639 19:981695-981717 AACCACTTGAAGCCAGGAGGCGG + Intergenic
1161859889 19:6790089-6790111 AATCACTTAAGCCCAGGAGGTGG + Intronic
1161928833 19:7322206-7322228 AATCATTTGAGCCCAGGAGGCGG - Intergenic
1161928874 19:7322401-7322423 AATCATTTGAGCCCAGGAGGCGG + Intergenic
1162131312 19:8527697-8527719 GATCACTCAAGCCCAGGAGGGGG - Intronic
1163100555 19:15093506-15093528 AACCATTTGAACCCAGGAGGTGG - Intergenic
1163804041 19:19385517-19385539 AGCCACTCAAGGCCATGCGGGGG - Intergenic
1164246782 19:23437130-23437152 TACCATTCAAGTCCAGCAGAGGG + Intergenic
1164296688 19:23916417-23916439 AACCGTTTGAGCCCAGGAGGCGG - Intronic
1164386781 19:27778127-27778149 AATCATTTAAACCCAGGAGGTGG - Intergenic
1165087099 19:33358042-33358064 AACCATTTGAACCCAGGAGGCGG - Intergenic
1165810745 19:38610290-38610312 AATCAATTAAGCCCAGGAGGTGG - Intronic
1166528573 19:43528571-43528593 GACCATTTGAGGCCAGGAGCTGG - Intronic
1166847959 19:45741622-45741644 AATCACTCTAGCCCAGGAGGTGG + Intronic
1168282180 19:55311743-55311765 ACCAATTCAAGGCCAGGTGCTGG + Intronic
925289511 2:2737983-2738005 CACCATTCTAGGCCTGGTGGAGG - Intergenic
926698853 2:15789228-15789250 CACCATTCTAGGCAGGGAGGTGG - Intergenic
926765946 2:16322842-16322864 GAGCATTCAAGGCCTGTAGGTGG - Intergenic
927193429 2:20532397-20532419 AAACTGTCAAGGCCAGAAGGTGG - Intergenic
927539613 2:23897041-23897063 AATCACTCAAACCCAGGAGGTGG + Intronic
927666349 2:25035625-25035647 ATCAATTCAAGGCCATGAAGTGG + Intergenic
927821840 2:26272994-26273016 AACCACTTAAACCCAGGAGGTGG + Intronic
928961258 2:36928563-36928585 AATCACTCAAACCCAGGAGGCGG + Intronic
929193426 2:39161817-39161839 AATCATTTGAGCCCAGGAGGCGG - Intergenic
929653557 2:43706657-43706679 AACAATTCATGGCCATGGGGAGG - Intronic
929782207 2:44964513-44964535 AATCATTCAAACCCAGGAGGTGG - Intergenic
929785853 2:44990613-44990635 GACCGTTCAAGCCCTGGAGGTGG + Intergenic
930793978 2:55368222-55368244 AACCATCCAAGGCCAGGGCTTGG - Intronic
932085462 2:68753796-68753818 AACATTTGAAGGTCAGGAGGAGG + Intronic
932231317 2:70086699-70086721 AACGACACAAGGGCAGGAGGTGG + Intergenic
932251339 2:70246797-70246819 AATCATTTAAACCCAGGAGGTGG + Intronic
933794614 2:85909568-85909590 AAGCATCCAAGGCCAGGCGGTGG + Intergenic
933895194 2:86804887-86804909 AATCATTTAAGCCCAGGAGGTGG - Intronic
935940431 2:108232364-108232386 AAACTTTCCAGGCCAGAAGGAGG + Intergenic
936436337 2:112509839-112509861 AAGAGTTCAAGACCAGGAGGAGG - Intronic
939674327 2:145053264-145053286 AACAATTCATGGCCAGAAGATGG - Intergenic
941837606 2:170042600-170042622 AACCACTTGAGCCCAGGAGGTGG + Intronic
942764664 2:179440843-179440865 AAAAATTTAAGGCCAGTAGGTGG - Intergenic
944082369 2:195802580-195802602 AATCACTCAAACCCAGGAGGTGG + Intronic
944541005 2:200753420-200753442 AACCACTTGAGCCCAGGAGGCGG + Intergenic
944634656 2:201663492-201663514 AACCACTCGAGGCCTGGAGTTGG + Intronic
945341928 2:208666840-208666862 AATCATTTGAAGCCAGGAGGCGG - Intronic
945691383 2:213041029-213041051 AACCACTTAAACCCAGGAGGCGG + Intronic
945834187 2:214819954-214819976 AATCATTTAAACCCAGGAGGCGG - Intergenic
946210310 2:218142551-218142573 GATCATTTAAGCCCAGGAGGTGG + Intergenic
946317681 2:218928538-218928560 AGCCATCCTAGGCCAGGAGATGG + Intergenic
946677755 2:222180423-222180445 AATCACTTAAGCCCAGGAGGCGG + Intergenic
947000188 2:225446092-225446114 AACCATTCGAACCCGGGAGGCGG + Intronic
947795430 2:232891140-232891162 AACCATGCACAGCCAGGAAGTGG - Intronic
1169883058 20:10368286-10368308 AATCATTTGAGCCCAGGAGGCGG - Intergenic
1170395595 20:15921981-15922003 AACCAATGACGGACAGGAGGGGG - Intronic
1170406930 20:16047850-16047872 AACCATTCAACGTAAGGAGTTGG + Intronic
1170958594 20:21004128-21004150 AACCAGTGAAGGACAGGAGATGG - Intergenic
1171419176 20:25006453-25006475 AACCTGTGAAGCCCAGGAGGTGG - Exonic
1171471124 20:25372278-25372300 GATCACTTAAGGCCAGGAGGTGG - Intronic
1171507189 20:25647198-25647220 AACCACTTAAACCCAGGAGGTGG - Intergenic
1172514597 20:35524102-35524124 AACCATTTGAACCCAGGAGGCGG - Intronic
1173059297 20:39646320-39646342 AATCATTCAAGCTCAGGAGTTGG - Intergenic
1173062340 20:39674671-39674693 AACCCTTCAAAGCCAGGATAAGG + Intergenic
1173134537 20:40427742-40427764 AATCACTTAAGCCCAGGAGGTGG - Intergenic
1173462903 20:43258272-43258294 AATCACTCAAACCCAGGAGGCGG + Intergenic
1173904264 20:46614339-46614361 AACCAATGATGGCCAGGAGTTGG - Intronic
1174123622 20:48286779-48286801 AACCCTTGCAGGCCATGAGGTGG - Intergenic
1174331771 20:49825553-49825575 AACCACTTGAGTCCAGGAGGCGG + Intronic
1174619595 20:51863993-51864015 AACCACTTGAGCCCAGGAGGCGG - Intergenic
1175169486 20:57070161-57070183 AGCCCATCAATGCCAGGAGGGGG - Intergenic
1176903105 21:14467408-14467430 AAACATTTAAGACCAGGAAGAGG + Intergenic
1176962563 21:15175722-15175744 AATCATTTAAACCCAGGAGGCGG + Intergenic
1178835171 21:36091160-36091182 AATCATTTAAACCCAGGAGGCGG + Intergenic
1178974114 21:37207491-37207513 AACCAGGCAAGGCCAGGCGGTGG - Intergenic
1180029603 21:45197089-45197111 AATCACTCAAACCCAGGAGGCGG + Intronic
1180870795 22:19145932-19145954 AATCACTCAAACCCAGGAGGTGG + Intergenic
1181890908 22:26062756-26062778 AAGGATTCAAAGCCAGCAGGGGG - Intergenic
1183257707 22:36773269-36773291 AATCATTTAAACCCAGGAGGTGG + Intronic
1183500968 22:38178777-38178799 AATCACTCAAACCCAGGAGGCGG + Intronic
1184482750 22:44757723-44757745 AATCATTTGAGCCCAGGAGGCGG - Intronic
1184917903 22:47585627-47585649 GACAATTCAAAGCCATGAGGGGG - Intergenic
1185354473 22:50359084-50359106 AATCACTCAAACCCAGGAGGTGG - Intronic
949358461 3:3206422-3206444 AACCATTCATGGACAAGGGGAGG + Intergenic
949477776 3:4465390-4465412 AATCATTCGAACCCAGGAGGTGG + Intronic
949549457 3:5100213-5100235 AATCACTCAAACCCAGGAGGCGG + Intergenic
950078223 3:10202534-10202556 AATCACTCAAACCCAGGAGGCGG + Intronic
950278316 3:11682489-11682511 AATCACTCGAGCCCAGGAGGTGG + Intronic
950370687 3:12527538-12527560 AAAAGTTCAAGGCCGGGAGGCGG - Intronic
952770147 3:36992741-36992763 GACCCTTCAAGGCCAAGAGGCGG + Exonic
953603343 3:44389201-44389223 AATCACTCAAACCCAGGAGGCGG + Intronic
953823972 3:46233988-46234010 ATCCATTGCAGCCCAGGAGGTGG - Intronic
953839396 3:46377010-46377032 AACCAAGGAAGGGCAGGAGGGGG + Intergenic
954056231 3:48028203-48028225 AATCACTCAAACCCAGGAGGCGG + Intronic
954418750 3:50407443-50407465 AAGCCCTCAAGGCCAGGGGGTGG + Intronic
954571494 3:51644749-51644771 ATCCCTCCAAGGCCAGGATGCGG + Intronic
955010783 3:55012460-55012482 AACAGGTCAAGGCCAGGATGAGG - Intronic
955099668 3:55834793-55834815 AACCCTTCAAAACCAGGAGCTGG + Intronic
955297946 3:57750466-57750488 AAGCATACAAGGCTGGGAGGAGG - Intergenic
956016856 3:64892962-64892984 AAGCATTCCCTGCCAGGAGGAGG - Intergenic
956674364 3:71720721-71720743 AACCATGCCAGTCCAGGTGGGGG + Intronic
957916411 3:86693418-86693440 GACCATTAAAGGCCAGGAAGCGG - Intergenic
958417446 3:93891512-93891534 AATCATTTAAACCCAGGAGGCGG - Intronic
959824526 3:110777825-110777847 AACCATTTGAACCCAGGAGGTGG + Intergenic
961055368 3:123783897-123783919 ATCAAGTCAAGGCCAGGAAGAGG - Intronic
962597261 3:136959273-136959295 TAACAATAAAGGCCAGGAGGAGG - Intronic
963215856 3:142746769-142746791 AACTGTTCATGGCCGGGAGGCGG + Intronic
964583417 3:158266848-158266870 AATCATTTGAGCCCAGGAGGCGG - Intronic
965700523 3:171456159-171456181 AGGCATTCAAGGCCAGGAGTTGG - Intronic
966548164 3:181174585-181174607 TACCATTGAAGGCCATGAGCAGG + Intergenic
967736294 3:192956469-192956491 AATCACTTAAGCCCAGGAGGCGG - Intergenic
968694241 4:2014121-2014143 GATCACTCAAGGCCAGGAGTTGG - Intronic
969528789 4:7718114-7718136 CAGCATTCAAGGCGAGGCGGTGG + Exonic
970338906 4:15083937-15083959 AATCATTTGAGCCCAGGAGGTGG + Intergenic
971366608 4:25982784-25982806 AACCATTTGAACCCAGGAGGTGG - Intergenic
971727721 4:30335465-30335487 AATCACTCAAAGCCAGGAGGTGG + Intergenic
972002400 4:34055470-34055492 AATCACTCAAACCCAGGAGGTGG - Intergenic
973260561 4:48159477-48159499 AACCACTTAAACCCAGGAGGTGG - Intronic
973299855 4:48569391-48569413 AATCACTCAAACCCAGGAGGTGG - Intronic
974969147 4:68803508-68803530 AACCATTGAGGGCCAGGAAGTGG + Intergenic
975000752 4:69221775-69221797 GACCATTGAGGGCCAGGAAGTGG - Intergenic
975004700 4:69270494-69270516 GACCATTGAGGGCCAGGAAGTGG + Intergenic
975013120 4:69379474-69379496 GACCATTGAGGGCCAGGAAGTGG + Intronic
975683013 4:76895797-76895819 AGCCATTCACGGCCACCAGGGGG - Exonic
976625713 4:87179551-87179573 AATCATTTGAGGCCAGGAGGTGG + Intronic
977234840 4:94495681-94495703 AACCATTCCAGGGAGGGAGGAGG + Intronic
978266678 4:106835324-106835346 AACCACTTAAGCCTAGGAGGTGG - Intergenic
979005426 4:115289011-115289033 ATGCATTCAAGACCAGGAGCTGG + Intergenic
979671149 4:123361244-123361266 AATCATTTAAACCCAGGAGGCGG + Intergenic
980380896 4:132014681-132014703 AACCACTTAAACCCAGGAGGCGG - Intergenic
981729453 4:147882374-147882396 AACCATTTGAACCCAGGAGGCGG + Intronic
982490927 4:156028732-156028754 GATCACTCAAGGCCAGGAGCTGG + Intergenic
982759957 4:159269870-159269892 AACCGTTCACTGCCAGGAGGAGG + Intronic
982765896 4:159347997-159348019 AATCACTCGAGGCCAGGAGTTGG + Intronic
983234996 4:165169531-165169553 AATCACTTAAGCCCAGGAGGCGG - Intronic
984590096 4:181607499-181607521 AACCGTTTGAAGCCAGGAGGTGG - Intergenic
984706271 4:182849343-182849365 AACCTGTCAAGGCTTGGAGGTGG - Intergenic
984868119 4:184300336-184300358 AACCACCCAAACCCAGGAGGCGG + Intergenic
984873240 4:184345717-184345739 AAGCATTGAAGGTCAGGAAGAGG + Intergenic
984897071 4:184550229-184550251 AACCATTTGAGCCCAGGAGGTGG + Intergenic
984922837 4:184780914-184780936 AACAATTCAAACTCAGGAGGAGG + Intronic
985655448 5:1129362-1129384 AGCCACCCAAGGCAAGGAGGTGG + Intergenic
986584140 5:9297350-9297372 AACCTCTCAAGGCCTGCAGGTGG + Intronic
986821609 5:11473332-11473354 GAACATTCAATGCCAGGAGTGGG - Intronic
989325236 5:40185909-40185931 AATCGTTTGAGGCCAGGAGGTGG - Intergenic
990709740 5:58566956-58566978 TAACACTCAAAGCCAGGAGGGGG - Intergenic
993580610 5:89655432-89655454 AAACATTGGAGGCCAGGAGAGGG + Intergenic
993993259 5:94686615-94686637 AAACATTTGAAGCCAGGAGGAGG - Exonic
994701068 5:103136056-103136078 AATCACTCAAATCCAGGAGGTGG - Intronic
996876502 5:128246228-128246250 AACCACCAGAGGCCAGGAGGGGG + Intergenic
997094254 5:130892943-130892965 AATCACTCAAGGTCAGGAGTTGG + Intergenic
997481374 5:134187280-134187302 AATCACTCAAACCCAGGAGGCGG + Intronic
998948700 5:147369262-147369284 AACCATGAAGTGCCAGGAGGTGG - Intronic
999438709 5:151584447-151584469 AGCAAGTCAAGGCCAGGAGATGG + Intergenic
1000319533 5:160123157-160123179 ACCAATTCCATGCCAGGAGGAGG - Intergenic
1001558158 5:172650286-172650308 GTCCATTCAAGGGCAGGAGATGG + Intronic
1001634553 5:173200331-173200353 AGCCATCTAAGACCAGGAGGTGG + Intergenic
1003056290 6:2823963-2823985 CACCATTCAGGGCCAGGAACAGG - Intergenic
1004584920 6:16989971-16989993 AACCATATCAGGGCAGGAGGTGG - Intergenic
1004666974 6:17757372-17757394 AATCATTCAAACCCGGGAGGTGG - Intergenic
1004734083 6:18387396-18387418 TGCCAGTCAAGGCTAGGAGGCGG + Exonic
1005356514 6:24989380-24989402 AATCACTCAAACCCAGGAGGCGG - Intronic
1005412666 6:25566724-25566746 TATAATTCAAAGCCAGGAGGAGG - Intronic
1005472583 6:26176256-26176278 AATCACTCAAGGTCAGGAGTTGG - Intergenic
1005559937 6:27029580-27029602 AATCATTTGAGCCCAGGAGGCGG - Intergenic
1006000604 6:30962163-30962185 AATCACTCAAACCCAGGAGGCGG + Intergenic
1006954869 6:37859956-37859978 AATCACTCAAACCCAGGAGGTGG - Intronic
1007232532 6:40358499-40358521 AAAGATTGAAGCCCAGGAGGTGG - Intergenic
1007489046 6:42203712-42203734 GATCATTTAAGCCCAGGAGGCGG + Intergenic
1007957961 6:45934267-45934289 AACCAACAAAGGCCAAGAGGAGG - Intronic
1008168215 6:48167274-48167296 AACCATTCATGCCAGGGAGGAGG + Intergenic
1008862913 6:56172342-56172364 CACCATTGCAGGCCAGGAGTGGG + Intronic
1010402008 6:75456644-75456666 AATCATTTGAGCCCAGGAGGGGG - Intronic
1011275647 6:85628997-85629019 AGACAATAAAGGCCAGGAGGAGG - Intronic
1013987971 6:116219447-116219469 AACAATTCAATGACAGGAGGAGG + Intronic
1014228801 6:118878967-118878989 AATCATTTAAGCCCAAGAGGTGG + Intronic
1015262515 6:131254638-131254660 AAGTATTCAAGGACAGGATGGGG + Intronic
1017080443 6:150663638-150663660 AATCATTCGAACCCAGGAGGTGG - Intronic
1018238440 6:161749089-161749111 AAGGATTCAGGGCCGGGAGGCGG + Intronic
1019015633 6:168877867-168877889 AACCTTTTAAGGGCAGGCGGTGG + Intergenic
1019293269 7:260828-260850 AACCAGGCATGGCCAGGAGTCGG + Intergenic
1020028265 7:4914842-4914864 AATCATTCAAACCCGGGAGGTGG + Intronic
1020187861 7:5972448-5972470 AACCATTCAAGGCCAGTAACTGG + Intergenic
1020295056 7:6752322-6752344 AACCATTCAAGGCCAGTAACTGG - Intergenic
1021592170 7:22275094-22275116 AGCCATACAAGGCGGGGAGGTGG - Intronic
1021636509 7:22699423-22699445 AACCATTTGAACCCAGGAGGCGG - Intergenic
1021688506 7:23210704-23210726 AAATATGCAAGGCCAGGAGGTGG - Intergenic
1022386742 7:29906837-29906859 AAACTTTGAAGGCCAGAAGGTGG + Intronic
1022823358 7:33983178-33983200 AAACATTTAAGTCCAGGATGAGG - Intronic
1024173664 7:46815593-46815615 AATCACTCAAACCCAGGAGGCGG + Intergenic
1024622356 7:51172873-51172895 AATCACTCAAACCCAGGAGGTGG - Intronic
1025004423 7:55343522-55343544 TTCCAAGCAAGGCCAGGAGGCGG + Intergenic
1025056290 7:55767983-55768005 AATCAGTCAAACCCAGGAGGTGG + Intergenic
1025114133 7:56243281-56243303 AATCATTTGAAGCCAGGAGGTGG + Intergenic
1025734586 7:64135829-64135851 AATCATTTCAGCCCAGGAGGCGG - Intronic
1026225435 7:68436193-68436215 GATCATTCAAGTCCAGGAGTTGG - Intergenic
1027156848 7:75774531-75774553 AATCATTCGAACCCAGGAGGTGG - Intronic
1027669629 7:81079459-81079481 AATCACTCAAACCCAGGAGGTGG + Intergenic
1027927410 7:84483955-84483977 AACCACTTAAACCCAGGAGGCGG + Intronic
1028180943 7:87723998-87724020 AACCATTTGAGCCCAGGAGTTGG + Intronic
1028762142 7:94509008-94509030 AACCATTTGAACCCAGGAGGGGG + Intergenic
1029661774 7:101967098-101967120 AATCATTCAAACCCGGGAGGTGG - Intronic
1030668514 7:112308428-112308450 AACCACTTGAGCCCAGGAGGTGG + Intronic
1031044716 7:116875000-116875022 AATCACTCAAGCCCAGGAAGTGG + Intronic
1031947004 7:127852722-127852744 AATCACTCAAACCCAGGAGGCGG + Intronic
1033104181 7:138504845-138504867 AAGCACTCAAACCCAGGAGGAGG - Intronic
1033561984 7:142541052-142541074 AACCACTTAAGCCCAGGAAGCGG + Intergenic
1034234919 7:149559110-149559132 AATCACTCAAACCCAGGAGGCGG + Intergenic
1036490749 8:9223163-9223185 CACCATGCCCGGCCAGGAGGTGG + Intergenic
1036526858 8:9542950-9542972 AACCATTTGAACCCAGGAGGTGG - Intergenic
1037900445 8:22685078-22685100 AGCCAATCAGGGCCAGGAGAAGG + Intergenic
1038831459 8:31065963-31065985 AACCACTTAAACCCAGGAGGTGG - Intronic
1038901142 8:31845018-31845040 AATCATTCAAACCCGGGAGGCGG + Intronic
1039354030 8:36795415-36795437 TCCCCTTCAAGGCCAGGAAGTGG + Intronic
1039621687 8:39002922-39002944 AACCACTTTAGCCCAGGAGGGGG - Intronic
1040020340 8:42735449-42735471 AACCACTTAAACCCAGGAGGTGG + Intronic
1040361816 8:46672861-46672883 AATCACTTAAGCCCAGGAGGTGG - Intergenic
1042289484 8:67154451-67154473 AATCACTTAAAGCCAGGAGGCGG - Intronic
1043615458 8:82119505-82119527 AATCACTTAAGCCCAGGAGGTGG - Intergenic
1045486577 8:102636241-102636263 AATCACTTAAGCCCAGGAGGTGG + Intergenic
1045564011 8:103295339-103295361 AACCATTTGAACCCAGGAGGCGG + Intergenic
1045795923 8:106044015-106044037 AACCAATGAAGGACAGGAGCTGG + Intergenic
1046144969 8:110146929-110146951 AATCGTTCAAACCCAGGAGGTGG - Intergenic
1047364314 8:124198183-124198205 AGCCTTTCAAGGGCAGGAAGTGG - Intergenic
1049188216 8:141270582-141270604 AACCGCTTGAGGCCAGGAGGTGG + Intronic
1049235462 8:141510297-141510319 GACCACCCAGGGCCAGGAGGTGG - Intergenic
1051399330 9:16662647-16662669 AATCATTTAAACCCAGGAGGTGG + Intronic
1051896690 9:21995391-21995413 AACCATTCTACGCGAGGACGCGG - Intronic
1052617871 9:30865462-30865484 AATCACTTAAGACCAGGAGGTGG + Intergenic
1053076049 9:35135678-35135700 AAAAACTCAAGGCCAGGAGTTGG + Intergenic
1055875503 9:80937103-80937125 AATCATTTAAGACCAGGAGTTGG + Intergenic
1056010853 9:82328520-82328542 AACCATTTGAACCCAGGAGGCGG - Intergenic
1056943832 9:90977191-90977213 AAACATTCAGGGGCAGGGGGAGG + Intergenic
1057574453 9:96230788-96230810 AATCATTCGAACCCAGGAGGTGG + Intergenic
1059693718 9:116710644-116710666 AATCACTCGAGCCCAGGAGGTGG + Intronic
1060114917 9:120932353-120932375 AAACAGTGCAGGCCAGGAGGTGG - Intergenic
1061343013 9:129998425-129998447 AATCGCTCAAGCCCAGGAGGTGG + Intronic
1061760645 9:132848765-132848787 AACCATGCAGGGCCTGCAGGGGG + Intronic
1061958901 9:133978083-133978105 ACACATTCAAGACCAGGAGCGGG + Intronic
1062110947 9:134781869-134781891 AAACATTCAAGGCCCGGCTGGGG - Intronic
1062185071 9:135213804-135213826 AACCACACCCGGCCAGGAGGGGG - Intergenic
1185739163 X:2516779-2516801 AATCATTTGAGCCCAGGAGGCGG + Intergenic
1186316772 X:8379091-8379113 AAGCACTCAAACCCAGGAGGCGG + Intergenic
1188489748 X:30724965-30724987 AATCATTTAAACCCAGGAGGCGG - Intronic
1188531399 X:31145190-31145212 AACCATTTTAGGCCAAGAGAAGG - Intronic
1189206422 X:39243152-39243174 GCCCATTCACGGCCAGGAGCAGG - Intergenic
1189440563 X:41031985-41032007 GATCATTTAAGCCCAGGAGGCGG + Intergenic
1189539659 X:41972576-41972598 AAAACTTAAAGGCCAGGAGGAGG + Intergenic
1190261358 X:48799601-48799623 CACCATTCGTGGCCAGGATGGGG - Intergenic
1190513607 X:51199633-51199655 AAACCTTGCAGGCCAGGAGGAGG - Intergenic
1191829885 X:65405531-65405553 AATCACTCAAACCCAGGAGGCGG + Intronic
1192585731 X:72316908-72316930 GACCATTCAAGGCCAGGACAAGG - Intergenic
1194711951 X:97245987-97246009 AATCACTCAAACCCAGGAGGTGG - Intronic
1194810914 X:98386328-98386350 CACCATACAAGGGCAGGAGGAGG + Intergenic
1195494126 X:105509947-105509969 GATCATTTAAGGCCAGGAGTTGG + Intronic
1195567392 X:106358490-106358512 AACCACTTAAACCCAGGAGGTGG - Intergenic
1196424025 X:115551707-115551729 AATCATTTAAACCCAGGAGGCGG - Intergenic
1196675080 X:118411588-118411610 AACCATGGAAAGCCAGGAGAAGG - Intronic
1197347115 X:125337331-125337353 AACTACTCAAAGCGAGGAGGGGG + Intergenic
1198459771 X:136852062-136852084 AATCCCTCAAGCCCAGGAGGCGG + Intronic
1198469171 X:136930054-136930076 GATCATTTAAGCCCAGGAGGAGG - Intergenic
1198832919 X:140770063-140770085 ATCAATTCAAAGCCAGCAGGAGG + Intergenic
1199979816 X:152914828-152914850 CACCATGTAAGGCAAGGAGGCGG + Exonic
1201255775 Y:12106934-12106956 AATCATTCAAACCCAGGAGGTGG + Intergenic
1201392169 Y:13510629-13510651 AATCATTTGAGCCCAGGAGGTGG + Intergenic