ID: 1083636873

View in Genome Browser
Species Human (GRCh38)
Location 11:64125555-64125577
Sequence GCTGCTGGCGGGGCAGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1065
Summary {0: 1, 1: 1, 2: 12, 3: 95, 4: 956}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083636873_1083636879 -10 Left 1083636873 11:64125555-64125577 CCTGCTCCTGCCCCGCCAGCAGC 0: 1
1: 1
2: 12
3: 95
4: 956
Right 1083636879 11:64125568-64125590 CGCCAGCAGCTGGCACAGAGAGG 0: 1
1: 0
2: 3
3: 29
4: 286
1083636873_1083636880 -9 Left 1083636873 11:64125555-64125577 CCTGCTCCTGCCCCGCCAGCAGC 0: 1
1: 1
2: 12
3: 95
4: 956
Right 1083636880 11:64125569-64125591 GCCAGCAGCTGGCACAGAGAGGG 0: 1
1: 0
2: 8
3: 73
4: 606
1083636873_1083636882 -8 Left 1083636873 11:64125555-64125577 CCTGCTCCTGCCCCGCCAGCAGC 0: 1
1: 1
2: 12
3: 95
4: 956
Right 1083636882 11:64125570-64125592 CCAGCAGCTGGCACAGAGAGGGG 0: 1
1: 0
2: 7
3: 69
4: 543
1083636873_1083636883 18 Left 1083636873 11:64125555-64125577 CCTGCTCCTGCCCCGCCAGCAGC 0: 1
1: 1
2: 12
3: 95
4: 956
Right 1083636883 11:64125596-64125618 ATCTCAGCAGCTTTACCTCTTGG 0: 1
1: 0
2: 0
3: 18
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083636873 Original CRISPR GCTGCTGGCGGGGCAGGAGC AGG (reversed) Intronic
900199684 1:1398892-1398914 GCTGGGGTCGGGGCAGGGGCTGG + Intronic
900204492 1:1426259-1426281 GCAGCCGGCCGGGCAGCAGCGGG - Exonic
900314564 1:2050461-2050483 GCGGCGCGCGGGGCGGGAGCGGG - Exonic
900345944 1:2210339-2210361 GGTGCTGGCGGGACAGGGGGTGG + Intronic
900557979 1:3289603-3289625 CCTGCGGGCAGGTCAGGAGCTGG + Intronic
900579761 1:3403185-3403207 GCTGCGGGCAGAGCAGGTGCAGG + Intronic
900663217 1:3796383-3796405 GCTGCTGACGGGGCCCGGGCTGG - Exonic
900807425 1:4776627-4776649 GCTGCTGGAAGGGGAGGACCAGG - Intronic
900987265 1:6080381-6080403 GAGGCTGGGGGGGCAGCAGCAGG + Intronic
901160812 1:7175588-7175610 GCTGCAGGCTGGGGAGGAGCAGG + Intronic
901646006 1:10717068-10717090 GCTGCTGGAGGGACAGGAGCAGG + Intronic
901672832 1:10866329-10866351 GCTGGTGGGGGGGCAGGTGGGGG - Intergenic
901827204 1:11869955-11869977 CCTGCTGGAGGGGCCGGAGTGGG + Intergenic
902108849 1:14060971-14060993 GCTGCTGGTGTGGGAGGAGAAGG - Intergenic
902113750 1:14104234-14104256 GCTCCTTGCGGGGAAGGAGCAGG - Intergenic
902552768 1:17229175-17229197 GCTGGTGGCAGGACAGCAGCAGG + Intronic
902814279 1:18907386-18907408 GCTGCTGGCAGTGCAGGAGCTGG - Exonic
902814285 1:18907413-18907435 GCTGCTGGCAGGAGAGAAGCAGG - Exonic
902832972 1:19029580-19029602 GAAGCAGGCTGGGCAGGAGCAGG + Intergenic
902921086 1:19666239-19666261 GCTGCTGGGCTGGCACGAGCTGG + Exonic
903029124 1:20450263-20450285 GGTGCAGGAGGGGCAGGAGGGGG + Intergenic
903263182 1:22142326-22142348 TCTGCTTGGGGGGCGGGAGCCGG - Intronic
903299482 1:22368544-22368566 GATGCTGGCAGCCCAGGAGCTGG + Intergenic
903328869 1:22586726-22586748 TCTGCTGGTGGGGCAGGGGCGGG + Intronic
904006566 1:27366227-27366249 GCTGGGGGCGGGGCCGGATCCGG - Intronic
904014601 1:27409913-27409935 GCTGCTGGTGGTGGAGGAGGAGG + Exonic
904093983 1:27963521-27963543 GCTGCTGGTGTGGCAGCAGGAGG + Exonic
904237368 1:29123943-29123965 GCTGGAGGCGGGGCCGGGGCGGG - Intergenic
904814092 1:33182124-33182146 GCAGCGGGCGGGGGAGGGGCGGG + Intergenic
904966914 1:34381297-34381319 GGTGCTGGAGGGGAAGGAGGAGG - Intergenic
905106322 1:35565591-35565613 GCTGCAGGCGGGCGAGGAGACGG + Exonic
905158498 1:36010048-36010070 GCTGCTGGGGAGGCTGAAGCAGG - Intronic
905290668 1:36919917-36919939 GCTGATGGCAGGGATGGAGCTGG - Intronic
905804968 1:40869615-40869637 GCTGCTGGAGAGGCTGGGGCAGG + Intergenic
905960699 1:42040258-42040280 GCTGCTGGAGTGCCAGGAGGAGG + Intergenic
906140489 1:43531229-43531251 GCTGCGGGCGCGGCAGGTGGGGG - Intronic
906168955 1:43707759-43707781 GCGGCCGGCGGGGGAGGGGCGGG - Intronic
906344647 1:45007559-45007581 GCCGCTGGCGGGACAGCAGTAGG + Exonic
906517505 1:46448313-46448335 GCGGCAGGCGGGGCGGGAGCGGG - Intergenic
906646629 1:47479781-47479803 GCAGCTGGCGAGGCAGGAAGAGG - Intergenic
907464427 1:54625304-54625326 GCTGCTGGCTGGAATGGAGCAGG + Intronic
907486515 1:54781722-54781744 GCTGCTGGCGGTGGACGAGGCGG - Exonic
907675271 1:56512092-56512114 ACTGCAGGAGGGGCCGGAGCAGG + Exonic
908210857 1:61898350-61898372 GCTACTGGGGAGGCTGGAGCAGG - Intronic
908361990 1:63377843-63377865 GCTACTGGGGAGGCTGGAGCAGG - Intronic
909024657 1:70468323-70468345 GGTGCTGGTGGGGCTGGGGCTGG - Intergenic
910266562 1:85344409-85344431 TCTGCTGGCCGGGCAGCAGGAGG - Intronic
910935097 1:92480848-92480870 GCTGCCGGCGGCGCGGGGGCCGG - Exonic
911052399 1:93681803-93681825 GCTGCTGGCCGGGCGGGGGACGG - Intronic
911144037 1:94535415-94535437 GCAGATGGCTGGGCAGGTGCTGG + Intronic
912366564 1:109138555-109138577 GCTGCTGGTGGGGAGGGAGGAGG - Intronic
912800753 1:112718683-112718705 GGTGCTGGGGGGAAAGGAGCTGG - Intergenic
913144513 1:115976484-115976506 GCTGGCGGCGGGGCCGGGGCGGG - Exonic
913222094 1:116667760-116667782 GCGGCGGGCCGGGCTGGAGCTGG - Intergenic
914231021 1:145764761-145764783 GCGGCTGGCTGGGCGGGGGCTGG - Intronic
914463940 1:147909500-147909522 GCTGCTGGGGTTGGAGGAGCGGG - Intergenic
914788020 1:150851201-150851223 GCGGCTGGCCGGGCGGGGGCTGG - Intronic
915472811 1:156135972-156135994 GCTGCTGGCGGAAAAGGAGCGGG + Exonic
915586909 1:156848892-156848914 GCCGGGGGCGGGGCCGGAGCGGG - Intronic
915936740 1:160094067-160094089 GGTGCATGAGGGGCAGGAGCTGG - Exonic
915973112 1:160367650-160367672 GCTGCTGCCGGGACTGGAACTGG + Intronic
916882081 1:169028737-169028759 GCTGCTTGGGAGGCAGAAGCAGG + Intergenic
917292166 1:173481668-173481690 GCTGCTGGCAGGCCAAGAGGAGG - Intronic
917440759 1:175066985-175067007 GCTGCTGGAGGGAAAGGAGAAGG - Intergenic
917737962 1:177937397-177937419 GCTGTGGGCTGGGCTGGAGCAGG + Exonic
917937245 1:179880999-179881021 GCTGCTGGGGAGGCTGAAGCAGG + Intergenic
919753859 1:201054445-201054467 GCAAGTGGCAGGGCAGGAGCTGG + Intronic
919758236 1:201079364-201079386 GCTGCTGGGAGGTCAGGAGCAGG - Intronic
919875652 1:201865318-201865340 GCTGCTGGGGAGGCTGAAGCAGG - Intronic
919916839 1:202144311-202144333 GCGCCGGGCGGGGGAGGAGCCGG - Intronic
920022671 1:202967321-202967343 GCGGCTGGGGGGGCAGGAGGCGG + Intergenic
920092794 1:203466059-203466081 GCTTGTGGTGGGGCAGGAGTCGG + Intergenic
920180969 1:204131509-204131531 CCTGCTGGGGGGACAGGAGAGGG - Exonic
920361449 1:205419574-205419596 GCTGCTGGAGGGGCTGAGGCCGG - Intronic
921060246 1:211578954-211578976 GCCGCAGCCGGAGCAGGAGCAGG + Intergenic
921348828 1:214214661-214214683 GCTGCTGGTGAAGCAGGAGGAGG - Intergenic
922056092 1:222043814-222043836 GCCGCAGGCTGGGCAGGAGGGGG + Intergenic
922313023 1:224414215-224414237 GCTGCTGGGGAGGCTGAAGCAGG - Intronic
922314883 1:224434158-224434180 GCGGCGGGAGGGGCAGCAGCCGG + Exonic
922338224 1:224634861-224634883 GCTCCTGGCGGGGATGCAGCGGG - Intronic
922414002 1:225403821-225403843 GCTGGTGGAGGTGGAGGAGCTGG - Intronic
922586387 1:226737493-226737515 GCCGGCGGCGGAGCAGGAGCGGG - Exonic
922696643 1:227734185-227734207 GCTGCTGGCGGGGGAGGGGGCGG + Intronic
923235827 1:232031713-232031735 GCTGCTGGCTGAGCACGAGGTGG + Intronic
923854139 1:237827823-237827845 GCTGCTGGGGAGGCTGAAGCAGG + Intronic
923955323 1:239011582-239011604 GCTGGTGGCTGGCCAGGGGCTGG - Intergenic
924594138 1:245430553-245430575 GCTACTTGCGGGGCTGGGGCAGG + Intronic
924638387 1:245810092-245810114 CCTGCTGCCTGGGCAGGAGGCGG + Intronic
924784714 1:247184365-247184387 GGGGCTGGCGGGGCAGGACTGGG - Intergenic
1062818683 10:518346-518368 GCTGCCAGCGGTGCAAGAGCAGG - Intronic
1063123895 10:3123771-3123793 GTTGCTGGCTGGGAAGCAGCTGG + Intronic
1063179573 10:3585596-3585618 GCTGTGGGCGAGGAAGGAGCTGG + Intergenic
1063292404 10:4762798-4762820 GTTGATAGCAGGGCAGGAGCAGG + Intergenic
1063452972 10:6163739-6163761 GCTGCCTGCGGCGCACGAGCCGG + Intronic
1063463328 10:6228099-6228121 GCTGCTGGCTGGGCCGGCGTGGG + Intronic
1063983216 10:11473276-11473298 GGTGCTGGTGAGGCAGGAGCCGG + Intronic
1064028405 10:11867649-11867671 ACTGCTGACGTGGCAGGAGGTGG + Intronic
1064208037 10:13341447-13341469 GCTGCTGGCGGGGGCGGTGCAGG - Intronic
1064355378 10:14613081-14613103 GCTGCTCGCGGGGCTGAGGCAGG - Intronic
1064568712 10:16670874-16670896 GCTACTGGGGAGGCTGGAGCAGG - Intronic
1064582708 10:16810447-16810469 GCTGCTGGGGGAACAGCAGCAGG - Intronic
1065535244 10:26709447-26709469 GCTGCTTGCGGGGCTGAGGCAGG + Intronic
1065599101 10:27350260-27350282 GTTGCTGGCGGGGCTGGGCCCGG - Intergenic
1065917336 10:30364835-30364857 ACTGCTGGAGCTGCAGGAGCTGG - Intronic
1067034207 10:42900657-42900679 GCAGCTGGCCGGGCAGGGGCTGG - Intergenic
1067051943 10:43026678-43026700 CCTGCTGCCGGGGCAGACGCAGG + Intergenic
1067111970 10:43407554-43407576 GCAGCCGGCGCAGCAGGAGCCGG + Intronic
1067274060 10:44819053-44819075 GCTGCTGGCGAGGCTCCAGCTGG - Intergenic
1067500419 10:46799092-46799114 GCTACTTGCGGGGCTGAAGCAGG - Intergenic
1067594209 10:47541214-47541236 GCTACTTGCGGGGCTGAAGCAGG + Intronic
1067641318 10:48049329-48049351 GCTACTTGCGGGGCTGAAGCAGG + Intergenic
1068072003 10:52207223-52207245 CCTGCTAGCAGAGCAGGAGCGGG + Intronic
1069024203 10:63521911-63521933 GCTGCGCGGGGAGCAGGAGCGGG - Intronic
1069761807 10:70816240-70816262 GCTGCGGCCGGGGCGGGGGCGGG + Intronic
1069778338 10:70939624-70939646 GCTGCTGGAGGCACAGGGGCAGG + Intergenic
1069997703 10:72353228-72353250 GCTGCTGCGGGCTCAGGAGCAGG - Intronic
1070352953 10:75611051-75611073 GCTGCTGCAGAGGCTGGAGCTGG + Intronic
1070703348 10:78619084-78619106 GCTCCTGGGGGTGCAGAAGCAGG - Intergenic
1070982499 10:80660689-80660711 GATGGTGGCAGCGCAGGAGCAGG + Intergenic
1071052830 10:81472901-81472923 GCTGCAGGGGAGGCAGGACCCGG + Intergenic
1071420512 10:85492653-85492675 GCTGCTGGAAGGGAAGGAGACGG + Intergenic
1071435749 10:85646977-85646999 GGTGCTGGCTGGGGAGGAGCAGG - Intronic
1071572672 10:86706586-86706608 GCAGGTGGCTGGGCAGAAGCGGG - Intronic
1072102321 10:92240293-92240315 GCTGCTGCTGGGGCTGGGGCTGG + Exonic
1072617774 10:97060723-97060745 GCACATGGCCGGGCAGGAGCCGG + Exonic
1072656666 10:97334640-97334662 GCTGCGGGCGAAGCCGGAGCAGG + Exonic
1073326293 10:102645543-102645565 GCAGCTGGAGAGGCAGGACCGGG - Intronic
1073929960 10:108564272-108564294 GCTGCTTGGGGGGCTGAAGCAGG + Intergenic
1074115721 10:110456445-110456467 CCTGCTGGGGGGGCAGGTGGTGG - Intergenic
1074815136 10:117137159-117137181 GCTGCTGGCTGGGGCGGCGCCGG + Intronic
1075182250 10:120222142-120222164 GCTGTGGGCATGGCAGGAGCTGG - Intergenic
1075234271 10:120712251-120712273 GGTGTTTGCTGGGCAGGAGCTGG - Intergenic
1075438369 10:122461364-122461386 GGTGCTGGCGGGGCGCGGGCGGG - Intergenic
1075673425 10:124279889-124279911 GCTGCCCACGGGGCAGGAGTGGG - Intergenic
1075897485 10:126009730-126009752 ACAGCTTGCGGGGCAGGAGCCGG - Intergenic
1075967168 10:126623064-126623086 GCTGCTGGCCAGGCAGGGTCGGG - Intronic
1076110465 10:127855760-127855782 GCTCCTGCAGGGGCTGGAGCTGG + Intergenic
1076156114 10:128206997-128207019 GCTGCTGGCCAGGCCTGAGCAGG + Intergenic
1076242328 10:128917692-128917714 GCTGCTGCCAGTGCAGGGGCTGG - Intergenic
1076353809 10:129838162-129838184 GCTGCAGGAGGGGCAGGACTGGG - Intronic
1076451440 10:130559741-130559763 TGTCCTGGAGGGGCAGGAGCAGG + Intergenic
1076548796 10:131264132-131264154 GCTTCTGGCTGGGCAGGACTTGG - Intronic
1076707092 10:132307983-132308005 GCTGGGGGCGGGGCAGGGGCGGG + Intronic
1076707142 10:132308116-132308138 GCCGGGGGCGGGGCAGGGGCGGG + Intronic
1076754107 10:132559054-132559076 GAAGCTGGCTGGGCAGGAGGCGG - Intronic
1076793594 10:132788575-132788597 TCTGCTCGCGGGCCAGGAGGTGG - Intergenic
1076839864 10:133040633-133040655 GCTGTGGGCGGGGCAGGGGCGGG + Intergenic
1076869503 10:133186434-133186456 GCTGTGGCCGGAGCAGGAGCCGG + Exonic
1076898199 10:133324655-133324677 GCTGCTGGCTGGGGTGGTGCAGG + Intronic
1076916013 10:133423461-133423483 GCTGCCGCCGGGGCGGCAGCCGG - Exonic
1077065051 11:637337-637359 GCTGCTGGCTGGGCGCGGGCCGG + Exonic
1077225290 11:1436827-1436849 GCTGCGGGTGGGGCAGGACCCGG + Intronic
1077254495 11:1574208-1574230 GCTACTGGCCAGGCTGGAGCAGG + Intergenic
1077369365 11:2174363-2174385 GCTGGAGGCAGGGCAGGTGCAGG - Intergenic
1077484747 11:2833545-2833567 GTTGCTGGCGGGGCAGCAGTGGG - Intronic
1078050301 11:7960099-7960121 GCTGCTGGAGGTAAAGGAGCAGG - Exonic
1078059102 11:8032005-8032027 GGGGCTGGAGGGGCAGCAGCTGG + Intronic
1078067181 11:8086157-8086179 TCTCCTGGCGGGGCTGCAGCTGG + Intronic
1078144308 11:8712640-8712662 GCTGCTGGAGTGGCAGGAGCGGG - Exonic
1078146820 11:8727347-8727369 GCTTGGGGCGGGGCAGGGGCAGG - Intronic
1078316080 11:10294241-10294263 GGTGGGGGCGGGGGAGGAGCGGG - Intergenic
1078528910 11:12121310-12121332 GCTACTGCTGGAGCAGGAGCAGG + Intronic
1078631935 11:13010722-13010744 GCTGCTGCTGGAGCAGGAACGGG + Intergenic
1080595973 11:33774535-33774557 GGTGGGGGCGGGGCAGGGGCGGG - Intronic
1081584809 11:44376943-44376965 CCTGATGGCCTGGCAGGAGCTGG - Intergenic
1081705612 11:45180759-45180781 GCTGCGGCCGGGGCGGGCGCGGG - Intronic
1082834112 11:57639535-57639557 GCTGCTCTGGGGGCAGGGGCCGG + Intergenic
1083314377 11:61805224-61805246 GCAGGTGAAGGGGCAGGAGCAGG + Intronic
1083581918 11:63830487-63830509 GCAGCTGGGAGGGCAGGAGGTGG - Intergenic
1083636873 11:64125555-64125577 GCTGCTGGCGGGGCAGGAGCAGG - Intronic
1083681324 11:64353126-64353148 CCGGCTGGCGCGGCTGGAGCTGG + Exonic
1083721612 11:64606450-64606472 GCTGCTGGAGGAGCAGGGGTGGG - Exonic
1083911595 11:65713126-65713148 GCTCCTGGATGGGCAGGAGGCGG + Intronic
1084000253 11:66292094-66292116 GGCGCTGGGGGGGCCGGAGCCGG + Intronic
1084109156 11:67002368-67002390 GCTGCGGGTGGGGCAGCTGCAGG - Intergenic
1084146140 11:67266395-67266417 GCGGCAGGCGGGGCCGGAGGCGG + Exonic
1084156265 11:67314461-67314483 GCTGCAGGAGGGGCAGGGCCTGG - Intergenic
1084183552 11:67458442-67458464 GCCGCTGGCGGGTCCTGAGCTGG + Exonic
1084225936 11:67714877-67714899 GCTGCTGGCAGGGCAGAGGCTGG - Intergenic
1084263767 11:67994751-67994773 GCTGCTGGCAGGGCGGAGGCTGG - Intronic
1084274416 11:68044188-68044210 GCTGCCGCCAGGGCAGGTGCAGG + Exonic
1084426074 11:69085191-69085213 CCACCTGGCGGGCCAGGAGCCGG - Exonic
1084440661 11:69170988-69171010 TCTGCTGGCTGGGAAGGAGCTGG - Intergenic
1084476833 11:69394094-69394116 GCTGCTGGGAGGGCTGGAGGTGG + Intergenic
1084554510 11:69867948-69867970 GCTGCTGGCGGAGCACATGCTGG - Intergenic
1084562680 11:69913368-69913390 GCTTCTGTGAGGGCAGGAGCAGG - Intergenic
1084791214 11:71476312-71476334 GCAGCTGGCTTTGCAGGAGCAGG + Intronic
1084961826 11:72720917-72720939 CCTGCTGTCTGGGCAGGAGGTGG + Intronic
1085076728 11:73598135-73598157 GCTGCGGGCGAGGGAGGAGGAGG + Exonic
1085300046 11:75452637-75452659 GCTGCTGGAGGGACAGAGGCTGG + Intronic
1085741529 11:79081745-79081767 TTTGCTGGTGGGGCAGGGGCAGG + Intronic
1086361924 11:86068882-86068904 CCGGCAGGCGGGGAAGGAGCCGG - Exonic
1086697625 11:89863934-89863956 GCTGCAGGCGCTGCAGGGGCAGG + Intergenic
1086708534 11:89980554-89980576 GCTGCAGGCGCTGCAGGGGCAGG - Intergenic
1087548860 11:99620707-99620729 GCTGATGGCCGGGGGGGAGCGGG - Intronic
1088223229 11:107591225-107591247 GCTGCGGGCGCGGAAGGGGCGGG - Exonic
1089163593 11:116458072-116458094 GCTGGTGGGGGGCCAGGGGCGGG + Intergenic
1089666316 11:120022367-120022389 GCTACTGCCTGGGCAGGAGATGG - Intergenic
1089729444 11:120511484-120511506 GCTGCGGGCAGGGCGGGCGCGGG - Intergenic
1090080709 11:123610402-123610424 GCTCCTGACGGGGAAGGAGGAGG + Intronic
1090102535 11:123815299-123815321 GCTGCTGGGCTGGCAGGAGATGG - Intergenic
1090422217 11:126583261-126583283 GCTGCTGGCAGGCCTAGAGCGGG - Intronic
1090530171 11:127582772-127582794 GCTACTGGCGGGGCTGAGGCAGG - Intergenic
1091274579 11:134341934-134341956 GCTGAGTCCGGGGCAGGAGCCGG - Intronic
1091274589 11:134341966-134341988 GCTGAGTCCGGGGCAGGAGCCGG - Intronic
1091274706 11:134342442-134342464 GCTGCTGCTGGGGCCGGGGCGGG - Intronic
1091375469 12:22256-22278 GCTGCTGGGGAGGAAGAAGCAGG + Intergenic
1091449931 12:566043-566065 GCTGAAGGCGGTGCTGGAGCAGG - Exonic
1091880964 12:3977885-3977907 GCTGCTGGCTGGGCATGTGGTGG + Intergenic
1092365389 12:7872876-7872898 GCTGCAGGCGGGGCCGGCGGGGG - Intronic
1092392736 12:8095624-8095646 GCTGGTGTCGTGACAGGAGCAGG - Exonic
1092487381 12:8914501-8914523 GCTGCGGGCCGGGCTGGAGGAGG - Intronic
1093963726 12:25303360-25303382 GCTGCTGGCTGTGTGGGAGCTGG + Intergenic
1094127557 12:27039415-27039437 GCTACTGGCGAGGCTGAAGCAGG + Intronic
1094494562 12:30981257-30981279 GCTGCTGGAGGGCCGGGTGCTGG - Intronic
1094716910 12:33022779-33022801 GTGGCTGGCCGGGCGGGAGCTGG + Intergenic
1094716932 12:33022826-33022848 GTGGCTGGCCGGGCAGGGGCTGG + Intergenic
1095347402 12:41167916-41167938 GCTGCTGGGGAGGCAGGCCCGGG - Intergenic
1095513959 12:42985151-42985173 GATGGTGGTGGGGCAGGACCTGG + Intergenic
1096148611 12:49295307-49295329 GCTGCTGGAGAAGCGGGAGCTGG - Exonic
1096195839 12:49648315-49648337 GCTGCTGGACGTGAAGGAGCTGG - Exonic
1096298060 12:50400868-50400890 GCTGACGGCAGGGGAGGAGCCGG + Intronic
1096309180 12:50505206-50505228 GCAGCTGGCGGAGCTGGAGCTGG + Exonic
1096429902 12:51534390-51534412 ACTGGTGGCGGGGCGGGGGCGGG + Intergenic
1096550499 12:52368897-52368919 GCAGCTGGTGGGGGAAGAGCAGG + Intergenic
1096981216 12:55729021-55729043 GCGGCAGGCGGGGCGGGAGCCGG - Intronic
1097188986 12:57210563-57210585 GCTGGAGGCGAGGCAGGGGCTGG - Intronic
1097191522 12:57221655-57221677 GCTGCTGTCGGCGCGGGGGCGGG - Intronic
1097430974 12:59506580-59506602 GCTGCTGGGGAGGCTGAAGCAGG - Intergenic
1097990335 12:65825861-65825883 GCTGCTCGCGGGTCGGGGGCTGG + Intronic
1098355637 12:69610334-69610356 GCTCCTGGAGGCGCCGGAGCTGG + Exonic
1098394770 12:70005997-70006019 GCTGCTGCCAGGGCTGAAGCAGG + Intergenic
1100611730 12:96195867-96195889 GGGGCTGGCGGGGAAGGGGCGGG - Intronic
1101436542 12:104669218-104669240 GGAGCTGGCGGGGCAGGAGAAGG - Intronic
1101477275 12:105062781-105062803 ATTGCTGGCTGGGGAGGAGCTGG - Intronic
1101487678 12:105182135-105182157 GCTACTGGAGAGGCTGGAGCAGG - Intronic
1101683731 12:106995804-106995826 TCTGTTGGGGGGGCAGGGGCAGG - Intronic
1102323394 12:111957582-111957604 GCGGCTGGCCGGGCGGGGGCTGG - Intronic
1103220361 12:119239280-119239302 GCTGTGGGCTGGGCAGGACCTGG - Intergenic
1103567338 12:121823226-121823248 GTGGCTGGCCCGGCAGGAGCAGG - Exonic
1103641366 12:122355198-122355220 GCTGCTGGCGGAACGGGATCTGG - Exonic
1103902103 12:124308701-124308723 GCTGCTGGCTGGGCAGGTCCCGG - Intronic
1103942543 12:124508884-124508906 GCTGATGGGGGGACAGGAGGTGG + Intronic
1104215025 12:126726566-126726588 GCTGCTGGCGGAGCCGGGGACGG - Intergenic
1104598221 12:130134265-130134287 GGTGCTGGGGAGGGAGGAGCTGG - Intergenic
1104678686 12:130733360-130733382 GCTACTGGAGGGGCTGGGGCAGG + Intergenic
1104864020 12:131942098-131942120 GCTGCTGCAGGAGCAGGGGCAGG + Intronic
1104947626 12:132423622-132423644 GCTGCAGGCGGAGCAGGGGCTGG + Intergenic
1104989567 12:132618322-132618344 GCTGCGGCGGAGGCAGGAGCTGG + Intergenic
1105578912 13:21675577-21675599 GCTGCTGCCGGAGGAGGAGGAGG - Intronic
1105701310 13:22937583-22937605 GCTGCTGGAGGAGGGGGAGCTGG - Intergenic
1106027465 13:25968602-25968624 GCTGGAGGAGGTGCAGGAGCTGG + Exonic
1106165947 13:27246583-27246605 GCTGCTTGCGGGGCTGAAGCAGG - Intergenic
1107851680 13:44577476-44577498 GGGTCTGGCGGGGCAGGAGGCGG + Intergenic
1107910489 13:45101017-45101039 GCTGCTGGCATGCGAGGAGCTGG + Intergenic
1108350230 13:49585243-49585265 GGTGCTGGCGGGGCCGGGCCGGG + Intronic
1109149263 13:58823893-58823915 GGCGCTCGCGGGGCAGGCGCGGG - Intergenic
1112783318 13:102925823-102925845 GCAGCTGCTGGGGCTGGAGCAGG + Intergenic
1112832032 13:103464793-103464815 GCTGCTCTGGGGGCAGGGGCTGG + Intergenic
1113146058 13:107208884-107208906 TCTGCTGGAGGGGGAGGAGGGGG - Intronic
1113231207 13:108215550-108215572 GCTGCTCGCCGCGCAGGCGCAGG + Intronic
1113593937 13:111518282-111518304 GATGCTGGGGGGGCAGGTGAGGG - Intergenic
1113661370 13:112108285-112108307 GCAGGTGGGGTGGCAGGAGCTGG - Intergenic
1113674124 13:112196373-112196395 GGTGCTGAGGAGGCAGGAGCAGG - Intergenic
1113747720 13:112756549-112756571 GCGGATGGCGGGGCAGGTGGGGG + Intronic
1113927868 13:113951341-113951363 CCTGCGGGCCGGGCTGGAGCCGG + Intergenic
1114050389 14:18916270-18916292 GCTCCTGGCCCGGCTGGAGCCGG + Intergenic
1114112169 14:19485662-19485684 GCTCCTGGCCCGGCTGGAGCCGG - Intergenic
1114610391 14:24036388-24036410 GCTGAGGGCGGGGAGGGAGCAGG + Intergenic
1115768478 14:36647317-36647339 GGTGCTGGCGCGGCGGGAGTCGG - Intergenic
1115804940 14:37040086-37040108 GCTACTCGGGAGGCAGGAGCAGG + Intronic
1115830968 14:37340593-37340615 GCTCCTCCCGAGGCAGGAGCTGG - Intronic
1118220718 14:63852937-63852959 GCGGCGGGCGGGGAAGGCGCGGG + Intergenic
1119163380 14:72471706-72471728 GCTGCTGGGTGGTCAGGAGGTGG - Intronic
1119722018 14:76898114-76898136 GCGGCTGGCGGGGCGGGGGCTGG + Intergenic
1119835777 14:77747757-77747779 GCGGCTGGCCAGGCAGGGGCTGG - Intronic
1120406521 14:84099487-84099509 GCGGCTGGCCGGGCGGGGGCTGG + Intergenic
1120406544 14:84099533-84099555 GCGGCTGGCCGGGCGGGGGCTGG + Intergenic
1120521259 14:85530442-85530464 GACGCTGGCGCGGCAGCAGCGGG - Exonic
1121122044 14:91382179-91382201 TCTGCTGTGGGGGCAGGAGGTGG - Intronic
1121266965 14:92610502-92610524 ACTACAGCCGGGGCAGGAGCAGG - Intronic
1121310415 14:92932629-92932651 GCGGCTGGAGGGGCAGGAGGAGG + Exonic
1121975234 14:98397235-98397257 GATGAGGGCAGGGCAGGAGCCGG + Intergenic
1122117544 14:99535396-99535418 GCTGCAGGTGGGGCAGGCGTGGG - Intronic
1122445037 14:101761835-101761857 GCTGCTGCGGGGGCAGGCGGCGG + Exonic
1122727007 14:103762759-103762781 GCTGCTGTGGGGGCAGGTGGTGG + Intronic
1122830666 14:104394055-104394077 GCTGCTGCCTGGGCACGAGTGGG + Intergenic
1122959415 14:105087654-105087676 GCCGCTGGCGGAGCAGCGGCGGG + Intergenic
1123120728 14:105915201-105915223 GCTGCTGGCTGTGGAGGAGCTGG + Intergenic
1123158804 14:106257656-106257678 ACTGAGGGCGGGACAGGAGCAGG - Intergenic
1123180135 14:106461565-106461587 GCTCCTGGATGGGCAGAAGCAGG - Intergenic
1123219805 14:106844808-106844830 GCTGCAGGAGGGGCCGGTGCGGG - Intergenic
1123403445 15:20006764-20006786 GGTGCTGGCTGTGGAGGAGCTGG + Intergenic
1123473713 15:20572324-20572346 GCTGCTGGAGCTGCAGGAGATGG + Intergenic
1123512783 15:21013418-21013440 GGTGCTGGCTGTGGAGGAGCTGG + Intergenic
1123644296 15:22428029-22428051 GCTGCTGGAGCTGCAGGAGATGG - Intergenic
1123734013 15:23167335-23167357 GCTGCTGGAGCTGCAGGAGATGG + Intergenic
1123980480 15:25597449-25597471 GCTGCTGGTGGAGCAGGAACCGG - Intergenic
1124139786 15:27067301-27067323 GCAGCTGGCGGGGCAGGGCTAGG + Intronic
1124284516 15:28388646-28388668 GCTGCTGGAGCTGCAGGAGATGG + Exonic
1124298181 15:28522968-28522990 GCTGCTGGAGCTGCAGGAGATGG - Exonic
1124957243 15:34367365-34367387 GCGGCTGCCAGGGCTGGAGCGGG + Intergenic
1124959073 15:34381829-34381851 GCTGCTGGAGCTGCAGGAGATGG - Exonic
1124975699 15:34528050-34528072 GCTGCTGGAGCTGCAGGAGATGG - Exonic
1125675842 15:41502264-41502286 GGGGCAGGCGGGGCGGGAGCGGG - Intronic
1125685015 15:41558949-41558971 GCTGCGGGCGGGCCGGGAGGAGG + Intronic
1125702960 15:41704544-41704566 GCTGCTGGGGAGGCTGAAGCAGG + Intronic
1125728865 15:41881965-41881987 GCGGCTGGAGGAGCAGGGGCGGG - Exonic
1125729929 15:41887353-41887375 CCTGGTGGCTGAGCAGGAGCTGG - Exonic
1127089200 15:55449808-55449830 GCTACTAGCGGGGCTGGGGCAGG - Intronic
1127147150 15:56036018-56036040 CCTACTGGTGAGGCAGGAGCAGG - Intergenic
1127428972 15:58883647-58883669 GGTGACGGCCGGGCAGGAGCAGG - Exonic
1127644687 15:60947023-60947045 GCGGCTGGCCGGGCGGGGGCTGG - Intronic
1127793935 15:62422645-62422667 GCTGCTGGAGTGCCAGGAGATGG - Intronic
1128114713 15:65097941-65097963 GATGGTGGTGGGGCAGGAACGGG + Intronic
1128455242 15:67828151-67828173 GCCACTGGCGGGGCGGGCGCGGG - Intronic
1128562678 15:68678942-68678964 GCTGCTGGAGGGGCAGGGAGGGG - Intronic
1128986858 15:72228695-72228717 GGTGCTGTGGGGGCAGGAGTGGG - Intronic
1129169221 15:73797734-73797756 GCTGCAGGACTGGCAGGAGCGGG + Intergenic
1129319824 15:74768298-74768320 GCGGCTGGAGGGGAAGGAGATGG - Intergenic
1129322324 15:74782185-74782207 GGCGCGGGTGGGGCAGGAGCGGG - Exonic
1129386991 15:75201840-75201862 GCTGGGGGCGGGGCGGGGGCGGG - Intronic
1129414617 15:75368351-75368373 GCCGCGGGCAGGGCAGGGGCCGG - Intronic
1129419504 15:75412791-75412813 GGAGCTGGCTGGGCAGGAGCTGG + Exonic
1129476319 15:75786534-75786556 GCTGCTGGAGCTGCAGGAGCTGG + Intergenic
1129522331 15:76193756-76193778 GCTGGTGGGGAGGCAGGGGCAGG - Intronic
1129530652 15:76261633-76261655 GCTGCTGTGGCGGCAGCAGCAGG + Intronic
1129667643 15:77588408-77588430 CCAGCTGGAGGGGCAGGCGCGGG - Intergenic
1129680580 15:77656482-77656504 GCGGCTGCGGGGGGAGGAGCTGG - Intronic
1129868691 15:78927539-78927561 GATGGTGGCGAGGCAGGAGATGG - Intronic
1130128785 15:81118461-81118483 GCTGCTTGTGGGACCGGAGCGGG + Intronic
1132130734 15:99275990-99276012 GCTGCTGATGGGACAGGAGGTGG - Intronic
1132321912 15:100931629-100931651 TCTGCTGGTGGGGCTGGCGCGGG + Intronic
1132478662 16:154652-154674 GCAGCTCCCGGGGCGGGAGCGGG + Intronic
1132507278 16:317398-317420 GCTGCTCGGGAGGCAGGTGCAGG + Intronic
1132649540 16:1014272-1014294 GGTGTTGGCGGGGCTGGGGCTGG + Intergenic
1132691049 16:1182112-1182134 GCTGTGGCAGGGGCAGGAGCAGG + Intronic
1132694354 16:1195302-1195324 GCTCAGGGCGGGGCAGGGGCGGG + Intronic
1132697797 16:1209699-1209721 GCTGCTGCCGAGGCAGGGCCAGG + Intronic
1132769546 16:1553650-1553672 GGTGCTGGGTGGGCAGAAGCGGG + Intronic
1133021705 16:2969754-2969776 GCTGCTGGCGGGCCGGTACCCGG - Exonic
1133188467 16:4116416-4116438 ACAGCGGGCGGGGCAGGGGCCGG - Intergenic
1133203445 16:4218633-4218655 GCTGCTGGTGATGGAGGAGCAGG - Intronic
1133205759 16:4232620-4232642 GCTGCTTGGGAGGCTGGAGCAGG - Intronic
1133284529 16:4684388-4684410 GCTGCAGACAGAGCAGGAGCAGG + Intronic
1133315981 16:4884358-4884380 GCGGCTGGCAGCGCTGGAGCAGG - Exonic
1134172107 16:11976854-11976876 GCAGCTGGAGCGGCGGGAGCCGG - Intronic
1134247633 16:12551837-12551859 GCTGCTGGGGACACAGGAGCAGG + Intronic
1134388233 16:13794152-13794174 GCTGGAGGAGGGGCAGGGGCTGG - Intergenic
1135281723 16:21158725-21158747 GCTGCTCGGCGGTCAGGAGCAGG + Exonic
1135424244 16:22324448-22324470 GCTGCTGGAGGGGAGGGGGCTGG + Intronic
1135607352 16:23836095-23836117 GCTGCGGGCCGGGGAGGCGCGGG - Exonic
1136248716 16:28989846-28989868 TCTGCGGGAGGGGCAGGAGCTGG + Intronic
1136500811 16:30668997-30669019 GCTGAGGGTGGGGCAGGGGCAGG - Intronic
1136512790 16:30749105-30749127 GCTGCTGGTGGTGCTGGTGCTGG + Intronic
1136534968 16:30893942-30893964 CATGCTGGCGGGGCTGGGGCCGG + Exonic
1137247625 16:46718525-46718547 GCTGCTTGGGAGGCAGGTGCTGG + Intronic
1137613493 16:49834466-49834488 TCTGCTGGAGAGGCTGGAGCCGG - Intronic
1137668623 16:50266503-50266525 GCTGCTGCCGCTGCCGGAGCAGG + Exonic
1138455230 16:57117135-57117157 GCTGCCGCAGGGGCAGGAGAAGG + Intronic
1139461158 16:67123463-67123485 GCTACTGGGGAGGCTGGAGCAGG + Intronic
1139636487 16:68261312-68261334 CCTGCTGACCAGGCAGGAGCAGG - Intergenic
1139890646 16:70251504-70251526 GCTGCAGGAGGCGCTGGAGCCGG - Exonic
1139924460 16:70478529-70478551 CCTGCGGACGGGGCAGGAGAAGG - Exonic
1140188457 16:72794917-72794939 GCAGCTGGCTGGCCAGGAGTGGG + Exonic
1140442573 16:74999083-74999105 GCGGCTGGCGGGGCCGGCGGCGG + Exonic
1141204857 16:81925773-81925795 GCTACTGGCGGGGCTGAGGCAGG + Intronic
1141582740 16:85011388-85011410 GCTCATGGCCGGGCTGGAGCGGG + Exonic
1141605568 16:85151659-85151681 CCTGCTGCCTGGGCAGGAGCGGG - Intergenic
1141699030 16:85634025-85634047 GCTGGTGGCGGGGCTGCCGCTGG - Exonic
1141996107 16:87637333-87637355 GATGATGGCCGGGGAGGAGCAGG - Intronic
1142031701 16:87841702-87841724 GCTGCAGCCGGGGCAGGGGCAGG + Intronic
1142142901 16:88480446-88480468 GGTGCTGGTGGGGGAGGAGCGGG + Intronic
1142195793 16:88738796-88738818 GCTCCTGGCTGGGCAGGTGTGGG - Intronic
1142202577 16:88768171-88768193 CCAGCTGGTGGGGCAAGAGCTGG + Intronic
1142274135 16:89107097-89107119 GCTTCTGAGGTGGCAGGAGCAGG - Intronic
1142319745 16:89373429-89373451 GGTGCTGGCGTGGCTGGAGAGGG - Intronic
1142890175 17:2938023-2938045 GTGGCAGGCTGGGCAGGAGCAGG + Intronic
1143034084 17:3984534-3984556 GCTACTGGGGGGGCTGGGGCAGG - Intergenic
1143109428 17:4545025-4545047 GCTGCAGGCTGGGAAGGCGCTGG - Exonic
1143371641 17:6444246-6444268 GCTGGCGGCGGGGCGGGGGCCGG + Intergenic
1143618943 17:8070193-8070215 GCTGCTGGGGAGGCTGAAGCAGG + Intergenic
1143758846 17:9086569-9086591 GCCACTTGCGGGGCAGGATCAGG + Intronic
1143852878 17:9825842-9825864 GCTTTTGGGGGGGCAGGGGCGGG + Exonic
1143990215 17:10952859-10952881 GCTGCTCGGGGGGCTGAAGCAGG - Intergenic
1144646879 17:16981121-16981143 ACTCCTGGCAGGGCAGCAGCAGG - Intergenic
1144762570 17:17715656-17715678 ACTGCTGGAAGGTCAGGAGCGGG - Intronic
1144833291 17:18143601-18143623 GCTGCTGTGGGAGCAGGAGGTGG + Exonic
1145098622 17:20054307-20054329 GCTGCAGGAGAGACAGGAGCTGG - Intronic
1145235309 17:21203758-21203780 GCTGCTGGGTGGTCAGGAGCTGG - Intronic
1145937086 17:28720703-28720725 GCTTTAGGAGGGGCAGGAGCTGG - Exonic
1147334140 17:39716610-39716632 GCTGCTGGCGGGCTCAGAGCTGG + Intronic
1147382511 17:40063738-40063760 GTTGCTGGCTGGGGAGGAGAGGG + Intronic
1147512627 17:41084451-41084473 GCAGCTGGGGCGGCAGCAGCTGG - Exonic
1147513882 17:41097773-41097795 GCAGCTGGGGCGGCAGCAGCTGG + Exonic
1147514365 17:41101871-41101893 GCTGCTGGAGATGCAGCAGCTGG + Exonic
1147516584 17:41123673-41123695 GCTGCTGGAGATGCAGCAGCTGG + Exonic
1147661870 17:42121147-42121169 GCTGCAGCTGGGGCAGGGGCTGG + Exonic
1147768905 17:42854548-42854570 GCTGCTGGAGATGGAGGAGCAGG + Exonic
1148073176 17:44920595-44920617 GTTGGCGGAGGGGCAGGAGCTGG + Intergenic
1148105862 17:45118492-45118514 GCTGCAGGGGTGGCAGGAGAGGG + Exonic
1148105951 17:45118959-45118981 GCTGCTGAAGCGGCCGGAGCTGG - Exonic
1148206134 17:45781427-45781449 GCTGCTGGCTGGACAGGAAGGGG + Intergenic
1148225222 17:45894571-45894593 GCTGCTGTTGGTGCCGGAGCTGG - Exonic
1148356553 17:46979213-46979235 GCAACAGGCGGCGCAGGAGCTGG + Exonic
1148382388 17:47209477-47209499 GCTGGTGCAGGGGCTGGAGCTGG - Exonic
1148468591 17:47879314-47879336 ACTGCTGGCAGGGGAGGAGGTGG + Intergenic
1148581906 17:48750027-48750049 AGGGCTGGCGGGGCAGGAGTTGG + Intergenic
1148688391 17:49513251-49513273 GATGGTGACGGGGCAGGGGCAGG - Exonic
1148793187 17:50184980-50185002 GGTGCTGGGCGGGCAGGAGCGGG + Exonic
1148798614 17:50209676-50209698 GCTGCAGGGAGGGGAGGAGCAGG + Intergenic
1148856723 17:50582989-50583011 GCTGGGGGTGGGGCAGGAGGAGG + Intronic
1150239828 17:63622583-63622605 GCCGCGGGCGGAGCCGGAGCCGG + Exonic
1150266254 17:63834199-63834221 GCTGCAGGATGGGCACGAGCGGG - Exonic
1150302188 17:64055867-64055889 GCTGCTGCTGCTGCAGGAGCTGG + Exonic
1150402992 17:64874482-64874504 GCGGCTGGCCGGGCGGGGGCTGG - Intronic
1150427153 17:65086055-65086077 GCAGATGGGGGAGCAGGAGCCGG - Intergenic
1151537904 17:74749002-74749024 GCTGCTGGCGGGGGACCGGCTGG + Exonic
1151670297 17:75568501-75568523 GGTGCTGGCTGAGGAGGAGCTGG + Exonic
1151696625 17:75721341-75721363 GCACCTGTCGGGGCAGGAGCTGG - Intronic
1151746611 17:76014974-76014996 GCTGCTGGCGAGGCAGGTCTTGG + Exonic
1151810934 17:76441436-76441458 GCTGCAGGAGGGGCAGGAAAGGG - Intronic
1151895084 17:76974724-76974746 GCTCTTGGGGGGCCAGGAGCAGG + Intergenic
1151969556 17:77450723-77450745 GAGGCTGGAGAGGCAGGAGCTGG + Intronic
1152017770 17:77762983-77763005 GATGGGGGCAGGGCAGGAGCTGG + Intergenic
1152317253 17:79588416-79588438 GCTCCTGGAGTGGCAGGAGGAGG - Intergenic
1152418495 17:80178522-80178544 GCTGCTGGGTGGGACGGAGCTGG - Exonic
1152423548 17:80206853-80206875 GCTGAGGGCAGGGCAGGAGCTGG - Intronic
1152433320 17:80261066-80261088 GCCGCGGGCGGGGCTGGACCGGG - Intronic
1152466925 17:80471731-80471753 GCTGGTGCTGGGCCAGGAGCAGG - Exonic
1152471483 17:80492238-80492260 GCAGGTGGCGGGGCAGGTGGTGG + Intergenic
1152471558 17:80492480-80492502 GCAGGTGGCGGGGCAGGTGGCGG + Intergenic
1152554484 17:81046101-81046123 GCAGCTGGGCGTGCAGGAGCCGG - Intronic
1152579062 17:81158003-81158025 AGTGCTGGCTGGGCAGCAGCAGG + Intronic
1152593118 17:81223222-81223244 GGAGCTGGCCGGGCAGGGGCGGG + Intergenic
1152626329 17:81389430-81389452 GCTGCCTGGGGGGAAGGAGCCGG + Intergenic
1152630669 17:81409455-81409477 GGTTCTGGAGGGCCAGGAGCGGG + Intronic
1152662164 17:81547546-81547568 GGTGCTGGTGGTGCAGGAGATGG + Exonic
1152693079 17:81729945-81729967 GCTGCTGGGGAGGCTGAAGCAGG + Intergenic
1152730644 17:81967977-81967999 GCCGCTGTTGCGGCAGGAGCAGG - Intergenic
1152742227 17:82023359-82023381 GCTGCAGGCGGGGCAGGGCTGGG + Exonic
1152782095 17:82231138-82231160 GCGGCTGGCGGGGCGGGGCCGGG + Intronic
1152821770 17:82441173-82441195 GTTGCTGCCAGGGAAGGAGCCGG - Exonic
1153522164 18:5963456-5963478 GCTGCTTGCGGGCCAGGTGGAGG - Intronic
1153582952 18:6593832-6593854 GGTGCTGGGGGGTCAGGAGAAGG + Intergenic
1153979595 18:10297673-10297695 GCTTCTGGAGGGGGAGAAGCAGG - Intergenic
1154049030 18:10935796-10935818 GCTGCTGGCGAGGCAGGAGCAGG - Intronic
1154173822 18:12068582-12068604 CCTGCGGCCGGGGCCGGAGCTGG - Intergenic
1154193269 18:12247655-12247677 GCTGAGGACGGGGCAGGAGAGGG + Intergenic
1154326556 18:13395538-13395560 GTTGTTGTGGGGGCAGGAGCTGG + Intronic
1154326594 18:13395646-13395668 GCTGGCGTGGGGGCAGGAGCTGG + Intronic
1154367704 18:13726485-13726507 GCGGCTGGCGGGGCCGGGGGCGG - Exonic
1155877497 18:31104624-31104646 GGTGCTGGCAGGGGAGGAACTGG - Intergenic
1156270019 18:35522035-35522057 GCTGCTGGAGTGGCAGGAAGGGG + Intergenic
1156570288 18:38244763-38244785 GCAGCAGGCAGGGCAGGACCAGG + Intergenic
1157313058 18:46566595-46566617 GCTGATGGTGGGGCAGGAATGGG - Intronic
1157479035 18:48040978-48041000 GCTCCTGGTGGTGCAGGAGCAGG - Exonic
1157662836 18:49460555-49460577 GCTGCAGGCCGGACCGGAGCCGG - Exonic
1157867095 18:51196930-51196952 CCTGCTGGAGGAGGAGGAGCTGG - Exonic
1158872287 18:61699588-61699610 GCTGGGGGCTGGGCAGGTGCTGG + Intergenic
1160034156 18:75285886-75285908 GGTGCTGACGGGGCAGGTGGGGG - Exonic
1160096771 18:75880484-75880506 GCTGGTGGCTGGGCCGGGGCTGG - Intergenic
1160165319 18:76506598-76506620 AATGCTGGCAGGGCAGGGGCTGG - Intergenic
1160377141 18:78421712-78421734 GCTGGTGGGTGGGCTGGAGCAGG - Intergenic
1160536443 18:79597035-79597057 GCTGGAGCCGGGTCAGGAGCTGG - Intergenic
1160678208 19:401536-401558 CCTGCTGGTGGGGCTGGAGTGGG - Intergenic
1160691384 19:461911-461933 GCTTGGGGCGGGGCAGGTGCAGG - Intergenic
1160701091 19:507773-507795 GCTGCTGCTGCAGCAGGAGCTGG - Exonic
1160781308 19:878932-878954 GCTGCGGCCGGGGCCGGGGCCGG - Intronic
1160792619 19:929570-929592 GCAGCGGGCGCGCCAGGAGCTGG + Exonic
1160827185 19:1086046-1086068 CGTGCTGGAGGGACAGGAGCAGG - Exonic
1160881837 19:1324523-1324545 GCAGCTGGTGTGGCTGGAGCAGG + Intergenic
1161015394 19:1980561-1980583 GCGGCTGGCGGGGCGGGGCCAGG - Exonic
1161078600 19:2299216-2299238 GCTGCCGGGGAGGCAGGAGGGGG + Intronic
1161120803 19:2525204-2525226 GCTGTGGGAGGGGCGGGAGCAGG + Intronic
1161215753 19:3094453-3094475 GCGGCTGGCGCGGCCCGAGCGGG + Exonic
1161264608 19:3358614-3358636 GCGGCTCGCGCGGCAGGGGCGGG + Intergenic
1161279061 19:3435213-3435235 GCTGGTGGCGGGGGCGGAGCCGG + Intronic
1161293190 19:3506578-3506600 GCTCCTGGAGGGGCCTGAGCTGG - Intronic
1161297168 19:3525998-3526020 GGGGCTGGCTGGGCAGGAGATGG + Intronic
1161428523 19:4217518-4217540 GCTGCGGGCGGCCCTGGAGCAGG + Exonic
1161428669 19:4218007-4218029 GCTGCGCGCGGAGCTGGAGCGGG + Exonic
1161471158 19:4457396-4457418 TCTGGGGGCGGGGCAGGAGGGGG - Intronic
1161478610 19:4499634-4499656 GAAGCTGGCCGGGGAGGAGCTGG + Exonic
1161589657 19:5123604-5123626 GCTTCCTGCAGGGCAGGAGCAGG + Intronic
1161937870 19:7383150-7383172 GCAGCTGGAGGGGCCGGAGAAGG - Exonic
1161951833 19:7471761-7471783 GGAGGGGGCGGGGCAGGAGCTGG + Exonic
1161961627 19:7526609-7526631 GCTGGTGGGCGGGCAGGTGCTGG + Intronic
1161961649 19:7526681-7526703 GCTGGTGGGCGGGCAGGTGCAGG + Intronic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1162565716 19:11445114-11445136 GCCACTGGTGGGGCTGGAGCAGG - Intronic
1163284883 19:16340240-16340262 GCTCCTGGTGGGGCAGTTGCTGG - Intergenic
1163287113 19:16355758-16355780 GCGGCTGCGGCGGCAGGAGCAGG - Exonic
1163366466 19:16878505-16878527 GGTGGTGGCGGAGCAGGACCAGG - Exonic
1163392303 19:17038156-17038178 GCTGCTGGCGGAGCCGAGGCGGG - Intergenic
1163631344 19:18419445-18419467 CCTGCGGCCGGGGCCGGAGCTGG + Exonic
1163655234 19:18541971-18541993 GCTGCTGGGGGGACAGGAATTGG + Exonic
1163766267 19:19165122-19165144 GGTGCTGGGGATGCAGGAGCAGG + Intronic
1163996110 19:21048792-21048814 GCGGCTGGCCGGGCGGGTGCTGG + Intronic
1164046937 19:21551313-21551335 GCGGCTGGCTGGGCGGGGGCTGG + Intronic
1164051308 19:21587231-21587253 CCTGCTGTCCGGACAGGAGCGGG + Intergenic
1164065049 19:21708076-21708098 GCGGCTGGCCGGCCAGGGGCTGG - Intergenic
1164105350 19:22105378-22105400 GCGGCTGGCGGGCCAGGGGCTGG - Intergenic
1164156983 19:22602983-22603005 GCTGCTGGAGTTGCAGGAGCTGG + Intergenic
1164244730 19:23419530-23419552 GCGGCTGGCCGGGCGGGGGCTGG - Intergenic
1164244753 19:23419576-23419598 GCGGCTGGCCGGGCAGGGGCTGG - Intergenic
1164301289 19:23964468-23964490 GTTGCTGGCCGGGCGGGGGCTGG - Intergenic
1164623499 19:29711875-29711897 GATGCTGGCCTGGCTGGAGCAGG - Intronic
1164623928 19:29714685-29714707 GTGGCTGGTGGGGCAGGGGCGGG - Intronic
1165093422 19:33397982-33398004 GCTGCGGCCTGGGCAGGACCTGG - Intronic
1165094208 19:33401800-33401822 GCCGTTGGCGGGAAAGGAGCAGG + Exonic
1165236472 19:34426245-34426267 GCTGGTGCCGGGGCCGGGGCCGG + Intergenic
1165256054 19:34577803-34577825 GCTGGGGGCGGGGCAGGGGCGGG - Intergenic
1165313012 19:35039973-35039995 GCGGCCGGCGGGGCAGGAGCTGG - Intronic
1165407040 19:35637375-35637397 ACTGCAGGCGCGGCAGGCGCTGG + Intronic
1166007180 19:39915767-39915789 GCTGTTGGCAGGGCAGGACAGGG + Exonic
1166053432 19:40274709-40274731 GCTGCAGGCAGGGGAGGAGCAGG + Intronic
1166213970 19:41323895-41323917 TCTGCTGGGGGAGCAGGAGCCGG - Exonic
1166326050 19:42051824-42051846 GCGGCAGGAGGGGCAGGAGCTGG - Intronic
1166364324 19:42270741-42270763 GGTGCTGTGGGGGGAGGAGCAGG + Intronic
1166679387 19:44757825-44757847 GCTGGACGCGGAGCAGGAGCCGG - Intronic
1166748368 19:45152699-45152721 GCTGCTGGCGGTGCAGGCGCAGG - Exonic
1166748488 19:45153377-45153399 GCTGCTGGCGGCGCTGGGCCTGG - Exonic
1166789770 19:45391935-45391957 GGAGCTGGTGGGGCAGGAGCAGG + Exonic
1166862174 19:45816875-45816897 GCTGCTGGGGCGGCAGCTGCAGG + Exonic
1166898044 19:46036325-46036347 GCTCTTGGGGGGCCAGGAGCAGG + Intergenic
1166898068 19:46036435-46036457 GCAGCTGCAGGGGCAGGAGGAGG - Intergenic
1167089235 19:47332034-47332056 GTGGCTGGCAGGGCAGGAGAGGG - Intergenic
1167145998 19:47681072-47681094 GCTGCTGGAGGCCCAGGGGCAGG - Exonic
1167221771 19:48204036-48204058 TCTGCTGGCGGGAGAGGAGTGGG + Intronic
1167249164 19:48391525-48391547 GCTGGCGGCGGAGCTGGAGCCGG + Exonic
1167254884 19:48421480-48421502 GAGGCTGGCATGGCAGGAGCTGG - Intronic
1167288222 19:48610736-48610758 GCTGCTGGCGGTCCAGGAGCAGG + Exonic
1167466109 19:49651785-49651807 GCGGCGGGCGGCGCGGGAGCCGG - Exonic
1167926076 19:52821754-52821776 GCAGAGGGCGGGGCCGGAGCGGG + Intronic
1167930260 19:52857740-52857762 GCAGAGGGCGGGGCCGGAGCGGG + Intergenic
1168080217 19:54004670-54004692 GAGGCTGGCGTGGCCGGAGCAGG - Intronic
1168097447 19:54123752-54123774 GCAGCTGTCGGAGGAGGAGCTGG + Exonic
1168110529 19:54189342-54189364 GCTGCTCGCCGGGCAGGAGGCGG + Exonic
1168288157 19:55344658-55344680 GCAGCTGTGGTGGCAGGAGCAGG + Intronic
1168293433 19:55368215-55368237 GCTGCAGCCGGCGCAGCAGCCGG + Exonic
1168354172 19:55691790-55691812 TCTGTGGTCGGGGCAGGAGCTGG - Exonic
1168354846 19:55694736-55694758 GCTGCTGGCAGGAGAGGTGCCGG + Exonic
1168408069 19:56121020-56121042 GCTGCTGGGGGGGCGTGAGTGGG - Intronic
1168594468 19:57664333-57664355 GCTGGCGGCGGGCGAGGAGCTGG + Intergenic
925039346 2:718522-718544 GCTGCTGGCTGGGAGGGAGCAGG - Intergenic
925068759 2:950602-950624 GGGGCTGGCGGGGCAGGGGCCGG - Intergenic
925165073 2:1710878-1710900 GGTGCTGGTGGAGCAGGTGCTGG - Intronic
925216078 2:2096958-2096980 GCCGCTGGCGTGAGAGGAGCTGG - Intronic
925320406 2:2962059-2962081 GCTGCCTGCGGGGCGGGAGTGGG - Intergenic
925404602 2:3597808-3597830 ACTGCTGCTGAGGCAGGAGCCGG + Intronic
925665216 2:6246921-6246943 GCTGCTGGGGAGGCAGAGGCAGG + Intergenic
926008094 2:9388474-9388496 GCTGCAGGCTGGGCGGGAGGTGG - Exonic
926130793 2:10302433-10302455 GCTGCACGCGGGGCTGGGGCTGG + Intergenic
927432863 2:23041733-23041755 GCTGCAGGCTAGGCAGGGGCAGG - Intergenic
927478381 2:23431500-23431522 GCGGCTGCCGGCGGAGGAGCAGG - Intronic
927484050 2:23476966-23476988 GCTACTGAAGGGACAGGAGCTGG + Intronic
927641422 2:24847966-24847988 GAGGCTCGCGGGGCAGGAGGAGG + Intronic
927927513 2:27024206-27024228 TCTGCTGGCGCGGCAGGGCCAGG + Exonic
927932079 2:27051825-27051847 GGGGCTGGCGGGGCCGGGGCTGG - Intronic
927997284 2:27495013-27495035 GCTGCGGGCGGAGCGGGCGCGGG + Exonic
928245766 2:29625774-29625796 GCTGCTGGAGGGCCAGGCTCTGG + Intronic
928635639 2:33243101-33243123 GCTGATGTCTGGGCAGGAGCTGG - Intronic
929650572 2:43676462-43676484 GAAGGGGGCGGGGCAGGAGCGGG + Intronic
929778353 2:44942276-44942298 GGTGCTGGCGGAGCAGGCGGCGG + Exonic
929879682 2:45824929-45824951 GCTGCAGTCAGGGCAGGAGACGG + Intronic
929916573 2:46141906-46141928 CCTGCTGGCAGGGCAGAACCGGG - Intronic
930886409 2:56332030-56332052 GGTACTGACGGAGCAGGAGCAGG - Intronic
931694109 2:64859440-64859462 GCTGCGGGCGGGGCAGCTGCTGG + Intergenic
933512723 2:83261753-83261775 GGTGGTGGCGGGGCAGGGGGTGG + Intergenic
934188187 2:89764135-89764157 CTTGGGGGCGGGGCAGGAGCTGG + Intergenic
934216830 2:90038822-90038844 GCAGCTGGGGGGGCGGGTGCTGG - Intergenic
934559732 2:95306950-95306972 GCTGCTGGGGAGGCGGGAGGAGG - Intronic
934744856 2:96752680-96752702 GCTGCTGGGGAGGCAGAGGCAGG - Intergenic
935326678 2:101943935-101943957 GCTACTCGGGGGGCTGGAGCAGG - Intergenic
935447092 2:103168204-103168226 GCTCCTGGCAGGGCGGGGGCAGG - Intergenic
935971524 2:108534453-108534475 GCTACTGGCGGGCCCGGAGCAGG - Intronic
936111860 2:109671286-109671308 GCTGCAGCCAGGGCAGGGGCAGG + Intergenic
936252463 2:110877149-110877171 GCTGCTGGCTGTGCTGGAGAAGG - Intronic
937127284 2:119482681-119482703 GCTGCTGGCTGGGCCTGAGCAGG + Intronic
937301887 2:120847742-120847764 GCTGCGTGGGGGGCAGGGGCGGG + Intronic
937346528 2:121129620-121129642 GCTGGTGGCGGCGGAGGGGCGGG - Intergenic
937979600 2:127607250-127607272 GCCGCTGGCGAGGCAGTACCAGG + Exonic
938286183 2:130119917-130119939 CCTCCTGGCGGGGGAGGAGGGGG - Intronic
938305472 2:130251644-130251666 GCAGCTGCTGGGGCAGGACCTGG - Intergenic
938336825 2:130508637-130508659 CCTCCTGGCGGGGGAGGAGGGGG - Intronic
938352998 2:130611998-130612020 CCTCCTGGCGGGGGAGGAGGGGG + Intronic
938429426 2:131218979-131219001 CCTCCTGGCGGGGGAGGAGGGGG + Intronic
938572337 2:132572066-132572088 TCTCCTGGCTGGGGAGGAGCTGG - Intronic
940918921 2:159286656-159286678 GAGGCTGGCGGGGCGGGCGCCGG + Intronic
941021923 2:160416585-160416607 ACTGGTGGCGGGGCAGGGGCAGG - Intronic
941403781 2:165063549-165063571 GCTGCTGATGGGACAGGAGGTGG + Intergenic
941819165 2:169827657-169827679 GCTGCAGGCGCTGCTGGAGCGGG + Exonic
941987487 2:171522989-171523011 GCTGCTGGGGGCGGCGGAGCGGG + Intronic
942045454 2:172097003-172097025 GCCCCCGGCGGGGCTGGAGCCGG + Intergenic
942278965 2:174342303-174342325 GCGGCTGGGCAGGCAGGAGCCGG + Intergenic
942414492 2:175744860-175744882 GCTGCTTCCGGGGCCGGGGCAGG - Intergenic
943692415 2:190881639-190881661 GTTGCGGGCGGGGAAGGCGCGGG - Intronic
944402915 2:199348880-199348902 GATGCTGGTGAGCCAGGAGCCGG + Exonic
945157050 2:206849955-206849977 GCTGCTGACCTGGCAGGAGGTGG + Intergenic
945225852 2:207530405-207530427 GCGGCGGGCGGGGTGGGAGCCGG + Intronic
945466001 2:210171281-210171303 GCGGCGGCCGGGGCGGGAGCGGG - Exonic
946159588 2:217828084-217828106 GGTCCTGGCAAGGCAGGAGCTGG - Intronic
946202117 2:218076480-218076502 GCTGCTGAGGGAGCAGGAGGGGG + Exonic
946331736 2:219013449-219013471 GGGGCTGGCTGGACAGGAGCAGG - Intronic
946848006 2:223878247-223878269 GCTGTTGTCAGAGCAGGAGCTGG - Exonic
947287309 2:228530921-228530943 GCTACTTGCGGGGCTGAAGCAGG + Intergenic
947731768 2:232435223-232435245 GCTGCTGATGGGGCCGGAGTTGG - Intergenic
947866684 2:233402636-233402658 GCTGCCGGCCGGACATGAGCTGG - Intronic
947874812 2:233461132-233461154 GCACCTGGCGGGCGAGGAGCAGG - Intronic
947983243 2:234427408-234427430 GCTGATGGCGGGGCCAGAGCTGG + Intergenic
948113194 2:235473437-235473459 GCTGCTGGCAAGGCAGAAGATGG + Intergenic
948219061 2:236254993-236255015 GCAGCTTACAGGGCAGGAGCAGG - Intronic
948330626 2:237161548-237161570 GCATCTGGCAGGGCAGGAGCAGG + Intergenic
948337422 2:237221459-237221481 GCTGGTAGCGGGGCAGAACCTGG + Intergenic
948388993 2:237598633-237598655 GATGCTGGAGGGGACGGAGCAGG - Intronic
948479604 2:238241162-238241184 ACTGACGCCGGGGCAGGAGCCGG - Intergenic
948768005 2:240233386-240233408 GCTGTGGGCGGGGCTGGAGGTGG - Intergenic
948768027 2:240233442-240233464 GCTGTGGGCGGGGCCGGAGAAGG - Intergenic
948907605 2:240987146-240987168 GCTGCTGGGGGTGGAGGAGCAGG + Intronic
1168757554 20:327102-327124 GCTGGTGGCTGTGCAGGAGGGGG - Exonic
1170570054 20:17627521-17627543 GCTGGAGGCGGGCCAGGCGCGGG - Exonic
1170570267 20:17628618-17628640 GCTGGTGGCGGGGCAGGGCCAGG - Intronic
1171188201 20:23138447-23138469 GCTCCTGGCAGGACAGGTGCTGG + Intergenic
1171340197 20:24421335-24421357 CCAGTGGGCGGGGCAGGAGCTGG + Intergenic
1171345416 20:24462137-24462159 GCTGTTGGGGGCACAGGAGCAGG - Intergenic
1172846314 20:37931695-37931717 GCCGCTGCCGCGGAAGGAGCAGG - Exonic
1173486899 20:43447779-43447801 GCTGCTTGGGAGGCTGGAGCAGG - Intergenic
1173649103 20:44651741-44651763 GCGGCGGGCGGGGCGGGAGGCGG - Exonic
1173672921 20:44810437-44810459 CCGGCGGGCGGGCCAGGAGCTGG + Intergenic
1173792079 20:45834215-45834237 GCCGCAGCCGGTGCAGGAGCCGG - Exonic
1173792236 20:45834996-45835018 GCTCCTGGCGCGGCAGCTGCAGG + Exonic
1173860757 20:46281998-46282020 ACAGCTGGCAGAGCAGGAGCTGG + Intronic
1174346826 20:49936448-49936470 GCAGCTGGCGGGGCCGGCGGCGG + Exonic
1174399038 20:50265965-50265987 GCAGCTGAGGGGGCAGGTGCTGG + Intergenic
1174504477 20:51008282-51008304 GTTGGTGGCGGGGCAGGGGGAGG + Intronic
1175392170 20:58634414-58634436 TCTGCTGGATGGGCAGGAGCCGG - Intergenic
1175429367 20:58891223-58891245 GCGGCTGGGAGGGCGGGAGCCGG - Intronic
1175443735 20:59007062-59007084 GCTGCTGGCGGGCGCGGCGCAGG - Exonic
1175448477 20:59042793-59042815 GCTGGGGGCGGGGCAGGGGCAGG - Exonic
1175448539 20:59042988-59043010 GCAGCTGGAGGGGCCGGCGCGGG + Intergenic
1175604838 20:60304307-60304329 GGTGGTGGCAGGGCAGGAGCAGG - Intergenic
1175777716 20:61663588-61663610 GCTGCTGGGACGGCAGGACCGGG + Intronic
1175913197 20:62414261-62414283 GCTGCTGCTGGGCCAGGAGCAGG + Exonic
1176048481 20:63104603-63104625 GCTCCTGGGGGGGCAGGGGTGGG - Intergenic
1176099657 20:63359165-63359187 GCAGGGGCCGGGGCAGGAGCAGG - Intronic
1176099794 20:63359728-63359750 GGTGCAGGCGGGACAGGAGCCGG + Intronic
1176121121 20:63455027-63455049 GCCGCTGCCTGGGCAGGAGGGGG - Intronic
1176284501 21:5012367-5012389 GCTGCTGGAGGGACAGGGGCAGG + Intergenic
1176408250 21:6433593-6433615 GATGATGGGAGGGCAGGAGCAGG - Intergenic
1178513801 21:33229833-33229855 GCCGCTGGCGGGGCTGGAGCAGG - Intergenic
1178860237 21:36282862-36282884 GCTACTGGGGAGGCAGAAGCAGG + Intronic
1179054104 21:37915845-37915867 GCTGCTCGCAGGCGAGGAGCTGG - Intronic
1179658874 21:42862252-42862274 TCTGCTGGAGGGGCAGGAAGGGG + Intronic
1179674812 21:42974367-42974389 GGTGCGGGCGGGGCTGGAGGCGG + Intergenic
1179683743 21:43041919-43041941 GATGATGGGAGGGCAGGAGCAGG - Intergenic
1179796796 21:43789674-43789696 GCGCCTGGCGGGGAATGAGCAGG + Exonic
1179812038 21:43877954-43877976 GCTGGTGGTGGGGCAGGAGGCGG - Intronic
1179872680 21:44251108-44251130 GCTGCTGGAGGGACAGGGGCAGG - Intronic
1179926831 21:44539365-44539387 GCAGCTGGCCTGGCAGGAGGAGG + Exonic
1179935542 21:44601616-44601638 GCAGCTGGCCTGGCAGGAGGAGG - Exonic
1179936975 21:44612258-44612280 GCAGCTGGAGGCACAGGAGCGGG - Exonic
1179949581 21:44702281-44702303 GCAGCTGGCGGCGCAGCAGGGGG - Intronic
1180035886 21:45249004-45249026 GCTGCTGGCATAGAAGGAGCTGG + Intergenic
1180042355 21:45287250-45287272 GATGGGGGCGGGGCGGGAGCCGG - Intronic
1180049968 21:45326604-45326626 GATGCTGTGGGGGCAGGAGCAGG - Intergenic
1180109999 21:45643244-45643266 GGTGGGGGCGGGGCAGGGGCGGG - Intergenic
1180120943 21:45747685-45747707 TCTGCTGGCTGGCGAGGAGCGGG - Intronic
1180180294 21:46115940-46115962 GCTGCAGGCGGGGCGGGCGTGGG - Intronic
1180187451 21:46146482-46146504 GCTCCTGGCGGGGCAGAGGTGGG - Intronic
1180225771 21:46391276-46391298 GCAGCAGGCGGCCCAGGAGCAGG + Exonic
1180468865 22:15638644-15638666 GCTCCTGGCCCGGCTGGAGCCGG + Intergenic
1180639153 22:17284108-17284130 GCTGCTGGGGAGGCTGAAGCAGG - Intergenic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1180841481 22:18960863-18960885 GCTGCTGGCGCGCCCTGAGCAGG + Intergenic
1180951722 22:19723476-19723498 GGTGCGGGCGTGGCAGGGGCGGG + Exonic
1180959235 22:19755240-19755262 GGGGGTGGCGGGGGAGGAGCGGG - Intergenic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1181147418 22:20858759-20858781 GGCGCTCGCGGGCCAGGAGCGGG - Exonic
1181342782 22:22196036-22196058 ACTGCTGCCGGTGCAGGAGATGG - Intergenic
1181374105 22:22441952-22441974 GCGGCTGGCTGGGCGGGGGCTGG - Intergenic
1181518814 22:23433732-23433754 GGGGCGGGCGGGGCAGAAGCAGG + Intergenic
1181539961 22:23567732-23567754 GCTGCTGGCTGGGCTCCAGCTGG + Intergenic
1181816646 22:25442577-25442599 GCTGCTGGGGAGGCTGAAGCAGG - Intergenic
1182153382 22:28047281-28047303 CCTCCTGGCAGGGCAGAAGCAGG - Intronic
1182331165 22:29552581-29552603 GCGGCTGGCCGGGCTGGGGCTGG - Intronic
1182697642 22:32207331-32207353 GCTGCTGCCTGGGCAAGGGCAGG + Intergenic
1182867263 22:33614597-33614619 CCTGCAGGAGGAGCAGGAGCTGG - Intronic
1183411734 22:37658908-37658930 GCTGCTGGAGCGGCTGGCGCGGG + Exonic
1183507916 22:38219765-38219787 GCAGATGGCGGGGCAGGGCCAGG + Exonic
1183593284 22:38794070-38794092 GCTCCTGCGGGGGCCGGAGCCGG + Exonic
1184115465 22:42419308-42419330 GGTTCAGGCAGGGCAGGAGCAGG - Intronic
1184236446 22:43185759-43185781 GAGGCTGGCTGGGCAGGAGCTGG + Intronic
1184491823 22:44814298-44814320 GCTCCTGGCAGGGCAGGTGTTGG + Intronic
1184594540 22:45505881-45505903 GCTGCTGGGGAGGCTGAAGCAGG - Intronic
1184647333 22:45903392-45903414 GGTGGTGGCGGGGCTGGGGCTGG + Intergenic
1184660272 22:45962439-45962461 GCCCCTGGAGGGGGAGGAGCTGG - Intronic
1184754294 22:46507634-46507656 ACTGCGGGCGAGGCAGGAGGAGG - Intronic
1185377150 22:50487867-50487889 CATGCTGGCGGGGAAGGAGAAGG - Exonic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
949518353 3:4827183-4827205 GGTGCTGTCGGGGCAGGAGCAGG - Intronic
949606623 3:5660539-5660561 GCAGCTGGTGTGGCCGGAGCAGG + Intergenic
950298268 3:11850832-11850854 GCTGATGGAGGGGAAGGAGAGGG + Intergenic
950316229 3:12004327-12004349 GGAGCGGGCGGGGCAGGGGCGGG - Intergenic
950496184 3:13335815-13335837 GATGCAGGCAGGGCAGGACCCGG - Intronic
950552574 3:13675570-13675592 GCTGCTGGCAGAGCTGGAGGTGG - Intergenic
951140109 3:19148430-19148452 GCAGCTGGCGGGGGTGGAGGGGG + Intergenic
952312497 3:32202780-32202802 GCTGCTGGAGGGAGAGCAGCTGG - Intergenic
952315612 3:32229713-32229735 GAGGCTGGTGGGGAAGGAGCAGG - Intergenic
952728353 3:36613407-36613429 GCTGCTGGTGGGGCGAGGGCAGG - Intergenic
952788257 3:37176601-37176623 GCTGCTGGCGGGGCGGAGGCCGG + Intronic
952892290 3:38051378-38051400 CCTGCTGCCGTAGCAGGAGCTGG + Intronic
953027571 3:39153712-39153734 GCTCCAGGCGGGGGAGGAGGCGG - Intronic
953125738 3:40090252-40090274 GGTGCTGGCTGGTGAGGAGCTGG + Intronic
953314980 3:41918711-41918733 GCTGCTGGGGAGGCTGAAGCAGG - Intronic
953389818 3:42527622-42527644 GAAGCTGGCCTGGCAGGAGCTGG - Intronic
953768105 3:45759553-45759575 GCTGCTCAGGAGGCAGGAGCTGG + Intronic
953879994 3:46686570-46686592 TCTGCTGGTGGGGCAGGGGGTGG + Intronic
954005621 3:47588222-47588244 GAGGCTGGCGGGCCAGGAGCAGG + Exonic
954292404 3:49656532-49656554 CCAGCTAGTGGGGCAGGAGCTGG - Exonic
954340005 3:49945768-49945790 GCTGCTGGGGAGGCTGGGGCAGG + Intronic
954686590 3:52373346-52373368 GCTGCTGCGGGGGCAGGAAGCGG + Intronic
954693118 3:52406409-52406431 CCTGATGGCGGGGCCGGGGCGGG - Intronic
954697547 3:52435714-52435736 GCTGCTTCCGGAGCCGGAGCCGG - Exonic
954707606 3:52489397-52489419 GCTGCTGCAGGGGCTGGAGCTGG - Exonic
955399026 3:58578006-58578028 GCTGCTGAAGGGGCTGGTGCTGG - Intronic
957079199 3:75622703-75622725 GCTGCTGGCAGGGCATAGGCTGG - Intergenic
959863780 3:111243302-111243324 GCTCTTGGGGGGCCAGGAGCAGG - Intronic
960687217 3:120306806-120306828 GGGGCTGGCTGGCCAGGAGCGGG - Intergenic
960950125 3:122993779-122993801 GCTGTGGGGGAGGCAGGAGCGGG - Intronic
961333990 3:126159278-126159300 GCTGGTGACGGGGCAGGAGGAGG - Intronic
961445986 3:126982093-126982115 GCTCCTGGGGAGGGAGGAGCGGG + Intergenic
961656550 3:128445603-128445625 GCTGCTGGTGGTGCTGGAGGTGG + Intergenic
962202474 3:133413097-133413119 GCTGGAGACAGGGCAGGAGCAGG + Intronic
962259871 3:133895548-133895570 GCGGCCGGCGGTGCGGGAGCCGG + Exonic
962278624 3:134033754-134033776 GCTGCTGGGGAGGCAAGAGAAGG + Intronic
963275936 3:143329829-143329851 GCTGACGGCTGGGCAGGAGCGGG - Intronic
964720402 3:159763926-159763948 GCCGCGGGCGGGGAAGGGGCGGG + Intronic
965820220 3:172677632-172677654 GCTGTTGGTGGGGGAGGGGCGGG + Intronic
966721240 3:183064527-183064549 GCTGGTGGCGTGCCATGAGCAGG - Intronic
967088557 3:186115646-186115668 GGGGCTGGCAGGGCTGGAGCGGG + Intronic
967178476 3:186883179-186883201 GCTGCTTGCGGGGCTGAGGCGGG - Intergenic
967281222 3:187825923-187825945 GCTGCTGGGGAAACAGGAGCAGG - Intergenic
967711291 3:192711246-192711268 GCGGCTGGCCGGGCAGGGGCTGG - Intronic
967814563 3:193788026-193788048 GGGGCTGGCGGGGCAAGTGCAGG + Intergenic
968262931 3:197339768-197339790 GCTGCTGCCCAGGCAGGAGACGG - Intergenic
968550657 4:1222133-1222155 GCTCCAGGCGGGGCCGGTGCTGG - Intronic
968646607 4:1744248-1744270 GCTGCAGGTGTGGCAGGAGGGGG + Intronic
968653138 4:1767777-1767799 GCTGCTGGCGGAGCGGGGTCGGG - Intergenic
968658333 4:1788073-1788095 GGTGCTGGGGGGGCAGAAGTGGG + Intergenic
968753488 4:2402351-2402373 GCAGCGGGCGGGGCGGGAGATGG - Intronic
968761277 4:2443778-2443800 CCTGCTGGGGAGGCAGGAGAAGG - Intronic
968771507 4:2510552-2510574 GCTACTGGCAGGGCAGGGGATGG - Intronic
968828145 4:2914792-2914814 GCTGCAGGCAGGGCGGGGGCAGG - Intronic
968917876 4:3505103-3505125 GCTGCGTGCGTGGCAGGACCCGG - Intergenic
968969859 4:3788164-3788186 GGGGCAGGAGGGGCAGGAGCTGG - Intergenic
969203278 4:5622649-5622671 GCAGCTGGAGGGGGAGGAGAGGG - Exonic
969283789 4:6189920-6189942 GCTGCAGGCGTGGCAGGAGAGGG + Intronic
969411593 4:7031951-7031973 GCTCCTCGAGGTGCAGGAGCAGG + Exonic
969532818 4:7739277-7739299 GCTCCTGCTGGGGCAGGAGGTGG + Intronic
969583407 4:8078414-8078436 TCTGCTGGAGGGGCAGGCCCAGG - Intronic
969626086 4:8306485-8306507 GCAGTAGGAGGGGCAGGAGCAGG - Exonic
970124288 4:12791976-12791998 GCTGGAGATGGGGCAGGAGCTGG + Intergenic
970385269 4:15549689-15549711 GCTACTTGCGGGGCTGGGGCAGG + Intronic
970664307 4:18319337-18319359 GGTGCTGGGGGAGCAGGAGCGGG + Intergenic
971258152 4:25031775-25031797 GCTCCTGGCTGGGCAGGATGGGG + Intergenic
971622418 4:28872595-28872617 GCTGCTGGGGAGGCTGAAGCAGG - Intergenic
972654199 4:41049514-41049536 GCGGCTGGCCGGGCGGGGGCTGG - Intronic
973744416 4:53949133-53949155 GCTGCTTGCGGGGCTGAGGCAGG + Intronic
975870845 4:78776607-78776629 GGGGCTGGCGGGGCCGGGGCCGG + Exonic
976547950 4:86359568-86359590 GCTCCTGGTGGGGCGGGAGAGGG - Intronic
977167017 4:93711755-93711777 GCTGCTGCTGGGGCATGGGCGGG + Intronic
977518904 4:98056342-98056364 GCAGCTGGCGGGGAAGCAGGGGG - Intronic
978976688 4:114884282-114884304 GCTGCTGGGGAGGCAGGAAGAGG + Intronic
979523831 4:121697085-121697107 GCTGAGGCCGGGGCAGGGGCGGG - Exonic
982176501 4:152710151-152710173 GCTCCTGCTGGGGCAGGACCTGG - Intronic
982358098 4:154491067-154491089 GCTGCCGGCCGCGCAGCAGCAGG - Intronic
982655078 4:158137722-158137744 GATGCTGGCGGGGGTGGAGCAGG - Intronic
982745675 4:159102921-159102943 GCCGCTGGCGGGCGGGGAGCGGG + Intergenic
982918900 4:161249794-161249816 GCTCCTGGCTGGAAAGGAGCAGG - Intergenic
984639330 4:182144710-182144732 GCTGCTGCCGGGGAGCGAGCCGG + Intronic
984785882 4:183566919-183566941 GCTGGTGGTGGGGAAGCAGCTGG - Intergenic
985478845 5:94584-94606 GTGGCTGGCGGGGCTGGAGGGGG + Intergenic
985482906 5:128569-128591 GCTGCCTGCGGGGCTGGAGGTGG + Intergenic
988100460 5:26669800-26669822 GCAGCTGAAGGTGCAGGAGCTGG - Intergenic
989231828 5:39095742-39095764 GCTGCTGGGGAGGCTGAAGCAGG + Intergenic
991692332 5:69237097-69237119 TGTGGTGGCGGGGCAGGAGGAGG + Intronic
994625704 5:102215748-102215770 GCTGCTGGGGAGGCTGAAGCAGG + Intergenic
995745057 5:115394167-115394189 GCTCTTGGGGGGCCAGGAGCAGG - Intergenic
995876138 5:116792264-116792286 GCTGCTGGGGAGGCTGAAGCAGG - Intergenic
996927494 5:128845789-128845811 GCTGCTGGCGGGGTGGGGGAGGG - Intronic
996978898 5:129465670-129465692 GCTGCTGTCAGGGCAGGAATGGG + Intronic
997265229 5:132491139-132491161 CCTCCTGGCGGGGCGGGGGCGGG + Intergenic
997350174 5:133225373-133225395 GCTGCTGGCTGCCCAGGGGCTGG - Intronic
997457375 5:134027275-134027297 GCTGCTGATGGGGCGGGAGAGGG - Intergenic
998060093 5:139112639-139112661 GCGGCTGGCCGGGCGGGGGCTGG - Intronic
998136038 5:139675172-139675194 GCTGCTGTCGAGGTAGGTGCAGG + Intronic
998161000 5:139813002-139813024 GCTGGCAGCGGGGCAGGGGCAGG + Intronic
998987961 5:147782820-147782842 GCTGCTGGCCCGGCAGCTGCTGG + Intronic
999264177 5:150255728-150255750 GCTGCTGAGGAAGCAGGAGCTGG + Intronic
999447560 5:151652265-151652287 GCCGTTGGTGGGGCAGGAGCTGG + Intergenic
1000353373 5:160370416-160370438 GCTGCGGGCGGGGCGGGATGCGG - Intronic
1001403060 5:171457648-171457670 GCTGGTGGCAGGGCGGGGGCAGG + Intergenic
1001808459 5:174609047-174609069 GCTGAGCGCGGGGCATGAGCTGG - Intergenic
1001992792 5:176132478-176132500 GGTGCTGGTGGGGCAGGGGTGGG + Intergenic
1002103143 5:176867241-176867263 GCTACAGACGGGGCAGGAGGAGG + Intronic
1002106223 5:176880604-176880626 GCTGGGGGAGGGGCAGGGGCAGG - Exonic
1002123358 5:177022810-177022832 GTTGCTGGAGGGCCAGGAGCCGG + Exonic
1002252608 5:177939059-177939081 GCTGCTGGGGAGCCTGGAGCTGG + Intergenic
1002288281 5:178180152-178180174 GTTGGGGGCGGGGCAGGGGCGGG + Intergenic
1002401726 5:178994875-178994897 GCCGCTGGCGTGGCTGGCGCAGG - Exonic
1002419312 5:179137497-179137519 GCTGCGGGCTCGGCAGGGGCCGG - Intronic
1002458732 5:179361795-179361817 GCCTCTGGCGGGGCTGGAACTGG - Intergenic
1002466592 5:179411842-179411864 CGTGCTGGCGGAGCAGGAGGAGG - Intergenic
1002508161 5:179695159-179695181 GCTGCTGGGGAGGCTGGGGCAGG - Intronic
1002640800 5:180629767-180629789 GCTGCTGGTAGGGGAGAAGCTGG - Exonic
1002721710 5:181265346-181265368 GCTGCTGGCAGAGGAGGAGTGGG + Intergenic
1003076565 6:2988337-2988359 GCTCCAGGTGGGGCAGGAGTGGG + Intronic
1003145241 6:3504857-3504879 GCTGCTGGCTGGGGGGGAGGTGG + Intergenic
1003271710 6:4613434-4613456 GATGCTGGCTGGGAAGGAGCAGG - Intergenic
1003299171 6:4861322-4861344 GCTGGTGGCTGGGGAGGAGGTGG + Intronic
1003305363 6:4922193-4922215 ACTGCTGGCCGGGCAGTACCAGG - Intronic
1003352475 6:5330991-5331013 GCTACTTGCGGGGCTGAAGCCGG + Intronic
1004229021 6:13814375-13814397 GCTGGCGGCCGGGCAGGCGCTGG + Exonic
1004755021 6:18601617-18601639 GCTGCTGGCGATGGAGCAGCTGG + Intergenic
1005494325 6:26375442-26375464 GCTGCTGGCAGGGAGGAAGCAGG + Intronic
1005498812 6:26412339-26412361 GCTGCTGGCAGGGAGGAAGCAGG + Intronic
1005503572 6:26450887-26450909 GCTGCTGGCAGGGAGGAAGCAGG + Intronic
1005873451 6:29994515-29994537 CCTGCTGGAAGGGCAGGAGGGGG - Intergenic
1005966599 6:30731013-30731035 GCAGGTGGCAGTGCAGGAGCAGG - Exonic
1006117424 6:31782579-31782601 GCTGGTGGCGCTGAAGGAGCGGG - Exonic
1006277104 6:33013819-33013841 CCTGCTGGAGTGGGAGGAGCTGG - Intergenic
1006369211 6:33633807-33633829 GCTGGGGGCGGGGCGGGCGCGGG + Intronic
1006634577 6:35452641-35452663 GCTGCAGGCGGGGCCTGAGGGGG + Exonic
1006749319 6:36366689-36366711 GCCGCTGGAGAGCCAGGAGCAGG - Exonic
1006910367 6:37559452-37559474 GCTGCAGGCAGAGCTGGAGCTGG + Intergenic
1007564033 6:42834827-42834849 GTTGATGGTAGGGCAGGAGCAGG - Intronic
1007576684 6:42929639-42929661 GCTGCTGCCGGCCCCGGAGCTGG + Exonic
1007721781 6:43889466-43889488 TCTGCTGGCCAGGGAGGAGCAGG - Intergenic
1009274245 6:61654863-61654885 GCTGCTGCTGGGGAAGGCGCAGG + Intergenic
1009425960 6:63513797-63513819 GCTGCTCGCGGGGCTGAGGCAGG + Intergenic
1010985134 6:82414851-82414873 GCTGCTGGAGGAGCAGCAGTGGG + Intergenic
1011426741 6:87239376-87239398 GCGGCTGGCGGGCCGGGGGCTGG + Intronic
1012716047 6:102671928-102671950 GCTGAGGGCAGGGCAGGAGTAGG + Intergenic
1013507530 6:110815091-110815113 GCTGGCGGCGGAGCGGGAGCGGG - Exonic
1014783978 6:125597175-125597197 GCTGCTGGGGTGGGAGAAGCTGG - Intergenic
1015226615 6:130864441-130864463 GCTGCGAGCGGGGCTGGAGGAGG + Intronic
1015275045 6:131375521-131375543 ACTGCTGGAGGGCCAGAAGCTGG - Intergenic
1015544937 6:134352161-134352183 GCAGCTGGAGGGCTAGGAGCTGG - Intergenic
1016886800 6:148966846-148966868 GCTGCTGGGGAGGCTGAAGCAGG - Intronic
1017470494 6:154733618-154733640 GCGGCGGGCGGGGGAGGGGCTGG - Intronic
1017672977 6:156784869-156784891 GCTGCTTGCGGGGCTGAGGCAGG - Intronic
1017756295 6:157532076-157532098 GCCGCTGGGGGAGGAGGAGCAGG + Intronic
1017799124 6:157876338-157876360 GCTGCTCGGGGGGCTGAAGCAGG + Intronic
1017907946 6:158769632-158769654 GCAGCTGGTGGGGAAGGGGCTGG - Intronic
1017908356 6:158772096-158772118 GTAGCTGGTGTGGCAGGAGCAGG - Intronic
1017950271 6:159130240-159130262 GCTGATGGTGGGGCAGGGGCAGG - Intergenic
1017981959 6:159407576-159407598 GCGGCTGGCTGGGCGGGGGCTGG - Intergenic
1018173283 6:161158849-161158871 GGTGGAGGCGGTGCAGGAGCAGG - Intronic
1018613089 6:165662315-165662337 GATGCTGGCGGAGGAGGAGGAGG - Intronic
1018960080 6:168441594-168441616 CCTGCCGGCGAGGCTGGAGCAGG + Intronic
1019294670 7:267389-267411 GGTCCTGGGGAGGCAGGAGCAGG - Intergenic
1019345983 7:531166-531188 GGGGCAGGCGGGGCAGGGGCAGG + Intergenic
1019530095 7:1498998-1499020 GCTGCTGGCGGTGCAGAAGCTGG - Exonic
1019568627 7:1697365-1697387 GCTGCTGGAGGGGCCTGTGCAGG + Intronic
1019641339 7:2105397-2105419 TCTGCTGGCCTGGCAGCAGCAGG + Intronic
1019692885 7:2426528-2426550 ACTGATGACGGGGCAGGGGCGGG + Intronic
1019709506 7:2511811-2511833 GCTGCGGCAGGGGCAGGGGCTGG - Intergenic
1020039853 7:4993644-4993666 GCTGCTGGTGTGGCAGCAGGAGG + Intronic
1020084501 7:5303221-5303243 AGTGCTGGCTGGGCTGGAGCCGG - Exonic
1020309709 7:6858700-6858722 GCTGCTGGCAGGGCAGAGGCTGG - Intergenic
1021206422 7:17786627-17786649 CCTGCTGGAAGGGCAGGAGGGGG + Intergenic
1021610644 7:22454673-22454695 GCTGCAGGTGCTGCAGGAGCTGG + Intronic
1022094551 7:27130562-27130584 GCTGCTGCAGCGGCAGGTGCTGG + Exonic
1022210202 7:28201182-28201204 ACAGCTTGGGGGGCAGGAGCAGG - Intergenic
1022700395 7:32754125-32754147 GCGGCTGGCCAGGCAGGGGCTGG - Intergenic
1023049164 7:36236241-36236263 GGGGCTGGCGAGGCCGGAGCCGG + Intronic
1023132491 7:37016676-37016698 GCTGCTGGCGGTGCAGGCCTTGG - Intronic
1023177656 7:37448872-37448894 GCAGCCGGCGGTGCAGCAGCCGG - Exonic
1023230397 7:38021892-38021914 GCTGGTGGTGGGGCAGGTGAAGG + Intronic
1023353065 7:39339676-39339698 GCTGCTGCTGGAGCTGGAGCTGG - Exonic
1023780104 7:43647470-43647492 TCTGATGGAGGAGCAGGAGCAGG + Intronic
1024075609 7:45816453-45816475 GCTGCTGGGGCAGCATGAGCAGG - Intergenic
1024520377 7:50300596-50300618 GCTGCTGGGGGTGAAGGAGCAGG - Intergenic
1024671800 7:51602505-51602527 GTGGCTGTTGGGGCAGGAGCAGG - Intergenic
1025051844 7:55739343-55739365 GCTGCTGGGGAAGCATGAGCAGG + Intergenic
1025058550 7:55784919-55784941 TATCCTGGCAGGGCAGGAGCTGG - Intergenic
1025209798 7:57013978-57014000 AGTGCTGGCTGGGCTGGAGCTGG + Intergenic
1025258288 7:57399841-57399863 GCTGCAGGAGCCGCAGGAGCTGG + Intergenic
1025610347 7:63071889-63071911 GCTGCAGGAGCTGCAGGAGCTGG - Intergenic
1025662155 7:63562873-63562895 AGTGCTGGCTGGGCTGGAGCTGG - Intergenic
1026797264 7:73374325-73374347 GCTGCTGGAGAGGCTGAAGCGGG + Intergenic
1026989508 7:74575737-74575759 GAAGCTGGTGGGGCAGGAGGTGG + Intronic
1027056333 7:75052451-75052473 GCTTCTTGGGGTGCAGGAGCTGG - Intronic
1027445197 7:78265923-78265945 ACTGCTGGCTGGGGTGGAGCTGG + Intronic
1027555136 7:79654548-79654570 ACTCCTGGTGGGGCAGGAGGAGG - Intergenic
1028177411 7:87674333-87674355 GCTGCTATCATGGCAGGAGCAGG + Intronic
1029453447 7:100655541-100655563 GCTGCTGGCCGCGGAGGAGGGGG - Exonic
1030216015 7:107044652-107044674 GCGGCTGGAGCGGGAGGAGCAGG + Exonic
1030227360 7:107168667-107168689 ACTGCTGGCCGGGGAAGAGCTGG - Intergenic
1030532745 7:110730634-110730656 GCTGCTGGGGAGGCTGAAGCAGG - Intronic
1031596870 7:123658973-123658995 GATGCTGCAGGGGCAGGAGTTGG - Intronic
1031711530 7:125052959-125052981 GCTGCTGGGGAGGCAGAGGCAGG - Intergenic
1032257139 7:130306259-130306281 GCTGCTGGGAGGGCAGCAGGAGG + Intronic
1032293549 7:130613264-130613286 GCTGCTGGTCTGGCAGGAGGCGG + Intronic
1032695188 7:134329823-134329845 GCTGGTGGCTGAGCAGGATCTGG + Intergenic
1033145843 7:138869469-138869491 GCTGCGGGGGGCACAGGAGCAGG - Intronic
1033278340 7:139989090-139989112 GCTATGGGCAGGGCAGGAGCGGG - Intronic
1034345627 7:150383769-150383791 GCTGCTAGTGGAGCGGGAGCAGG - Intronic
1034448005 7:151123176-151123198 GCGGCTTCCGGAGCAGGAGCAGG - Intronic
1034561275 7:151880856-151880878 GCTGGAGCCGGGGCAGGGGCTGG + Intergenic
1035168042 7:157003209-157003231 CCTGCTGGAGGCGCAGGGGCCGG + Intronic
1035312409 7:157977812-157977834 GCTGCTGGGGGAGCAGGAAGGGG + Intronic
1035560700 8:601720-601742 GCTACTGCCTGGCCAGGAGCAGG + Intergenic
1035705288 8:1670299-1670321 GCTGTGGGCGGGGCAGGAAGCGG - Intronic
1036033388 8:4994717-4994739 GCTGCGGGAGGGGGAGAAGCGGG + Exonic
1036754158 8:11461386-11461408 GCGGTTGGCGGGGCGGCAGCAGG - Intronic
1036967742 8:13319461-13319483 CCTGCTGGCGGGGCGGGGGGGGG + Intronic
1037305240 8:17497298-17497320 GGGGCCGGCGGGGAAGGAGCGGG + Intronic
1037355359 8:18013526-18013548 GATGATGTTGGGGCAGGAGCTGG - Intronic
1037584758 8:20268768-20268790 GCTGCTGGTGGGTTGGGAGCAGG + Intronic
1037842104 8:22252074-22252096 GCTGCTGGCTGGGCAGGTTGAGG - Exonic
1037887153 8:22601159-22601181 GCTTCTGGCTGGCCAGGAGTCGG - Exonic
1038017769 8:23529459-23529481 GCTGCTGGCGGCGCTGAGGCGGG + Intronic
1039898729 8:41735375-41735397 ATTGCTGGCGGGGAAGGAGGAGG - Intronic
1041162994 8:55063657-55063679 GCAGGTGGAGGGGCAGGACCAGG + Intergenic
1041368104 8:57130662-57130684 GCTGAGGGAGGGGAAGGAGCAGG - Intergenic
1041648801 8:60281199-60281221 GCTGGGCGCGGGGCTGGAGCCGG + Exonic
1041706681 8:60853520-60853542 GCTGCTGCAGGGTCAGGAGAGGG - Intronic
1042837875 8:73093407-73093429 GGTGCTGGCGGGGCGGGGGTCGG + Intronic
1042912888 8:73845056-73845078 GCAGCTGGCCGGGCGGGGGCTGG - Intronic
1042928466 8:73990507-73990529 GCTGCTGGTCTGACAGGAGCTGG - Intergenic
1043655474 8:82660100-82660122 GCTGGTCAGGGGGCAGGAGCAGG - Intergenic
1043760716 8:84063946-84063968 GCTGCTGCCGGGGATGGAGGAGG + Intergenic
1043982422 8:86657724-86657746 GCTGCAGGAGCTGCAGGAGCTGG - Intronic
1044637400 8:94340908-94340930 GCGGTTGGCCGGGCAGGGGCTGG - Intergenic
1044989146 8:97779937-97779959 GCTGCTGGGGAGGCAGAGGCAGG + Intronic
1045136233 8:99221818-99221840 GCTGCTGGGGAGGCTGGGGCAGG - Intronic
1045454804 8:102367443-102367465 GCTGGGGGCGGGGCTGGAGTGGG - Intronic
1045484685 8:102621904-102621926 GCTGCAGGAGTGGCAGAAGCTGG - Intergenic
1046550366 8:115708347-115708369 GCTGCTGGTGGGGAAAGAGATGG - Intronic
1047132768 8:122039544-122039566 GCTGCTGGGGAGGCTGAAGCAGG - Intergenic
1047807236 8:128373210-128373232 GCTGCTGGAGATGCAGGTGCTGG + Intergenic
1048179198 8:132179972-132179994 GCTGGGGTAGGGGCAGGAGCAGG - Intronic
1048697957 8:137049782-137049804 GCTGCTGGAGCTGCTGGAGCTGG - Intergenic
1048832139 8:138487638-138487660 GGTGGGGGCGGGGCAGGGGCTGG + Intronic
1049168148 8:141139798-141139820 GCTGCTGGGAAGGCAGGAGCAGG - Intronic
1049206885 8:141367659-141367681 GCTGTGTGCGGGGCAGGAGGGGG + Intergenic
1049208117 8:141372744-141372766 GCTTCTGGCGGGCCAGGCACAGG + Intergenic
1049598719 8:143497388-143497410 GCAGCTGGGTGGGCAGCAGCAGG + Intronic
1049612509 8:143562068-143562090 GCTGCTGGAGGGCCTGGAGGGGG + Exonic
1049655334 8:143794636-143794658 GCAGCTGGAGGGGCGGGTGCTGG - Intronic
1049657114 8:143803808-143803830 GCTCCAGGCAGGGCCGGAGCAGG + Exonic
1049665044 8:143839292-143839314 GGTGCTGGCGGGGCAGGGCTGGG - Exonic
1049748496 8:144272958-144272980 GCTGCTGACTGGGCTGGGGCTGG - Intronic
1049945106 9:586854-586876 CCTGCTGGGGGTGCAGGGGCAGG - Intronic
1050130417 9:2406547-2406569 GTTACTGGGGGGCCAGGAGCAGG + Intergenic
1051756457 9:20406140-20406162 GCTGCTGGGGGTACAGGAGAAGG - Intronic
1052820566 9:33135218-33135240 GCTGCTGGCGCTGCAGGACTGGG + Exonic
1053391610 9:37740246-37740268 GCTGCTGGCCCCGCAGGTGCTGG - Exonic
1053418349 9:37960971-37960993 GCTGCTGGTCTGGCAGGAGCTGG + Intronic
1054731418 9:68705590-68705612 GCGGCGGGCGGGGCCGGGGCCGG - Intronic
1054820461 9:69516238-69516260 GGCGCCGGCGGGGCAGCAGCGGG - Exonic
1055552584 9:77445114-77445136 CCTGATGGCGGGGAAGGAGAAGG + Intronic
1055945811 9:81689832-81689854 GCGGCTGGCGGAGGAGGGGCCGG - Intergenic
1056236831 9:84602871-84602893 GCTACTTGCGGGGCTGGGGCAGG + Intergenic
1057139731 9:92719132-92719154 GCTGCTGGCCCGGCTGGAGAAGG - Exonic
1057221496 9:93260050-93260072 GCCGATAGCGGGGCAGGGGCTGG + Intronic
1057572990 9:96218343-96218365 GGTGCCGGCGGGGCAGGGGATGG - Intergenic
1057605945 9:96497609-96497631 GCTGCTAACGGGAGAGGAGCGGG + Intronic
1057617450 9:96604667-96604689 GCGGGGGGCGGGGCAGGAGGGGG + Intronic
1057665052 9:97038698-97038720 GCTCCGGGCGGGCCAGGACCGGG + Intronic
1058233558 9:102461504-102461526 GTTGCTGGTGGGGCAGGGGGTGG + Intergenic
1059123024 9:111659637-111659659 GCTGATGGTGGGGGAGTAGCTGG - Intronic
1059352706 9:113676936-113676958 GCTCCTGGGGGGGCAGGTGGAGG + Intergenic
1060172221 9:121471209-121471231 GCTGCTGGGTGGGCAGGGGTGGG - Intergenic
1060414519 9:123420982-123421004 GCTGGTGCCTGGGCAGGGGCAGG + Intronic
1060745134 9:126126224-126126246 ACTGCTGTCTGGGCAGGGGCAGG + Intergenic
1061042917 9:128150073-128150095 ACTGGTGAAGGGGCAGGAGCAGG - Intronic
1061050304 9:128191344-128191366 GCGGCTGGCGGGGTGGGAGCGGG - Intronic
1061062455 9:128257498-128257520 GCTGCTGGAGCTGCAGGAGCTGG - Exonic
1061283677 9:129610730-129610752 GCTGCAGCCGGCGCAGGGGCCGG + Intronic
1061307916 9:129743055-129743077 TCTGCAGGCTGGGGAGGAGCAGG + Intronic
1061410346 9:130417655-130417677 AATGCTGGTGGGGCAGAAGCTGG + Intronic
1061566151 9:131441833-131441855 GCCACTGGTGGGGCAGCAGCTGG - Intronic
1061582298 9:131545625-131545647 GGAGCTGGAGGGGCAGGTGCCGG + Intergenic
1061582303 9:131545640-131545662 GGTGCCGGAGGGGCAGGTGCTGG + Intergenic
1061582313 9:131545670-131545692 GGTACTGGCGGGGCAGGTACTGG + Intergenic
1061582318 9:131545685-131545707 GGTACTGGCGGGGCAGGTACTGG + Intergenic
1061582331 9:131545730-131545752 GGTACTGGCGGGGCAGGTGCTGG + Intergenic
1061582336 9:131545745-131545767 GGTGCTGGCGGGGCAGGTGCTGG + Intergenic
1061582340 9:131545760-131545782 GGTGCTGGCGGAGCGGGTGCTGG + Intergenic
1061582357 9:131545815-131545837 GCTGCTGGAGGGGCAGGTGCTGG + Intergenic
1061582363 9:131545830-131545852 GGTGCTGGTGGGGCGGGTGCTGG + Intergenic
1061951279 9:133937634-133937656 GCTGCTTGCAGGGAAGGAACAGG + Intronic
1062021192 9:134320121-134320143 GGGGCTGGCAGGGCAGGATCTGG + Intronic
1062290834 9:135793659-135793681 GCTGCTGGAGGGGCCGGCCCTGG + Intergenic
1062460095 9:136659401-136659423 GCTGCAGGAGGTGCAGGAGGAGG - Exonic
1062500418 9:136849683-136849705 GGGGCTGGCGGGGCGGGGGCGGG + Intronic
1062565802 9:137163478-137163500 GCTGGGGGCGGGGCCGGGGCGGG - Intronic
1062620403 9:137417899-137417921 GGGGCTGGCGGGGCCGGAGGGGG + Intronic
1062655916 9:137604759-137604781 GCGGGGGGCGGGGCAGGTGCTGG + Intergenic
1203779984 EBV:95941-95963 GGAGCGGGAGGGGCAGGAGCAGG + Intergenic
1203779989 EBV:95956-95978 GGAGCAGGAGGGGCAGGAGCAGG + Intergenic
1203779995 EBV:95974-95996 GCAGGAGGAGGGGCAGGAGCAGG + Intergenic
1203780013 EBV:96019-96041 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780019 EBV:96037-96059 GCAGGAGGAGGGGCAGGAGCAGG + Intergenic
1203780033 EBV:96073-96095 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780039 EBV:96091-96113 GCAGGAGGAGGGGCAGGAGCAGG + Intergenic
1203780049 EBV:96118-96140 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780063 EBV:96154-96176 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780069 EBV:96172-96194 GCAGGAGGAGGGGCAGGAGCAGG + Intergenic
1203780079 EBV:96199-96221 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780093 EBV:96235-96257 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780099 EBV:96253-96275 GCAGGAGGAGGGGCAGGAGCAGG + Intergenic
1203780112 EBV:96286-96308 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780117 EBV:96301-96323 GGAGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780131 EBV:96337-96359 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780136 EBV:96352-96374 GGAGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780141 EBV:96367-96389 GGAGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780146 EBV:96382-96404 GGAGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780155 EBV:96406-96428 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780164 EBV:96430-96452 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780173 EBV:96454-96476 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780183 EBV:96481-96503 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780193 EBV:96508-96530 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780202 EBV:96532-96554 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780211 EBV:96556-96578 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780220 EBV:96580-96602 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780226 EBV:96598-96620 GCAGGAGGAGGGGCAGGAGCAGG + Intergenic
1203780231 EBV:96613-96635 GGAGCAGGAGGGGCAGGAGCAGG + Intergenic
1185759347 X:2677926-2677948 GCTGCCGGGTGGCCAGGAGCAGG + Intergenic
1186244907 X:7608914-7608936 GCGGCTGGCCGGGCAGGGGGCGG + Intergenic
1186658244 X:11639816-11639838 GTTGGTGGGGGGTCAGGAGCAGG - Intronic
1187013961 X:15307984-15308006 GCTGCTGGGTGGGCTGGAGAAGG - Intronic
1187087178 X:16052498-16052520 GCTGCTTGGGAGGCTGGAGCAGG + Intergenic
1187464578 X:19515558-19515580 GAGGGCGGCGGGGCAGGAGCGGG + Intergenic
1188005952 X:25015896-25015918 GCCGCGGGCAGGGCGGGAGCCGG - Exonic
1188898196 X:35695627-35695649 GCTACTGGGGAGGCAGGGGCAGG + Intergenic
1189391587 X:40581092-40581114 GTTGGTGGCGGGTGAGGAGCCGG + Exonic
1189825219 X:44911106-44911128 GCGGCTGGCCGGGCGGGGGCTGG + Intronic
1190319478 X:49171832-49171854 GACGCGGGCGGGGCCGGAGCCGG - Intergenic
1190339585 X:49286200-49286222 GCTGCGGGTGGGGCAGGGGGTGG + Exonic
1190366785 X:49702383-49702405 GCCAATGGCGGGGCAGTAGCTGG + Intergenic
1190415964 X:50180748-50180770 GCTCGGGGCGGGGAAGGAGCAGG - Intergenic
1190733046 X:53236976-53236998 GCTCCTGGAAGGGCAGGAGCAGG + Intronic
1190822844 X:53990431-53990453 GCTGGGGGTGGGGCAGGGGCAGG + Intronic
1190852782 X:54262971-54262993 ACTTCTGCTGGGGCAGGAGCAGG + Intronic
1194835226 X:98673111-98673133 ATTGCTGGTGGTGCAGGAGCAGG + Intergenic
1196892740 X:120306725-120306747 CCAGCTGGTGGGGAAGGAGCAGG - Intronic
1197276291 X:124483342-124483364 GCAACTGGCAGGGCAGGAGAGGG - Intronic
1197758732 X:130013670-130013692 ACTGAAAGCGGGGCAGGAGCTGG - Exonic
1197837822 X:130713954-130713976 GCTGCTGGTGGGGGAGGGGGTGG + Intronic
1198480221 X:137033922-137033944 GCTGCGGGCGCGGCAGGAGCGGG + Intergenic
1198934680 X:141894549-141894571 GTTGCTGTCGGGACAGGAGAAGG + Intronic
1199265607 X:145822590-145822612 GATACTGGGGGGGCTGGAGCAGG - Exonic
1199792943 X:151171921-151171943 GCTGCTGGGATGGGAGGAGCAGG + Intergenic
1199975599 X:152893396-152893418 GCTGCTTCTGGGGCAGCAGCAGG + Intergenic
1200000145 X:153056120-153056142 CGTGCGGGAGGGGCAGGAGCCGG + Intergenic
1200062382 X:153489314-153489336 GCTGAAGGAGGGGCAGGTGCAGG - Intronic
1200092444 X:153642315-153642337 GCGGCTCGCGGGGAGGGAGCGGG - Intergenic
1200244600 X:154516260-154516282 GCTGCTGCCGGGGGCGGGGCCGG - Intergenic
1201073188 Y:10168766-10168788 GCTCCTGGTGGGGCTGCAGCCGG - Intergenic
1201707746 Y:16955293-16955315 GCTGCTGGGGTGGCAGGTACTGG - Intergenic
1202147869 Y:21819482-21819504 GCAGCTGGGGGGGCTGAAGCGGG + Intergenic