ID: 1083636045

View in Genome Browser
Species Human (GRCh38)
Location 11:64121498-64121520
Sequence GTGACACAGCAGATATTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 243}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083636045_1083636052 -3 Left 1083636045 11:64121498-64121520 CCCCCAAATATCTGCTGTGTCAC 0: 1
1: 0
2: 2
3: 14
4: 243
Right 1083636052 11:64121518-64121540 CACAGCCCCTCAGCCAGGGAGGG 0: 1
1: 0
2: 5
3: 46
4: 430
1083636045_1083636053 -2 Left 1083636045 11:64121498-64121520 CCCCCAAATATCTGCTGTGTCAC 0: 1
1: 0
2: 2
3: 14
4: 243
Right 1083636053 11:64121519-64121541 ACAGCCCCTCAGCCAGGGAGGGG 0: 1
1: 0
2: 2
3: 36
4: 401
1083636045_1083636051 -4 Left 1083636045 11:64121498-64121520 CCCCCAAATATCTGCTGTGTCAC 0: 1
1: 0
2: 2
3: 14
4: 243
Right 1083636051 11:64121517-64121539 TCACAGCCCCTCAGCCAGGGAGG 0: 1
1: 0
2: 3
3: 74
4: 352
1083636045_1083636058 10 Left 1083636045 11:64121498-64121520 CCCCCAAATATCTGCTGTGTCAC 0: 1
1: 0
2: 2
3: 14
4: 243
Right 1083636058 11:64121531-64121553 CCAGGGAGGGGCCAGAAGCTAGG 0: 1
1: 0
2: 4
3: 77
4: 565
1083636045_1083636049 -8 Left 1083636045 11:64121498-64121520 CCCCCAAATATCTGCTGTGTCAC 0: 1
1: 0
2: 2
3: 14
4: 243
Right 1083636049 11:64121513-64121535 TGTGTCACAGCCCCTCAGCCAGG 0: 1
1: 0
2: 8
3: 240
4: 4452
1083636045_1083636050 -7 Left 1083636045 11:64121498-64121520 CCCCCAAATATCTGCTGTGTCAC 0: 1
1: 0
2: 2
3: 14
4: 243
Right 1083636050 11:64121514-64121536 GTGTCACAGCCCCTCAGCCAGGG 0: 1
1: 0
2: 2
3: 36
4: 647

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083636045 Original CRISPR GTGACACAGCAGATATTTGG GGG (reversed) Intronic
900376971 1:2359305-2359327 CTGACTCAGCAGACACTTGGTGG - Intronic
901668917 1:10842752-10842774 GTGACACAGAAGTTATTGGAGGG - Intergenic
902936896 1:19770967-19770989 GTCACACAGCTGATAAGTGGTGG - Intronic
903472827 1:23599056-23599078 GTCACTCAGCTGATAGTTGGTGG - Intronic
906182247 1:43832093-43832115 GAGTCACAGCAGATCTCTGGTGG + Intronic
906285581 1:44585591-44585613 CTTACTCAGCAGATATTTAGTGG + Intronic
908140182 1:61176168-61176190 GTGACACAGCAGTTAGCTGCAGG - Intronic
909560995 1:77009172-77009194 GTTACACAGGAGATATTCTGGGG - Intronic
909736931 1:78972811-78972833 GTGATACAAAAGACATTTGGTGG - Intronic
910905201 1:92169038-92169060 TTGTGACAGCAGATATTTTGAGG + Intronic
914254199 1:145947653-145947675 GTGACATAGCAGACATAAGGAGG + Exonic
916481328 1:165217350-165217372 ATGGCACAGCAGTTCTTTGGGGG - Intronic
916801855 1:168223332-168223354 GTTACATATCAGAAATTTGGTGG + Intergenic
916805794 1:168260220-168260242 GTTAAAAATCAGATATTTGGGGG + Intergenic
917556985 1:176100749-176100771 GTGACACCCCAGATAACTGGTGG - Intronic
918138433 1:181699463-181699485 GAGACAGAGCAGATCTATGGAGG + Intronic
918773963 1:188604611-188604633 GTGGCACAGCAGAAATTAGAAGG + Intergenic
919732226 1:200920653-200920675 GTGACTGGGCAGATCTTTGGTGG + Intergenic
920294245 1:204946198-204946220 GTCACACAGCAAATGGTTGGTGG + Intronic
921300926 1:213750808-213750830 GTGACACTGCAAACATTTGGGGG - Intergenic
921485178 1:215706601-215706623 GTGATTAAGCAGACATTTGGTGG + Intronic
922557429 1:226543138-226543160 TTGACCCAGCAGCTACTTGGAGG + Intergenic
923546045 1:234923920-234923942 GAGAGACAGAAGATATTTGCTGG - Intergenic
923668162 1:236016974-236016996 GTGACTCTCCAGATAGTTGGAGG + Intronic
1064386061 10:14892787-14892809 CTGACACCGAAGATAGTTGGGGG + Intronic
1065324821 10:24541346-24541368 GTAAAACAGGAGGTATTTGGTGG + Intronic
1067295313 10:44972238-44972260 GAGACCCTGCAGATATGTGGCGG - Intronic
1068486092 10:57660716-57660738 GTCACAGGGTAGATATTTGGAGG - Intergenic
1069901170 10:71707388-71707410 GTGACAGAGCAGTGACTTGGAGG + Intronic
1070726459 10:78794849-78794871 GTTACACCGCTGAGATTTGGGGG - Intergenic
1073090942 10:100939197-100939219 GTTACACTTCAGATATTTGAAGG - Intronic
1074148566 10:110738660-110738682 GTGACACAGCTGAGATTGGAGGG + Intronic
1074312641 10:112335657-112335679 GTGACAATGCAGATGTTAGGTGG + Intergenic
1075739609 10:124686419-124686441 GTGAAAGAGCTGATGTTTGGGGG - Intronic
1076932483 10:133541849-133541871 GTGACACAGCACATGTTTCAGGG + Intronic
1078747596 11:14129987-14130009 ATGTCACAGGAGAGATTTGGTGG - Intronic
1079011426 11:16831687-16831709 GTCACACAGCTTATATGTGGTGG - Intronic
1079238822 11:18708026-18708048 GTCACACAGATGATATTTGGGGG + Intronic
1079972205 11:27049118-27049140 GTGCCACATAAGTTATTTGGGGG + Intronic
1080015155 11:27497741-27497763 GAGACAAACCAGTTATTTGGTGG - Exonic
1082633721 11:55571096-55571118 GGAACAGAGCAGAGATTTGGAGG - Intergenic
1083636045 11:64121498-64121520 GTGACACAGCAGATATTTGGGGG - Intronic
1085523596 11:77151947-77151969 GTCACACAGCAGATGTGTGGGGG - Intronic
1085801816 11:79596990-79597012 GCTACCCAGCAGGTATTTGGGGG + Intergenic
1086038969 11:82451826-82451848 GTGACACAGCTGGTAAATGGTGG - Intergenic
1086203931 11:84235801-84235823 GTCACACAGCAGATAGTAAGGGG - Intronic
1086448882 11:86896571-86896593 GTGACTGAACAGATGTTTGGGGG - Intronic
1086699100 11:89879168-89879190 GTGACACAGCACAGATATGTTGG - Intergenic
1086707071 11:89965341-89965363 GTGACACAGCACAGATATGTTGG + Intergenic
1089767684 11:120779917-120779939 GTCACACAGCAGACATGTTGAGG - Intronic
1092700878 12:11229394-11229416 GGGACACAGTAGATATTCAGGGG + Intergenic
1096453653 12:51767449-51767471 AAGACACATCAGATATTTGCTGG - Intronic
1097458751 12:59833906-59833928 GAGACACAGTAGATATCTGGTGG - Intergenic
1097466528 12:59932304-59932326 TTGATACAGCAGAAATTTGAAGG + Intergenic
1097893807 12:64804624-64804646 CTGACACATCAGAAAATTGGTGG - Intronic
1099473486 12:83078564-83078586 GCTCCACAGCAGATATTTGTTGG - Intronic
1103251194 12:119501363-119501385 GTGAGAGAGGAGGTATTTGGGGG + Intronic
1103723559 12:122987108-122987130 GTGACACGGCTAATAATTGGGGG + Intronic
1103972385 12:124680181-124680203 GTGACTCAGCAGCTCATTGGTGG + Intergenic
1106212876 13:27667101-27667123 GTGACACAGCAGCTCGGTGGCGG - Intronic
1110401128 13:75093232-75093254 GTCACACAGCTGGTATATGGTGG - Intergenic
1110549397 13:76794978-76795000 GTTCTAGAGCAGATATTTGGTGG - Intergenic
1110932176 13:81234299-81234321 ATCACATAGCAGATATCTGGAGG + Intergenic
1111308851 13:86454309-86454331 GTAAAACAGTAGGTATTTGGGGG + Intergenic
1112117792 13:96376090-96376112 GAGTCACAGCATCTATTTGGTGG - Intronic
1112668885 13:101612276-101612298 GTGAAACAGCAAATATTTTGAGG + Intronic
1113108760 13:106799420-106799442 GTCACAAAGCAGATGCTTGGAGG + Intergenic
1114061581 14:19022552-19022574 GTGGCATAGGAGACATTTGGTGG - Intergenic
1114100668 14:19377393-19377415 GTGGCATAGGAGACATTTGGTGG + Intergenic
1114460211 14:22881833-22881855 GTGACACTTCACTTATTTGGAGG - Intergenic
1114757087 14:25271528-25271550 GTGACAGAGAACATATTTGAAGG + Intergenic
1115778277 14:36740347-36740369 GTCACACAGCAAATATGAGGAGG + Intronic
1118054173 14:62062183-62062205 GTGACAAAACAGATGTTTGCAGG + Intronic
1121267430 14:92613370-92613392 GTGGTACAGGAGGTATTTGGAGG - Intronic
1121302880 14:92885903-92885925 GTAACACAGCAGACATGTAGAGG + Intergenic
1121690498 14:95874968-95874990 GAGACTCAGCAGAGATTTAGGGG - Intergenic
1123134010 14:106011000-106011022 ATGACTCAGCAGAAATGTGGTGG + Intergenic
1123495640 15:20822419-20822441 GTGGCATAGGAGACATTTGGTGG + Intergenic
1123552127 15:21391511-21391533 GTGGCATAGGAGACATTTGGTGG + Intergenic
1123584039 15:21741432-21741454 ATGACTCAGCAGAAATGTGGTGG + Intergenic
1123588371 15:21828908-21828930 GTGGCATAGGAGACATTTGGTGG + Intergenic
1123620689 15:22184035-22184057 ATGACTCAGCAGAAATGTGGTGG + Intergenic
1125260883 15:37823535-37823557 GTGACACAGCGGATTTTTTCAGG + Intergenic
1125489794 15:40137879-40137901 TTCACACAGTACATATTTGGTGG + Intergenic
1126141296 15:45441504-45441526 GTGACACAGCAGGTAAATGTGGG - Intronic
1126240202 15:46433180-46433202 GTCACACATCAGAATTTTGGTGG + Intergenic
1129249589 15:74301508-74301530 GGCACACAGTAAATATTTGGTGG + Intronic
1131979714 15:97982984-97983006 GTGAGACACCAGATCTCTGGAGG + Intergenic
1202960475 15_KI270727v1_random:118742-118764 GTGGCATAGGAGACATTTGGTGG + Intergenic
1133082972 16:3338204-3338226 GTTACACAGCAGAGATTTCAGGG + Intergenic
1135975480 16:27106515-27106537 GTCACACAGCAAATGTTTGGAGG - Intergenic
1137713351 16:50582555-50582577 GTGACACAGCAGGGATTCTGGGG + Intronic
1139909407 16:70388160-70388182 GTGACACAGCATATTGATGGTGG - Intronic
1140994696 16:80247240-80247262 GTGGCACTGCAGTTATTTGCAGG - Intergenic
1143580904 17:7825256-7825278 GTGACACGGCAGATTTTAGAGGG - Intronic
1144403079 17:14925598-14925620 GTGGAAGAGCTGATATTTGGAGG + Intergenic
1144823168 17:18089608-18089630 GTGATACAGCAGAATATTGGGGG + Intronic
1146291815 17:31613127-31613149 GTGACAGAGCAGAGAGCTGGAGG + Intergenic
1149481885 17:57010134-57010156 GAGACACAGCAGATAATCCGTGG + Intergenic
1149577462 17:57724374-57724396 GTCACCCAGCAGACAGTTGGTGG + Intergenic
1151705368 17:75764500-75764522 GTCACACAGCAGGTTCTTGGCGG - Intronic
1153471362 18:5450067-5450089 GTGAGACTGCAGATAATGGGGGG + Intronic
1154453045 18:14494846-14494868 GTGGCATAGGAGACATTTGGTGG + Intergenic
1157364738 18:47054371-47054393 GTGACAAAACAGACATTGGGAGG - Intronic
1157520736 18:48343588-48343610 GTCACACAGCTGATAGGTGGTGG - Intronic
1158284950 18:55870014-55870036 GGGACTCAGCAGAACTTTGGGGG - Intergenic
1159273290 18:66181688-66181710 GTGAAACAGGGGATATTTCGGGG + Intergenic
1159758990 18:72401470-72401492 GTGACAGAGCAGAGATTGGAGGG - Intergenic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1160438369 18:78868491-78868513 GTGACACAGGAGATAATTGCAGG - Intergenic
1161513141 19:4682843-4682865 GGGACACAGCAGACAGATGGGGG + Intronic
1162849293 19:13418254-13418276 GGTCCACAGCAAATATTTGGGGG + Intronic
1163769044 19:19179691-19179713 GTGACACATCAGATCTTTCCTGG + Intronic
1168076961 19:53985854-53985876 GAGAGACAGCAAATATTTGCTGG + Exonic
1168218518 19:54943882-54943904 GTGACACAGCACATGTTTCTGGG - Intronic
1168459643 19:56542627-56542649 CTGATACAGAAAATATTTGGTGG + Intronic
925256601 2:2494770-2494792 GTTAAACAGCAGAAATTAGGAGG - Intergenic
928044469 2:27915020-27915042 GTTACACAGCAGAAATTTACAGG - Intronic
928983618 2:37159274-37159296 GAGACACAGCAGAATTTAGGAGG - Intergenic
929433254 2:41906873-41906895 GTGACTCAGGAGATAATTTGGGG + Intergenic
931962091 2:67493471-67493493 GTCACACAGCTCATATTGGGAGG - Intergenic
932096106 2:68850303-68850325 CTGGCACACCAGAAATTTGGAGG - Intergenic
932127029 2:69153851-69153873 GTCACACAGCCAGTATTTGGTGG - Intronic
933605234 2:84375651-84375673 CTGACACAGCAGTCATTTGATGG + Intergenic
934695133 2:96394545-96394567 TTGTCACAGCAGAGATGTGGCGG - Intergenic
935567004 2:104619796-104619818 ATGATAAAGGAGATATTTGGTGG + Intergenic
936171338 2:110178987-110179009 GTGTCACTGGAGAAATTTGGAGG + Intronic
938478937 2:131642858-131642880 GTGGCATAGGAGACATTTGGTGG - Intergenic
940323763 2:152403653-152403675 GTGACAGATCACATACTTGGTGG + Intronic
940978518 2:159974306-159974328 GTTACACAGCAGCTAAGTGGTGG - Intronic
942395102 2:175538846-175538868 GTGCTACAGCAGATTTTAGGAGG - Intergenic
943778140 2:191790553-191790575 GTGCCACAGGACATTTTTGGAGG + Intergenic
943852723 2:192747352-192747374 ATGACACAGAAGAAATTTGAGGG + Intergenic
944093618 2:195942253-195942275 TTAACACCGCAGATATTTAGAGG + Intronic
944912676 2:204325759-204325781 GTGACACAGCAGAAAATTGGGGG + Intergenic
946029049 2:216690856-216690878 CTGACACAGCAGAAAGGTGGGGG + Intronic
947426213 2:229985307-229985329 TTAACACAGCAGTTTTTTGGAGG - Intronic
1170208086 20:13821235-13821257 GTGACACACCATCTATTTGTTGG - Exonic
1172019360 20:31902119-31902141 TTGACACAGCAGGTATGTGGGGG - Intronic
1173152531 20:40579832-40579854 GTGCCACAGTAGTGATTTGGCGG - Intergenic
1173513013 20:43645137-43645159 GTGATACAGTAAATATGTGGTGG + Intronic
1173645011 20:44627828-44627850 GTCACACAGCAGATAAGTGTGGG - Intronic
1177001215 21:15615461-15615483 TTTACTCAGCAGATATTTGAGGG - Intergenic
1178008670 21:28256053-28256075 GTAACAAAAAAGATATTTGGTGG + Intergenic
1178415833 21:32404524-32404546 GTGACACACCTGAGTTTTGGAGG - Intergenic
1178420742 21:32441363-32441385 GGGAGAAAGCAGATGTTTGGAGG + Intronic
1180480069 22:15745151-15745173 GTGGCATAGGAGACATTTGGTGG - Intergenic
1180979901 22:19873521-19873543 GTGCCACAGCAGAAGTGTGGAGG + Intergenic
1181617755 22:24066224-24066246 GGGACACTGCAGATCCTTGGTGG + Intronic
1181773542 22:25143804-25143826 GTCACACAGCACATAAATGGCGG - Intronic
949476041 3:4446630-4446652 GTAAGACATCAGATAATTGGTGG - Intronic
951225349 3:20114552-20114574 GTGACAGTGCAGCTATATGGAGG + Intronic
951364019 3:21758504-21758526 GAGACACATCAGAAATTTTGTGG + Intronic
952181067 3:30917315-30917337 GTGGAACACAAGATATTTGGGGG - Intergenic
952367071 3:32684462-32684484 GTTACTCCTCAGATATTTGGTGG - Intergenic
953184515 3:40625640-40625662 GGGACACAGGAGACATCTGGAGG + Intergenic
955067072 3:55543026-55543048 GTGAAACACCAGAGATATGGAGG - Intronic
955727035 3:61944173-61944195 GTGTCACAGCAGTTATCTAGTGG - Intronic
955919382 3:63939537-63939559 ATGGCAGAGCAGATTTTTGGAGG - Intronic
956967555 3:74479689-74479711 TGGACACAGCAGAGATTTGTAGG + Intronic
959604396 3:108226064-108226086 GCGATACAGCAGATATATGAAGG - Intergenic
959606982 3:108251557-108251579 GTCACACAGCTGGTATGTGGTGG + Intergenic
961098770 3:124180543-124180565 GTCACACAGCTGATAAGTGGTGG - Intronic
961777508 3:129299428-129299450 GTGATACAGAAGTTAATTGGAGG - Intronic
962658060 3:137569656-137569678 GTGGCACTGCAGATAGTTTGGGG - Intergenic
963924125 3:150933454-150933476 GTGAGAAGGTAGATATTTGGAGG + Intronic
964040467 3:152255413-152255435 CTACCACAGGAGATATTTGGTGG + Intronic
964441919 3:156720675-156720697 GTGACCTAGAAGATATTTTGGGG - Intergenic
964676112 3:159281554-159281576 CTGACACAGCACAGATTTGTAGG - Intronic
966513353 3:180788812-180788834 GATACACTACAGATATTTGGTGG + Intronic
968705420 4:2075311-2075333 GTGACACAGCAGCAATGAGGTGG + Intronic
969034700 4:4243819-4243841 ATCACACATAAGATATTTGGGGG - Intronic
970105515 4:12578289-12578311 GTGAAACAGCAGAAACTTTGGGG - Intergenic
970449273 4:16150907-16150929 GTGACACATCAAAGGTTTGGTGG + Intergenic
973337819 4:48974389-48974411 GGTGCTCAGCAGATATTTGGTGG - Intergenic
973588958 4:52420740-52420762 GACACACAGCAAATATTTGCAGG - Intergenic
973909386 4:55564211-55564233 GTGGTACAACAGATATTTGTGGG + Intronic
975459760 4:74637191-74637213 GTGGCAAAGCTGAGATTTGGAGG + Intergenic
977390164 4:96399043-96399065 GAGACACAGCACATTTTTAGAGG + Intergenic
978311157 4:107386314-107386336 GTGACTGGGCAGATGTTTGGTGG + Intergenic
983950156 4:173630034-173630056 GGGTCACAGCAAAAATTTGGGGG - Intergenic
984880680 4:184407586-184407608 GTAACACTGCAGTTATCTGGGGG + Intronic
987702951 5:21425470-21425492 GTGAAACCGCTGAGATTTGGAGG + Intergenic
987984457 5:25128208-25128230 GTGACACTGAAGATATTTGAAGG - Intergenic
989344037 5:40409050-40409072 GTTACTCAGTAGATATTTGTTGG - Intergenic
989741081 5:44772902-44772924 TTGATACAACAGATAGTTGGAGG - Intergenic
992941043 5:81761884-81761906 ATCACACAGCTGATAATTGGTGG - Intergenic
993628581 5:90256107-90256129 GTGAATCAGCTGATATTTGAAGG - Intergenic
995490408 5:112685035-112685057 ATGATACAGCATGTATTTGGTGG - Intergenic
995538037 5:113157037-113157059 GTCACACAGCAGATATGTAACGG - Intronic
997281625 5:132651858-132651880 GTGGCCATGCAGATATTTGGGGG - Intergenic
999673770 5:153979193-153979215 TTGACAAAGGAGATATTAGGGGG + Intergenic
1000155247 5:158544516-158544538 CTGACACAGGAAAAATTTGGAGG + Intergenic
1004553405 6:16672259-16672281 ATGACACAGAAAACATTTGGAGG - Intronic
1005822338 6:29608179-29608201 GAAACACAGCAGAGAGTTGGGGG - Intronic
1008215375 6:48782193-48782215 CTGATACAGCAGAAATTTGAAGG + Intergenic
1010979584 6:82356117-82356139 GTGACACGGAAGATGTTTGCAGG - Intergenic
1011486254 6:87844935-87844957 GAGACACAGCAGATATTATAGGG - Intergenic
1012150834 6:95749559-95749581 GTGACAGAGGAGAGTTTTGGGGG - Intergenic
1012972588 6:105747709-105747731 GTTACAAAGCAGAAATTTTGTGG + Intergenic
1014308100 6:119767009-119767031 GTGACTATGCAGATGTTTGGTGG - Intergenic
1015668496 6:135659444-135659466 GTGAAACAAAAGAAATTTGGGGG + Intergenic
1018921310 6:168177776-168177798 GAGACACAGAGGACATTTGGTGG - Intergenic
1019958607 7:4437354-4437376 GTGACTCAGCAGATGGGTGGTGG - Intergenic
1020549236 7:9579146-9579168 GTAACTCAGCAATTATTTGGAGG + Intergenic
1021214235 7:17896541-17896563 TTGAGACCCCAGATATTTGGAGG - Intronic
1021279423 7:18699066-18699088 GTGACACAGCAGTGATTCTGGGG + Intronic
1022943969 7:35263828-35263850 ATTACACAGCAAATATGTGGTGG + Intergenic
1023476703 7:40587161-40587183 GAGACACAACAGATTTTTTGGGG + Intronic
1023653328 7:42392837-42392859 GTGACACACAAAAAATTTGGGGG + Intergenic
1024083240 7:45873074-45873096 GGGACACAGCAGGTATTTCTTGG - Intergenic
1024493523 7:50015222-50015244 GTCAGACAGCAGATATTTGGGGG + Intronic
1027424687 7:78050803-78050825 ATGAAACAGCACATATTTGCAGG + Intronic
1027490308 7:78815778-78815800 GAGACAGAACAGCTATTTGGTGG - Intronic
1030290413 7:107866582-107866604 GTGTCACTGCAAATATTTTGTGG + Intergenic
1031358690 7:120820737-120820759 GTCACACAGCAGGTATTGGGTGG + Intronic
1031407880 7:121407272-121407294 GTGATCCAGCAGATAGTGGGAGG + Intergenic
1031513038 7:122672320-122672342 GTCCCACAGCAGAAAGTTGGAGG - Intronic
1031521479 7:122771447-122771469 GAGACTCAGTAGATATTTGTTGG - Intronic
1031900164 7:127400061-127400083 GGGACACAGGAGAATTTTGGGGG + Intronic
1032304692 7:130721623-130721645 GTTAGCCAGCAGATATCTGGAGG - Intergenic
1032722186 7:134559319-134559341 GTGACTGGGCAGATGTTTGGTGG + Intronic
1032941059 7:136792502-136792524 CTGACACTGCAGAAATTTAGAGG + Intergenic
1033008693 7:137595689-137595711 TTTACTCAGCAGATATGTGGAGG - Intronic
1033937065 7:146599329-146599351 GTGAGACAGAAAATAATTGGAGG - Intronic
1034235378 7:149563763-149563785 GTGCCACATCAGATATTTACAGG - Intergenic
1035967150 8:4205566-4205588 GTGACACAGCATATAAATGATGG + Intronic
1036542439 8:9730241-9730263 GAGACATAGAAGAGATTTGGAGG + Intronic
1038269591 8:26064427-26064449 GTGACAATTCAGATATTTGGAGG - Intergenic
1039870917 8:41544344-41544366 GGGAAACAGCAGATATTTAGTGG + Exonic
1040344039 8:46469013-46469035 GTGAAACACCAAATATTTGGGGG - Intergenic
1041277916 8:56182202-56182224 GAGACACAGAAGATATGTGTTGG + Intronic
1042080003 8:65041182-65041204 GTGACAGAGCAGTTCTTTGTTGG + Intergenic
1042472568 8:69207966-69207988 GTTACAGAACAGATACTTGGTGG - Intergenic
1042701765 8:71623300-71623322 GTAACATAGCAGACATTTGTTGG - Intergenic
1042841312 8:73126661-73126683 GTGACTCAGTAGATCTTGGGCGG - Intergenic
1046599594 8:116300672-116300694 GTGAAAAAGGAGATAGTTGGAGG - Intergenic
1047989156 8:130267525-130267547 GTCACACAGCAGGTAAATGGAGG + Intronic
1048462479 8:134633666-134633688 GTCACACAGCCCATATGTGGTGG - Intronic
1050087503 9:1981209-1981231 GGCATACAGCAGAGATTTGGGGG - Intergenic
1050480847 9:6085600-6085622 GTGACTGGGCAGATGTTTGGTGG + Intergenic
1050561208 9:6835764-6835786 GCCACACTGCAGAAATTTGGGGG - Intronic
1054823131 9:69543719-69543741 GTCACAAAGCAGATAATTGGTGG + Intronic
1055758537 9:79581675-79581697 GTGATACAGCTAATAGTTGGTGG + Intronic
1186294729 X:8136573-8136595 GTGACAGACCACATATTTGATGG + Intergenic
1186447358 X:9643032-9643054 AAGGCACTGCAGATATTTGGGGG + Intronic
1186613513 X:11162338-11162360 GTGACACAGTAAATATGGGGGGG - Intronic
1190525902 X:51329382-51329404 GTGACACAACAATTATTTGCTGG + Intergenic
1191709917 X:64138607-64138629 GTTACACAACACATAATTGGTGG + Intergenic
1193436745 X:81482778-81482800 GTGAAAGAGCAGATAGTTGCAGG - Intergenic
1195281325 X:103337006-103337028 CTGATAAAGGAGATATTTGGTGG + Intergenic
1195413746 X:104597662-104597684 GAGGCACAGCAGGTTTTTGGGGG + Intronic
1195871002 X:109485620-109485642 GTCACACAGCTGATACATGGTGG + Intergenic
1196925708 X:120631267-120631289 GAGACACATCAAATATTTCGTGG - Intergenic
1198016626 X:132618091-132618113 GTTACACAGCTAATATGTGGTGG + Intergenic
1198512971 X:137372791-137372813 GTCACACAGCTAATATGTGGTGG + Intergenic
1198952851 X:142092326-142092348 GTGAAACAGCAGAGATGAGGTGG + Intergenic
1199365215 X:146972402-146972424 GAGACAATCCAGATATTTGGAGG - Intergenic
1201520858 Y:14872079-14872101 GTGAAAAAGCAGCTATTGGGTGG - Intergenic
1201603026 Y:15751384-15751406 ATGACAGAGCACATATTTGATGG - Intergenic