ID: 1083638224

View in Genome Browser
Species Human (GRCh38)
Location 11:64131734-64131756
Sequence TGCCAGGCCCTGTTCAGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 230}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083638217_1083638224 8 Left 1083638217 11:64131703-64131725 CCAACCAAGCCTTTATTGAGCAC 0: 1
1: 0
2: 5
3: 24
4: 199
Right 1083638224 11:64131734-64131756 TGCCAGGCCCTGTTCAGATGGGG 0: 1
1: 0
2: 0
3: 23
4: 230
1083638215_1083638224 29 Left 1083638215 11:64131682-64131704 CCCTGTTTCAGGCTGTGACTACC 0: 1
1: 0
2: 1
3: 11
4: 106
Right 1083638224 11:64131734-64131756 TGCCAGGCCCTGTTCAGATGGGG 0: 1
1: 0
2: 0
3: 23
4: 230
1083638218_1083638224 4 Left 1083638218 11:64131707-64131729 CCAAGCCTTTATTGAGCACCTAC 0: 1
1: 5
2: 33
3: 125
4: 455
Right 1083638224 11:64131734-64131756 TGCCAGGCCCTGTTCAGATGGGG 0: 1
1: 0
2: 0
3: 23
4: 230
1083638219_1083638224 -1 Left 1083638219 11:64131712-64131734 CCTTTATTGAGCACCTACTGCAT 0: 2
1: 3
2: 44
3: 126
4: 433
Right 1083638224 11:64131734-64131756 TGCCAGGCCCTGTTCAGATGGGG 0: 1
1: 0
2: 0
3: 23
4: 230
1083638216_1083638224 28 Left 1083638216 11:64131683-64131705 CCTGTTTCAGGCTGTGACTACCA 0: 1
1: 0
2: 1
3: 6
4: 129
Right 1083638224 11:64131734-64131756 TGCCAGGCCCTGTTCAGATGGGG 0: 1
1: 0
2: 0
3: 23
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083638224 Original CRISPR TGCCAGGCCCTGTTCAGATG GGG Intronic
900554125 1:3271265-3271287 AGCCAGGCTCTGTTTAGCTGTGG - Intronic
900887241 1:5423676-5423698 TTCCAAGTCCTGTTCAGAGGTGG + Intergenic
901061306 1:6473220-6473242 TGCCTGACCCTGGGCAGATGGGG + Intronic
902170249 1:14604414-14604436 TGCCAGGCCCATCTCAGTTGTGG + Intronic
903551254 1:24158546-24158568 AGGTCGGCCCTGTTCAGATGAGG - Intronic
904597040 1:31653426-31653448 TGCCAGGGCCTGTGGGGATGTGG - Intronic
904921940 1:34014719-34014741 TTCCAGGCCTTGTTCAGAAGAGG + Intronic
904978698 1:34478699-34478721 TGAAAGGCTCTGCTCAGATGTGG - Intergenic
907469934 1:54666824-54666846 TGAAAGGGTCTGTTCAGATGTGG + Intronic
907920993 1:58911442-58911464 TACCAGGCCCTGTTAGGATCTGG - Intergenic
909320935 1:74284888-74284910 TGTCAGGACCTGCCCAGATGTGG - Intronic
911060946 1:93747276-93747298 TGGTAGGCTCTGTTCAGGTGAGG + Intronic
911156081 1:94638203-94638225 GGCCAGGCCCTTTTCATAAGGGG - Intergenic
912684119 1:111748701-111748723 TGACAGGCCCAGAACAGATGAGG - Intronic
913376230 1:118155592-118155614 TATCAGGCCCTGTTCAGTTCTGG - Intronic
914751105 1:150535610-150535632 GGCCAGGCACTGTTCAGTTACGG + Intergenic
921299410 1:213736285-213736307 AGCCAGGCCGTGTTCTCATGGGG + Intergenic
924817478 1:247455361-247455383 GTCCAGGCCCTGTTCAGCTGCGG + Intergenic
1065902978 10:30224596-30224618 TGCCAGGCACTGTTGAGATATGG - Intergenic
1069690782 10:70350608-70350630 TGCCAGCCCCTGCTGAGAAGTGG + Intronic
1069860550 10:71468577-71468599 TGCCCTGCCCTGTTCAGCTCTGG + Intronic
1069881423 10:71596082-71596104 TGCCTGGCCCTGCTCAGGGGTGG + Intronic
1070670699 10:78375371-78375393 TGCCAGGCCCTGGGGTGATGGGG + Intergenic
1071483740 10:86084052-86084074 TGCCAGGGCCTGATCACAGGAGG - Intronic
1072441647 10:95461827-95461849 TGCCAGACTGTGTGCAGATGGGG - Intronic
1072460884 10:95617471-95617493 TGCCAGCCCCTGGGCAGCTGTGG + Intronic
1074520927 10:114223261-114223283 TGCCAGTCCCTGGGCAGAGGTGG + Intronic
1074951157 10:118338096-118338118 TGGAAGGACCTGTGCAGATGAGG - Intronic
1075443227 10:122495468-122495490 TGCCAGGCTTTGTCCAGAGGCGG + Intronic
1075680590 10:124328504-124328526 GCCCAGTCTCTGTTCAGATGAGG + Intergenic
1076031461 10:127162776-127162798 TGCCAGTCCCAGTTCATCTGGGG + Intronic
1076335823 10:129705902-129705924 TGCCCGGCCCTGTGTGGATGGGG - Intronic
1076788545 10:132764281-132764303 TGCCATGCCCTGCACAGCTGTGG + Intronic
1077252004 11:1564850-1564872 TGATAGGCCCTGTTCAGAGCTGG - Intronic
1077515956 11:3002365-3002387 TGCCAGGCCCTTCTCACATGGGG - Intronic
1078828591 11:14955864-14955886 TCCCAGGCCCAGATCAGATTAGG - Intronic
1078936998 11:15960814-15960836 TGCAAGGCCATGTGAAGATGGGG + Intergenic
1080656058 11:34259269-34259291 TGCCAGGCCTCGTTCAGACTTGG - Intronic
1082096381 11:48133935-48133957 TACCAGGGGCTGTTCAGAGGAGG + Intronic
1082996643 11:59260919-59260941 GGCCAGGCCCCATTCACATGAGG + Intergenic
1083459144 11:62799367-62799389 TCCCACGCCCAGTTCAGATCGGG - Intronic
1083638224 11:64131734-64131756 TGCCAGGCCCTGTTCAGATGGGG + Intronic
1084709051 11:70832724-70832746 TGCAAGGCCCTGGGCAGAAGAGG - Intronic
1084748498 11:71188721-71188743 TGGCAGGCCCTCAGCAGATGAGG - Intronic
1084903672 11:72329389-72329411 TCCCAGGTCCTTTTCAGAGGAGG - Intronic
1086520516 11:87663432-87663454 TGCCAAGCACTGTTGAGAGGTGG + Intergenic
1087026317 11:93653373-93653395 CGCCAGGCCCAGGTCAGAAGAGG - Intergenic
1087070403 11:94074129-94074151 TGCCAGGCCCAGTTGAGAACAGG + Intronic
1087747444 11:101965392-101965414 TGCCAGGCACTGTTAGGATCTGG - Intronic
1089199386 11:116714720-116714742 AGCCAGGCCCTGGCCGGATGGGG - Intergenic
1089763297 11:120744518-120744540 TGCCAGGCCCTGGGCAAAGGGGG + Intronic
1090267158 11:125360306-125360328 TCCCACCCCCTGTTCAGATCCGG - Intronic
1090401902 11:126454361-126454383 TGCCAGGCTCTGGTCACCTGGGG - Intronic
1092143734 12:6200803-6200825 AGCCGGGCCCTCTTGAGATGAGG + Intronic
1096997530 12:55848149-55848171 TGCCAGGAAGTGTTCATATGGGG - Intergenic
1097233770 12:57526707-57526729 TGCCAGGCCCTGCTCAGGGCTGG - Exonic
1100405727 12:94271512-94271534 TCCCAGGCCGTGTGCAGAAGAGG + Intronic
1101740556 12:107496671-107496693 TGTCAGGCACTGTTCAGATATGG + Intronic
1104449773 12:128859569-128859591 AGCAAAGCCCTGTTCACATGTGG - Intronic
1105721524 13:23120873-23120895 TTCAAATCCCTGTTCAGATGTGG - Intergenic
1107374023 13:39782716-39782738 TGCTAGCCCCTGTTGTGATGGGG - Intronic
1107831494 13:44377465-44377487 GGCCAGGCCAAGTTCAGATCCGG - Intronic
1111991774 13:95123876-95123898 TCTCAGGCCCTGTTCCCATGAGG - Intronic
1113652083 13:112040845-112040867 TGCCAGGTCCTGTTGAGGGGTGG + Intergenic
1114653423 14:24300983-24301005 TGCTAAGCCCTGTTCAGATTAGG - Intronic
1115711097 14:36051582-36051604 TGCCACTCACTGTTCACATGTGG + Intergenic
1119880899 14:78098729-78098751 TGCCAGGCCCTGTGCATTAGAGG + Intergenic
1120979736 14:90279239-90279261 TGCCAGGCCCTCTGCACAGGTGG - Intronic
1121040678 14:90744124-90744146 TGCCAAGACCTGTTCATCTGGGG - Intronic
1122025186 14:98870675-98870697 TGGCAGGCCCTGCTCAGAAGAGG + Intergenic
1122400487 14:101464629-101464651 GACCTGGCCCTGTACAGATGAGG + Intergenic
1122740676 14:103870058-103870080 TGCGGGGCCCTGTCAAGATGTGG + Intergenic
1122828443 14:104383585-104383607 TGCGAGGCCCGGTGCAGGTGGGG - Intergenic
1123033500 14:105462131-105462153 TGCGGGGCCCTGTCCAGGTGCGG + Intronic
1123775874 15:23579400-23579422 TGCCAGGCGCTGTTCTGAGATGG + Intronic
1125171967 15:36775516-36775538 TGACAGGCCCTGATTAGATTAGG + Intronic
1127560916 15:60135250-60135272 TGTCACCCCCTTTTCAGATGAGG + Intergenic
1128518360 15:68358413-68358435 TGGGTGGCCCTGTTCAGAAGTGG + Intronic
1130960069 15:88653313-88653335 CTCCAGGCTCTGTTCAGATCTGG - Intronic
1132354762 15:101163058-101163080 AGCGAGGCCCTGTTCTGATCCGG + Intergenic
1133335481 16:5004267-5004289 TTCAAGGCTCTGTTCAGGTGAGG + Intronic
1133498061 16:6339150-6339172 TGCCAGGCACTGTGCTGCTGAGG + Intronic
1137393124 16:48097881-48097903 TGCAATGCACTGTGCAGATGTGG - Intronic
1137545009 16:49396687-49396709 TGCCACCCCCTGGGCAGATGGGG + Intronic
1141684645 16:85563411-85563433 TGCCAGGCCCTCCGCAGCTGGGG + Intergenic
1143108939 17:4542896-4542918 GGCCAGGCCCTGCTCACCTGCGG + Exonic
1143903686 17:10193571-10193593 TGCCAGGCCCTCTTAAGGTCTGG - Intronic
1144676072 17:17162542-17162564 TGCCATGCCCTGTTCAGACCTGG + Intronic
1144816931 17:18040896-18040918 TGCCAGTCCCTGATCAGCTTCGG + Intronic
1145865489 17:28238652-28238674 TGCCACGCACTGCTCTGATGAGG + Intergenic
1146609346 17:34290665-34290687 AGCCAGGGCTGGTTCAGATGGGG - Intergenic
1147324070 17:39662098-39662120 TGCTAAGCCTTGTTCAGATAGGG + Intronic
1149476479 17:56965396-56965418 TGCCATGCACTGCTCTGATGAGG + Intergenic
1151381281 17:73727412-73727434 TGACAGGCCCTGTTCCCAGGAGG + Intergenic
1152268489 17:79310049-79310071 TGCCAGGCCCTGCTCCGGTATGG - Intronic
1157866561 18:51191875-51191897 TGACAGTCTCTGTTCAGCTGTGG - Intronic
1160837306 19:1130997-1131019 GGGCTGGCCCTGTTCACATGTGG + Intronic
1160899254 19:1419037-1419059 TGCCTGGCCCTCCTCAGAGGTGG + Intronic
1164397719 19:27880399-27880421 TGACAGTGCCTGTCCAGATGAGG - Intergenic
1165130291 19:33627817-33627839 TACCAGGCCCTGTGGACATGAGG + Intronic
1166124215 19:40703975-40703997 TGCCACCCCCTTTGCAGATGAGG + Intronic
1166253445 19:41586406-41586428 TGCCAGACCCTGTTCTGAGAAGG + Intronic
925465935 2:4107383-4107405 TGCCAGCCCCTGGGGAGATGTGG + Intergenic
925619550 2:5777862-5777884 TGCCAGGACCGAGTCAGATGTGG - Intergenic
926971716 2:18473472-18473494 TGCCAGCCTCTGTGCAGAAGTGG - Intergenic
931791649 2:65669021-65669043 TCCAAGGCCCTTTTCAGATGTGG + Intergenic
933366701 2:81362587-81362609 AGGCAGGCCTTGTTGAGATGCGG + Intergenic
935356904 2:102209746-102209768 TGCCAGGCCCTCTTCAACTCTGG - Intronic
937454513 2:122029701-122029723 TTCCAGGCCCCATGCAGATGGGG - Intergenic
937493813 2:122397451-122397473 CTCCAGGGCCTGTGCAGATGTGG - Intergenic
940332938 2:152494915-152494937 TGCCAGGCCCTGTTATGCAGAGG + Intronic
947715160 2:232335603-232335625 TGCCAGGCCACCTTCAGCTGAGG - Intronic
947830832 2:233140322-233140344 TGCCAGGCCATGAGCAGGTGCGG - Intronic
947869859 2:233428678-233428700 TGCCAGGCCCTGTGCACATTTGG + Intronic
947997391 2:234539837-234539859 TGCCAGGCCCTCCTCAGCTCTGG - Intergenic
948391187 2:237612661-237612683 TGCCAGGTACTCTTCAGCTGTGG - Intergenic
948709632 2:239817775-239817797 TGCCAGACAGTGATCAGATGGGG - Intergenic
948709667 2:239817950-239817972 TGCCAGACAGTGATCAGATGGGG - Intergenic
948709698 2:239818125-239818147 TGCCAGACAGTGATCAGATGGGG - Intergenic
948709717 2:239818230-239818252 TGCCAGTCAATGATCAGATGGGG - Intergenic
948771281 2:240252442-240252464 TCCCAGGCCTTGTTCAGAGATGG - Intergenic
948864638 2:240769080-240769102 CACCTGGTCCTGTTCAGATGAGG + Intronic
1168854139 20:997159-997181 TGCCAGGAGCTGTGCAGGTGGGG - Intronic
1171959971 20:31486189-31486211 TGCCAGGCTCTGGGGAGATGTGG + Intergenic
1172119013 20:32586689-32586711 TGCTAGGGCCTGTGCATATGAGG - Intronic
1173048719 20:39538171-39538193 TGCCAGTCCCTTTTCAGTTCTGG - Intergenic
1176184516 20:63771088-63771110 TCCCAGGCCCTCTTCAGAGCTGG + Intronic
1176231363 20:64034722-64034744 AGCCCGGCCCTGTACAGATGTGG + Intronic
1176231376 20:64034773-64034795 AGCCCGGCCCTGTACAGGTGTGG + Intronic
1176231388 20:64034824-64034846 AGCCCGGCCCTGTACAGATGTGG + Intronic
1176231400 20:64034875-64034897 AGCCTGGCCCTGTACAGATGTGG + Intronic
1177383482 21:20376676-20376698 AGCAAGGCCCTCATCAGATGTGG + Intergenic
1179105521 21:38397135-38397157 TGGCAGGGCATGTTCACATGTGG + Intronic
1179176873 21:39014257-39014279 TGCCTGGCACTGTACAGACGTGG + Intergenic
1179675969 21:42982241-42982263 TGGCAGGCCCTGCTCAAAGGGGG - Intronic
1180874997 22:19171106-19171128 TGCCTGGCCCTGTGCATGTGGGG - Intergenic
1180979369 22:19871580-19871602 TGCCAGGCTCTGTTGAGCTCTGG + Intergenic
1181898309 22:26130628-26130650 TGCCAGATTCTGCTCAGATGAGG - Intergenic
1184247232 22:43241870-43241892 TGCCAGGCCCTGTGCAGGCAGGG + Intronic
1184693647 22:46128388-46128410 GGCCAGGCCCTCTGCAGCTGAGG - Intergenic
1184699788 22:46162957-46162979 TGCCAGGCACTGTCCTGCTGTGG + Intronic
1185213444 22:49585119-49585141 TGCCACCCCATTTTCAGATGAGG - Intronic
1185213450 22:49585156-49585178 TGCCACCCCATTTTCAGATGAGG - Intronic
949904807 3:8850392-8850414 TGCAAGACCCTGTTTATATGTGG - Intronic
953347897 3:42191101-42191123 TGCCAGGCACTGAACATATGAGG - Intronic
953407733 3:42667783-42667805 GGCCAGGGCCTGTGCAGGTGTGG + Intergenic
953719338 3:45341665-45341687 TGCGAGGCCCTATTCTGTTGGGG - Intergenic
953928607 3:46994993-46995015 TGACAGTCCCTGGTCAGCTGTGG - Intronic
954109564 3:48426557-48426579 TGCCCGGCCCTGTTCACTTCAGG - Intronic
954783657 3:53077922-53077944 TGCAAAGCCCTTTTCAGATGTGG + Intronic
956196800 3:66661274-66661296 TGCCAGGCAGAGTTCTGATGAGG + Intergenic
956828802 3:73025064-73025086 GGCCTGGCCCTGGTCAGGTGGGG + Intronic
961451887 3:127005912-127005934 TCCCAGGCCCTGGTCACCTGGGG + Intronic
962188938 3:133289980-133290002 TTCCAAGCACTGTGCAGATGGGG + Intronic
966913374 3:184571455-184571477 CTCCAGGCCCTGGTGAGATGAGG - Intronic
967387842 3:188928314-188928336 GGCCAGGCCCTGGTTGGATGGGG - Intergenic
968278638 3:197459307-197459329 TACCAGGTGCTGTTCACATGTGG - Intergenic
969439231 4:7207547-7207569 TGCCAGCCCCAGTGCAGATGAGG - Intronic
969460335 4:7325694-7325716 GGCCTGGCCCTTCTCAGATGAGG + Intronic
970044341 4:11833542-11833564 CACCAGGCCCTGTTGAGAGGTGG - Intergenic
975582740 4:75921482-75921504 TGCCAGGCACTGTGCTGGTGGGG + Intronic
977976064 4:103268515-103268537 TGCCAGCACCTGCTCTGATGTGG + Intergenic
978348364 4:107795821-107795843 TTCCATGCCCTGCTCAAATGTGG - Intergenic
979675185 4:123401977-123401999 TAACAGTCCCTGTTCAGAAGAGG - Exonic
981854431 4:149271235-149271257 TCCCTGGCCATATTCAGATGAGG + Intergenic
981884132 4:149652281-149652303 TGCCAGGGCCTGTTGAGGGGTGG + Intergenic
984849922 4:184144352-184144374 TGCCAGGCCCTCTCCAGACCTGG + Intronic
984924460 4:184794582-184794604 GGCCAGCCCCTCTCCAGATGAGG + Intronic
986041145 5:3995196-3995218 TGCCAGGCCCGGTCAGGATGGGG + Intergenic
993409061 5:87551429-87551451 TGCCAGTCTCTGTTGGGATGAGG + Intergenic
996531560 5:124532845-124532867 TGCCAGGCCTAGGTCAGCTGGGG + Intergenic
997295648 5:132766732-132766754 TGGCAGCCCTTGTGCAGATGTGG + Intronic
998097376 5:139403862-139403884 GGCCAGAACCTGTTCCGATGCGG - Intronic
998503694 5:142654956-142654978 GGCCCGGCCCTGTTTGGATGTGG - Intronic
998630287 5:143890738-143890760 TGCCAGGCTCTGTTAAGCTGAGG + Intergenic
999147792 5:149407219-149407241 CTCCAGCCCCTGTACAGATGGGG - Intergenic
1001299365 5:170522881-170522903 TTCCAAGTCCTGTTCAGAAGTGG - Intronic
1001683593 5:173576475-173576497 TTCCTGGCCCTGTTCAGCTTTGG + Intergenic
1001930698 5:175670855-175670877 TGCCAGGCCATATCCAGATTTGG + Intronic
1002303112 5:178268699-178268721 TGCCAGAGGCTGTGCAGATGTGG - Intronic
1002434125 5:179220912-179220934 TGCCCGACCCTGTGCAAATGAGG + Intronic
1002522359 5:179798809-179798831 TACGAGGCCCACTTCAGATGCGG + Intronic
1003253773 6:4456817-4456839 TGCCAGGCCCTGCTCTGGTGTGG + Intergenic
1006511721 6:34525290-34525312 CCCCAGGCCCTGGACAGATGGGG + Intronic
1006514806 6:34539790-34539812 TGCAACCCCTTGTTCAGATGAGG + Intronic
1006555085 6:34859115-34859137 TGCTGGGCCCTGGTCTGATGAGG - Exonic
1007805288 6:44439752-44439774 TGCCAGGCACTGGACAGCTGAGG + Intronic
1009921719 6:70069974-70069996 TGTCAGGCCCTGTTCTGTTCAGG - Intronic
1013191794 6:107809997-107810019 TGCCAGGCACTGTGCTCATGTGG + Intronic
1016917713 6:149260197-149260219 TGCCAGGGGCTGTCCTGATGAGG - Intronic
1018169761 6:161135542-161135564 AGCCAGGTCCTGCTCTGATGAGG - Exonic
1019851272 7:3560715-3560737 TGCCAGGCCCAGTGGAGACGTGG - Intronic
1021118786 7:16773564-16773586 TGCCAAGCCCTGTTCTAATAGGG + Intronic
1022214314 7:28243249-28243271 GGCCAAGCCCTGTGCAGATGGGG + Intergenic
1022866380 7:34425768-34425790 TCCCAGTCCTTGTTCAGCTGTGG - Intergenic
1022942142 7:35251103-35251125 TCCCAGGCCCTTATCAGCTGTGG - Intronic
1023678047 7:42651414-42651436 TCCTAGATCCTGTTCAGATGTGG - Intergenic
1023912650 7:44566653-44566675 CTCCTGGCCCTGTGCAGATGTGG - Intronic
1024177675 7:46857835-46857857 TGCCAGGGCCTGGACAGATAAGG - Intergenic
1026600396 7:71772922-71772944 TGCCAGGCACTGATAGGATGTGG - Intergenic
1026970776 7:74466192-74466214 GGCCAGGCCCTGTTCTGGGGCGG + Intronic
1029544708 7:101204329-101204351 TCCCAGGTCCTCTTCAGATTTGG + Intergenic
1030823227 7:114121292-114121314 AGCCTGGCCCAGTTCTGATGAGG - Intronic
1032019052 7:128396496-128396518 TGCCAGGCCCTGTTCTGCCATGG - Intronic
1032706574 7:134425212-134425234 TGCCAGGGACAGTTAAGATGTGG + Intergenic
1033979463 7:147146268-147146290 TGCCATGCCCTGCTCTGAAGAGG + Intronic
1034155779 7:148955088-148955110 TGCCAGGCCCTTCCCAGCTGTGG + Intergenic
1034987746 7:155527821-155527843 TTCCAGGCCCTGTGCAAATCAGG - Intronic
1035028761 7:155844105-155844127 GGCCAGGCCCTGTGTAGCTGGGG + Intergenic
1035105970 7:156441783-156441805 TGCCAGGTCGTGTTTGGATGGGG - Intergenic
1035373107 7:158391769-158391791 TGCCAGGCCCTGGTCAGTACCGG + Intronic
1036501959 8:9322266-9322288 TGCCTGGCCCTGTTCACAGGAGG + Intergenic
1037401137 8:18496418-18496440 GGCCTGGCCTTGTTCATATGGGG - Intergenic
1037961801 8:23103264-23103286 TGCCTGGCCCTGGTCACCTGCGG + Intronic
1038135983 8:24786310-24786332 TGCCAGGCCCTGTGTGGGTGGGG + Intergenic
1039126987 8:34214911-34214933 TGCCAGCCTCGGATCAGATGGGG - Intergenic
1039236534 8:35508372-35508394 TGTCAGGCCCTCAGCAGATGAGG - Intronic
1039285972 8:36041270-36041292 TGCCAGCCACTGTTCATATCAGG + Intergenic
1039916186 8:41862019-41862041 CACCAGGCCCTGCTCAGACGGGG + Intronic
1039990205 8:42481423-42481445 TGCCAGGCCCTGATGATAGGAGG + Intronic
1040749054 8:50683129-50683151 TGCCAGGCGCTGTTCCAGTGTGG - Intronic
1042143774 8:65706081-65706103 TGCCATGCCCAGGTCAAATGAGG - Intronic
1044588832 8:93894040-93894062 TGCCAGGCCTTTTTCAAAAGTGG - Intronic
1045059929 8:98402680-98402702 TGGCTGGCCCTGCACAGATGAGG - Intronic
1047089120 8:121554405-121554427 TGCCTGGACCTGACCAGATGTGG + Intergenic
1048871669 8:138804157-138804179 TGCAAGGCCCAGTTGTGATGTGG - Intronic
1049052323 8:140208450-140208472 TCCCAGGCCCTCTGCAAATGGGG + Intronic
1049331622 8:142057046-142057068 TGACAGGCGCTGTACAGAAGAGG - Intergenic
1049637079 8:143694822-143694844 TGCCAGGCCGGGCTCAGAGGCGG + Exonic
1049956516 9:698113-698135 ATTCAGGCCCTGGTCAGATGCGG + Intronic
1053365945 9:37522698-37522720 TGAGAGTGCCTGTTCAGATGAGG + Intronic
1054713894 9:68538336-68538358 TGGCAGTCCCTGTTCTGTTGTGG - Intronic
1057522469 9:95771011-95771033 CTCCAGGCACTGGTCAGATGAGG + Intergenic
1062355552 9:136160410-136160432 TGCCAGGCCTTGGTCCGAGGAGG + Intergenic
1062387173 9:136317324-136317346 GGCCAGACTCTGATCAGATGGGG + Intergenic
1186806517 X:13145573-13145595 AGCAAGCCCCTGTTCAGATGAGG + Intergenic
1187128019 X:16472109-16472131 TCCCAGGCCCTTTACAGGTGGGG - Intergenic
1187682229 X:21778988-21779010 TGCCAAGCCCTGTGCCCATGGGG - Intergenic
1189316556 X:40061062-40061084 TGCCAGGCCATGCTCAGCTGTGG - Intronic
1194871800 X:99141474-99141496 TCTCAGGCTATGTTCAGATGAGG - Intergenic
1195318814 X:103704727-103704749 TCCCAGCCCCTGTACATATGTGG + Intergenic
1196303453 X:114072509-114072531 TGCAAGGGTCTGTTCAGGTGTGG + Intergenic
1196371893 X:114988284-114988306 TTGCAAGCCCTGTTCAAATGAGG - Intergenic
1199777865 X:151031451-151031473 TGCCAGGCACTGTTCAGGGCTGG + Intergenic
1199981973 X:152926053-152926075 GGCCATGCCCTGGTCAGGTGAGG - Intronic
1200988444 Y:9326916-9326938 TGCCAGCCCCTGGTCAGAGCAGG + Intergenic
1202073722 Y:21017695-21017717 TGCCTGGCCCTGCTTAGATGGGG - Intergenic
1202078422 Y:21059549-21059571 TGCCTGGCCCTGCTTAGATGGGG - Intergenic
1202119559 Y:21509276-21509298 TGCCAGCCCCTGGTCAGAGCAGG - Intergenic
1202122011 Y:21532816-21532838 TGCCAGCCCCTGGTCAGAGCAGG - Intronic
1202156995 Y:21896566-21896588 TGCCAGCCCCTGGTCAGAGCAGG + Intronic
1202159441 Y:21920107-21920129 TGCCAGCCCCTGGTCAGAGCAGG + Intergenic
1202185889 Y:22185022-22185044 TGCCAGTCCCTGGTCAGAGCAGG + Intergenic
1202205471 Y:22401374-22401396 TGCCAGTCCCTGGTCAGAGCAGG - Intronic