ID: 1083639565

View in Genome Browser
Species Human (GRCh38)
Location 11:64138198-64138220
Sequence CTTCCTCCTAACAAGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 426}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083639565_1083639574 0 Left 1083639565 11:64138198-64138220 CCTGCCTCCTTGTTAGGAGGAAG 0: 1
1: 0
2: 3
3: 32
4: 426
Right 1083639574 11:64138221-64138243 AGGAGGCTGGGTGGAGGCCGAGG 0: 1
1: 1
2: 13
3: 103
4: 1008
1083639565_1083639576 6 Left 1083639565 11:64138198-64138220 CCTGCCTCCTTGTTAGGAGGAAG 0: 1
1: 0
2: 3
3: 32
4: 426
Right 1083639576 11:64138227-64138249 CTGGGTGGAGGCCGAGGCCAGGG 0: 1
1: 0
2: 4
3: 88
4: 656
1083639565_1083639577 9 Left 1083639565 11:64138198-64138220 CCTGCCTCCTTGTTAGGAGGAAG 0: 1
1: 0
2: 3
3: 32
4: 426
Right 1083639577 11:64138230-64138252 GGTGGAGGCCGAGGCCAGGGAGG 0: 1
1: 0
2: 11
3: 116
4: 1046
1083639565_1083639573 -6 Left 1083639565 11:64138198-64138220 CCTGCCTCCTTGTTAGGAGGAAG 0: 1
1: 0
2: 3
3: 32
4: 426
Right 1083639573 11:64138215-64138237 AGGAAGAGGAGGCTGGGTGGAGG 0: 1
1: 0
2: 17
3: 182
4: 1567
1083639565_1083639572 -9 Left 1083639565 11:64138198-64138220 CCTGCCTCCTTGTTAGGAGGAAG 0: 1
1: 0
2: 3
3: 32
4: 426
Right 1083639572 11:64138212-64138234 AGGAGGAAGAGGAGGCTGGGTGG 0: 1
1: 6
2: 51
3: 494
4: 3065
1083639565_1083639575 5 Left 1083639565 11:64138198-64138220 CCTGCCTCCTTGTTAGGAGGAAG 0: 1
1: 0
2: 3
3: 32
4: 426
Right 1083639575 11:64138226-64138248 GCTGGGTGGAGGCCGAGGCCAGG 0: 1
1: 0
2: 9
3: 126
4: 933
1083639565_1083639579 19 Left 1083639565 11:64138198-64138220 CCTGCCTCCTTGTTAGGAGGAAG 0: 1
1: 0
2: 3
3: 32
4: 426
Right 1083639579 11:64138240-64138262 GAGGCCAGGGAGGCCCTGAGAGG 0: 1
1: 1
2: 14
3: 129
4: 835

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083639565 Original CRISPR CTTCCTCCTAACAAGGAGGC AGG (reversed) Intronic
900474014 1:2867975-2867997 CTTCCCCCTGGCCAGGAGGCTGG - Intergenic
901714012 1:11138653-11138675 CTTCCTTTTAAGAAGGAGGAAGG + Intronic
901875604 1:12165554-12165576 CCACCTCCTGACCAGGAGGCTGG - Intergenic
901945662 1:12701626-12701648 GGTCCTTCTAAGAAGGAGGCAGG + Intergenic
902799470 1:18820260-18820282 CACCCTCCTAACAAAGAGGTTGG + Intergenic
903030368 1:20459571-20459593 CTCCCTCCTAATAAGGAGTGTGG - Intergenic
903195853 1:21687685-21687707 CTTCCTCCTAAAAAGGAAATGGG - Intronic
905309346 1:37038454-37038476 CTTCCTGCTACCCAGTAGGCAGG + Intergenic
906028561 1:42697532-42697554 TTTCTCCCTACCAAGGAGGCAGG - Intronic
906583520 1:46955931-46955953 TCTCCTCCTAACAAGGAAGTGGG - Intergenic
907327151 1:53645826-53645848 CTTCCTGCAAGCAAGGAGTCAGG - Intronic
907495144 1:54838785-54838807 CTTGCTCCTATGGAGGAGGCTGG + Intronic
908823333 1:68111123-68111145 CTTCCTACTATTCAGGAGGCTGG - Intronic
908852352 1:68388090-68388112 CTTACTCTTAAAAAGGTGGCTGG + Intergenic
909035418 1:70590118-70590140 TTTCCTCCTAAAAAGGTGGCTGG + Intergenic
909504573 1:76373633-76373655 CTTTCTCATTACCAGGAGGCAGG - Intronic
910151176 1:84148963-84148985 CTTCCTCCTAACAAGCTCCCAGG - Intronic
910837420 1:91529763-91529785 ATTCCTCCAATCAAGGAGGTAGG - Intergenic
911148096 1:94571094-94571116 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
911510670 1:98805165-98805187 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
916042698 1:160974782-160974804 CTTCCTTACAACATGGAGGCTGG - Intergenic
916247757 1:162705641-162705663 CTTCATTCCAACAACGAGGCTGG - Intronic
916492661 1:165315613-165315635 CTTCAGCCTAACAAGGAGTCAGG - Intronic
916910407 1:169340305-169340327 CATCTTCCTCACAAGGCGGCAGG - Intronic
917334568 1:173914509-173914531 GGTGCTCCTAACAAGGTGGCTGG + Intronic
918728652 1:187960593-187960615 GTTCCTCATAACAAGGATGCCGG + Intergenic
920454105 1:206084884-206084906 CTGAATCCTGACAAGGAGGCAGG + Intronic
920751351 1:208680414-208680436 TTTCCTCCTCTCAAGGAGCCTGG - Intergenic
920940111 1:210474178-210474200 CTGCCTCCTAGCATGGGGGCTGG + Intronic
922363605 1:224844383-224844405 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
922824809 1:228510419-228510441 CTTCCTCCTTTCAGGGAGGAGGG + Intergenic
922934771 1:229414208-229414230 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
923214249 1:231834124-231834146 TTTCCTCTTAAAAAGGTGGCTGG - Intronic
923234785 1:232021973-232021995 CTTCCTCACAACATGGAGACTGG + Intronic
1062930696 10:1350536-1350558 TTTCCTCTTAAAAAGGTGGCTGG + Intronic
1062991909 10:1827227-1827249 CTTCCTCCCAACATGGAGGCTGG - Intergenic
1063363059 10:5472587-5472609 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
1063607831 10:7538581-7538603 CTTCCTCACAACATGGCGGCTGG + Intergenic
1066985992 10:42466854-42466876 CTACATCCTCACATGGAGGCAGG + Intergenic
1067360344 10:45572999-45573021 TTTCCTCTTAAAAAGGTGGCTGG + Intronic
1069776730 10:70931648-70931670 CTTCCTCCAGACACGGTGGCTGG + Intergenic
1071821686 10:89286483-89286505 TTTCCTCTTAAAAAGGTGGCTGG + Intronic
1072011331 10:91305417-91305439 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
1072281264 10:93867683-93867705 CTTCCTCATGACAAGGAAGCTGG - Intergenic
1072319938 10:94239391-94239413 CATCCTCTTCACAAGGTGGCAGG - Intronic
1072442262 10:95467553-95467575 CTTCCCACTAACCAAGAGGCGGG + Intronic
1073311882 10:102548808-102548830 TTTCCTACAAACAGGGAGGCAGG + Intronic
1074018974 10:109564146-109564168 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
1074974575 10:118569694-118569716 CTTGCTGGTAAGAAGGAGGCTGG + Intergenic
1076647779 10:131965250-131965272 CTTCTTCCCAGCACGGAGGCTGG + Intergenic
1077191551 11:1257875-1257897 TCTCCTCCTAACGATGAGGCTGG + Intronic
1077524185 11:3054270-3054292 CTTCCTCCTTACTGGGAGGGAGG + Intronic
1078500708 11:11872268-11872290 CTTCCTCACAGCATGGAGGCTGG + Intronic
1078864073 11:15280495-15280517 CTTCCTCCTGAAAAGGATACAGG - Intergenic
1078902548 11:15654795-15654817 CTTCCACCAACCCAGGAGGCAGG - Intergenic
1078912399 11:15745198-15745220 CTTCCTGCTCACAAGATGGCTGG + Intergenic
1080818899 11:35786542-35786564 CTTCCCACTAAAAAGAAGGCTGG - Intronic
1082004813 11:47413664-47413686 CTTCTTGCTCACAAGGAAGCTGG - Exonic
1083270351 11:61569195-61569217 CCTCCTGCTAATTAGGAGGCAGG + Intronic
1083511637 11:63214104-63214126 CATCCTCCAAACAAGGAATCTGG - Intronic
1083534359 11:63454707-63454729 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
1083639565 11:64138198-64138220 CTTCCTCCTAACAAGGAGGCAGG - Intronic
1083766171 11:64842633-64842655 CTTCGTCCAGACAGGGAGGCAGG - Intronic
1084221834 11:67686256-67686278 CATCCTCCAAACAAGGAATCCGG + Intergenic
1084611780 11:70207785-70207807 TTTGCTCCTAGCAAGGAGTCTGG - Intergenic
1085252159 11:75151030-75151052 CTTCCTCTTCACAGAGAGGCTGG + Exonic
1085934214 11:81123639-81123661 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
1086125361 11:83344010-83344032 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
1086134895 11:83435511-83435533 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
1086136325 11:83446818-83446840 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
1086485729 11:87299309-87299331 CTTCTTCTTCACAAGGTGGCAGG + Intronic
1086658003 11:89382798-89382820 TTTCCTCTTAAAAAGGTGGCTGG + Intronic
1089498989 11:118922001-118922023 CTTCCTCTCCACAAGGATGCGGG + Intronic
1089867107 11:121641851-121641873 TTTCCTCCTAAAAAGGTGGCTGG - Intergenic
1090107652 11:123869513-123869535 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
1091040726 11:132278486-132278508 CTTCCTCCTAGCAAGGTGGCTGG + Intronic
1091869038 12:3872116-3872138 CTTCCTCCTACGGAGGAGGAAGG - Intronic
1092138861 12:6168810-6168832 CTTACCCCTATCAAGCAGGCTGG - Intergenic
1092153037 12:6264205-6264227 CCTCCTGCTAGCAGGGAGGCTGG - Intergenic
1092416229 12:8292454-8292476 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
1092592806 12:9966982-9967004 TTTCCTCTTAAAAAGGTGGCTGG - Intronic
1092630096 12:10367635-10367657 CATCCTCCAAACAAGGAATCCGG - Intergenic
1093146142 12:15569197-15569219 ATTTCTCCTATCAAGGAAGCTGG + Intronic
1093812893 12:23509925-23509947 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
1093951018 12:25164948-25164970 TTTCCTCTTAAAAAGGTGGCTGG + Intronic
1094036529 12:26077705-26077727 CTGACTCCTAACAATGAGCCAGG - Intronic
1094316110 12:29138924-29138946 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
1094400611 12:30057773-30057795 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
1095304677 12:40625752-40625774 CTTCCTCTTAAAAAGGAAGGGGG - Intergenic
1095637602 12:44451594-44451616 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
1098629013 12:72705174-72705196 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
1099836147 12:87911300-87911322 GTTCCTCTTAAAAAGGTGGCTGG - Intergenic
1100372674 12:93982902-93982924 CTTGCTCCTACCAAGAAAGCAGG + Intergenic
1101192010 12:102343845-102343867 ATTCCTGCTAAACAGGAGGCAGG - Intergenic
1102281857 12:111624770-111624792 CCTCCTCCTAAGAGGGAGGCGGG - Intergenic
1103862598 12:124026521-124026543 GGTCCTCCTAAGAGGGAGGCAGG - Intronic
1104040007 12:125123534-125123556 CTCCCTCCACGCAAGGAGGCGGG - Intronic
1104382757 12:128322193-128322215 CTTCCTCACAACATGGTGGCTGG - Intronic
1104689332 12:130813598-130813620 CGGCCTCCTAACACGGAGGGAGG + Intronic
1106174729 13:27320541-27320563 CTTCCTCCCAACATGGTGGCTGG + Intergenic
1106933478 13:34692535-34692557 CTGTGTCCTCACAAGGAGGCAGG + Intergenic
1107699070 13:43029315-43029337 CTTCCTCCTCACAAGAGGGGTGG - Intronic
1108202646 13:48058189-48058211 TTTCCTCTTAAAAAGGTGGCTGG + Intronic
1108803929 13:54131604-54131626 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
1109562874 13:64075955-64075977 CTGCCAACTCACAAGGAGGCAGG + Intergenic
1109928628 13:69183286-69183308 CTTCCTCCTCAGACTGAGGCAGG + Intergenic
1110845287 13:80185467-80185489 TTTCCTCCTAAAAAGGTGGCTGG + Intergenic
1112509837 13:99999048-99999070 CCTCATTCTAACAAGGAGGGAGG - Intergenic
1113894366 13:113754429-113754451 CTTCCTCATGACATGGGGGCTGG - Intergenic
1114654591 14:24308488-24308510 CCTCCTCCGACCAAGGAGGAAGG - Exonic
1116013695 14:39381124-39381146 CTTCTCCCTAAAAAGGAGTCTGG + Intronic
1116490643 14:45499307-45499329 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
1117957971 14:61137347-61137369 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
1119248451 14:73132556-73132578 TTTCCTCCTAAAGAGGTGGCTGG - Intergenic
1120142259 14:80941972-80941994 TTGCCTCCTACAAAGGAGGCTGG - Intronic
1121487545 14:94330428-94330450 CTTCCTGCTGACCAGGAGGCTGG + Intergenic
1121980638 14:98451048-98451070 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
1122381377 14:101309567-101309589 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
1123482399 15:20644265-20644287 CTTCCTCCCAGCAAGGAGACAGG + Intergenic
1123882548 15:24689472-24689494 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
1126530209 15:49703034-49703056 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
1127214416 15:56809615-56809637 CTTCCTCATAGCATGGCGGCTGG + Intronic
1127809784 15:62554733-62554755 GTTTCACCTAACAAGGAGACAGG + Intronic
1128633534 15:69288287-69288309 CGTCCTTTTAAGAAGGAGGCAGG - Intergenic
1128765875 15:70250816-70250838 CTGCCTCTTCTCAAGGAGGCAGG + Intergenic
1129259382 15:74355716-74355738 TTTCCTCTTAAAAAGGTGGCTGG + Intronic
1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG + Exonic
1131447687 15:92513309-92513331 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
1132405403 15:101539144-101539166 CTTCCTCACAACATGGTGGCTGG - Intergenic
1135025466 16:18996035-18996057 TTTCCTCTTAAAAAGGTGGCTGG - Intronic
1135683388 16:24478166-24478188 CTTCCTCCTAATGATGGGGCAGG + Intergenic
1137354437 16:47746733-47746755 CTTCCTCATAAGAGGGAGGTTGG - Intergenic
1137648135 16:50093772-50093794 CTTCCTCATAACAGGATGGCTGG + Intronic
1137721006 16:50627467-50627489 CTTCCTCCCACCGAGGAGCCAGG + Intronic
1137938314 16:52656825-52656847 CTTCTTTCTTTCAAGGAGGCAGG - Intergenic
1138155740 16:54701441-54701463 CTTCCTCACAACATGGTGGCTGG - Intergenic
1138656670 16:58495543-58495565 CTTCCACCTTACCAGGAGGAAGG - Intronic
1138759155 16:59521526-59521548 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
1138804897 16:60080658-60080680 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
1139328673 16:66171049-66171071 CTTCTCCCTATCAAGGAAGCAGG + Intergenic
1139464568 16:67147403-67147425 CTCTCAACTAACAAGGAGGCAGG + Exonic
1140045030 16:71434790-71434812 CTTCCTTCTAATAGGGAGGTAGG - Intergenic
1140322150 16:73963340-73963362 CTTCCTCCCAAGATGGCGGCTGG - Intergenic
1140422994 16:74836055-74836077 AGTCCTTCTAAGAAGGAGGCAGG - Intergenic
1140708847 16:77657503-77657525 CATCTTCCTAGCAAGGTGGCAGG + Intergenic
1140952598 16:79833525-79833547 CTACCTCATAACAGGGGGGCTGG - Intergenic
1141010731 16:80395949-80395971 CTTCCTCACAACATGGTGGCTGG + Intergenic
1141447359 16:84069812-84069834 CCTCCTCCCACCACGGAGGCTGG + Intronic
1141638278 16:85327131-85327153 CTTCCTCACAACATGGTGGCAGG + Intergenic
1141713187 16:85712075-85712097 CATCCTCGTAACATGGTGGCTGG - Intronic
1142717616 17:1755563-1755585 CTTCTCCCAAACCAGGAGGCTGG - Intergenic
1143624298 17:8100246-8100268 CTTCCTCATAGCACGGTGGCTGG - Intronic
1143967737 17:10768817-10768839 CTTCCTTCCAACATGGTGGCTGG - Intergenic
1144617162 17:16787291-16787313 CTTCCTCTAAACCAGGAAGCTGG + Intronic
1144895532 17:18528382-18528404 CTTCCTCTAAACCAGGAAGCTGG - Intergenic
1145055984 17:19704318-19704340 CTTGCTGCTGACAATGAGGCAGG + Intronic
1145132672 17:20371511-20371533 CTTCCTCACAACATGGGGGCTGG + Intergenic
1145136684 17:20415848-20415870 CTTCCTCTAAACCAGGAAGCTGG + Intergenic
1145271131 17:21405523-21405545 CTTCCTCTGAAAAACGAGGCTGG - Intronic
1145866273 17:28243869-28243891 CACCCTCCTCACAAGGTGGCAGG - Intergenic
1151752135 17:76045347-76045369 CTTCCTCTAAACCAGGAAGCTGG + Exonic
1152044562 17:77927529-77927551 CTTCCTCAAAAGAAGGGGGCTGG + Intergenic
1153327136 18:3832408-3832430 CTTCCTCCTAGTAACGATGCTGG + Intronic
1153706214 18:7748374-7748396 CTCCCTCCTCACAAGGAGCTTGG - Intronic
1155173766 18:23285844-23285866 TTTCCTCTTAAAAAGGTGGCTGG + Intronic
1155892745 18:31288149-31288171 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
1156237297 18:35217552-35217574 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
1156251986 18:35360234-35360256 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
1156302192 18:35845680-35845702 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
1156366050 18:36428392-36428414 CTTCCTCCAAAGATGGAGGAAGG - Intronic
1156924111 18:42556411-42556433 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
1156958126 18:42992684-42992706 TTTCCTCTTAAAAAGGTGGCTGG + Intronic
1157450180 18:47780422-47780444 CTTCCTCATAGCAAGGAGGCTGG - Intergenic
1157547872 18:48560184-48560206 ATTCCTCCTAACAAGAAGTAGGG - Intronic
1157717975 18:49902269-49902291 GGTCCTCCTAAGAGGGAGGCTGG - Intronic
1160579313 18:79874735-79874757 CTCCCTCCTCTCCAGGAGGCCGG + Intronic
1161326843 19:3668172-3668194 CTTCCTCCATGCAAGGAGGCTGG + Intronic
1161610243 19:5238265-5238287 CTCGCTCCAAACAGGGAGGCCGG + Intronic
1163130484 19:15269528-15269550 CTTCATGGTGACAAGGAGGCAGG - Intronic
1163679754 19:18674202-18674224 ATTTCTCATAACAAGGAGACTGG + Intergenic
1163944505 19:20522972-20522994 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
1164010379 19:21198284-21198306 CATCCTCCAAACAAGGAATCTGG + Intergenic
1164202550 19:23030714-23030736 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
1165446494 19:35859670-35859692 CTTCCTCATACCCAGGAGTCAGG - Intronic
1165570745 19:36772818-36772840 CTTCCTCTTAGCCAGGTGGCGGG - Intronic
1165913124 19:39241897-39241919 AGTCCTTCTAAGAAGGAGGCCGG - Intergenic
1165917997 19:39272845-39272867 AGTCCTTCTAAGAAGGAGGCCGG + Intergenic
1166535935 19:43574870-43574892 CCTCCTCCTCACTAGGAGTCTGG - Intronic
1166927197 19:46277236-46277258 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
1166972801 19:46581500-46581522 CTTCCTCACAACATGGTGGCTGG + Intronic
924983596 2:246829-246851 CTTCCTCCTAATAAGGCTGAGGG + Intronic
925031815 2:655720-655742 CTGCCTCACAACAAGGTGGCTGG - Intergenic
925726895 2:6881872-6881894 CATCCTCCTAAAATGCAGGCAGG + Intronic
925726903 2:6881917-6881939 CATCCTCCTAAAATGCAGGCAGG + Intronic
925726912 2:6881962-6881984 CATCCTCCTAAAATGCAGGCAGG + Intronic
926009186 2:9395003-9395025 CTTCCTCATATCACGGTGGCTGG + Intronic
928124650 2:28607102-28607124 ATTCCTCCTTAAAAGGAGCCTGG - Intronic
928403129 2:30993594-30993616 CTTCCTCCTACCCAGGAATCTGG + Intronic
929004888 2:37384892-37384914 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
930710892 2:54550199-54550221 CTGCCTCGTAAGTAGGAGGCAGG - Intronic
931968096 2:67555882-67555904 CTTCCTCCTGGGAGGGAGGCTGG + Intergenic
932555919 2:72825228-72825250 CGTCCTCGTAACAGGGAGGCAGG + Intronic
934718908 2:96559300-96559322 CTATCTCCTTACAAGGATGCCGG - Intergenic
935888116 2:107646940-107646962 CTGCCTTGTGACAAGGAGGCTGG + Intergenic
936162496 2:110095054-110095076 CTACCTCCTAAACAGGAGGAGGG + Intronic
936182164 2:110276312-110276334 CTACCTCCTAAACAGGAGGAGGG - Intergenic
936794347 2:116188149-116188171 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
937144459 2:119630751-119630773 CTTCATCCTAACAAGGAGCAAGG - Exonic
938058849 2:128236636-128236658 ATTCTACCTAACAGGGAGGCCGG + Intergenic
939004566 2:136770962-136770984 CTTCCTCTTAACAGGAAGGAAGG - Intronic
939230009 2:139412380-139412402 ATTCCTTATAAGAAGGAGGCAGG + Intergenic
939307356 2:140427943-140427965 TTTCCTCTTAAAAAGGTGGCTGG + Intronic
939536181 2:143432508-143432530 GTTCCTCTTAATATGGAGGCAGG - Intronic
940197238 2:151108500-151108522 CTTCCTTGCAACATGGAGGCTGG + Intergenic
940322170 2:152389280-152389302 CTGTCTCCAAACCAGGAGGCAGG - Intronic
940508849 2:154587147-154587169 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
940771940 2:157848333-157848355 CTTCCTCATAGCATGGCGGCTGG - Intronic
942097032 2:172543538-172543560 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
942575905 2:177363323-177363345 CTTCCACCTATCACAGAGGCAGG + Intronic
943461248 2:188173115-188173137 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
943835348 2:192509275-192509297 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
943951350 2:194134808-194134830 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
945376052 2:209079887-209079909 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
945554639 2:211263284-211263306 TTTCCTCTTAAAGAGGAGGCTGG + Intergenic
945650167 2:212548239-212548261 CTTCATCCTAACAAAGACCCTGG - Intergenic
945938264 2:215924198-215924220 TTTACTCCTAAAAAGGTGGCTGG + Intergenic
945967614 2:216205681-216205703 CTTCCTCCCAACAAGCAGCTGGG + Exonic
946040394 2:216778224-216778246 CTTCCCCGTAACATGGAGGCTGG + Intergenic
946577296 2:221089504-221089526 CTTCATCCTATCAGGAAGGCAGG - Intergenic
947111268 2:226721776-226721798 CTTCCCTAAAACAAGGAGGCAGG + Intergenic
948182166 2:235990559-235990581 CTTCCTTCCAACATGGTGGCTGG + Intronic
948459882 2:238123920-238123942 CTGCCTCCCAGCAAGGATGCTGG - Intronic
948672296 2:239576259-239576281 CTTCCTCCCAACATGGCGGCCGG + Intergenic
1168743535 20:215835-215857 CTTCCTTCTAACATGGTGGCTGG - Intergenic
1168810731 20:702932-702954 CTTCCTCCTAGCATGCAGGCTGG - Intergenic
1169429366 20:5522744-5522766 ATTCCTTCCATCAAGGAGGCAGG + Intergenic
1170408892 20:16067378-16067400 CTTCCTCCCAATATGGTGGCTGG - Intergenic
1170877305 20:20262356-20262378 CTTCCTCATAACGTGGTGGCTGG - Intronic
1172310069 20:33911206-33911228 CTTCTTTCTTTCAAGGAGGCAGG + Intergenic
1172919582 20:38469996-38470018 CTTCCTCCCAACATGGTGGCTGG + Intergenic
1173570326 20:44071641-44071663 CTGCCTCCCAAGAAGGAGGAAGG - Intergenic
1175134154 20:56810327-56810349 CTTCCTCCCAACATGGTGGCTGG - Intergenic
1176082952 20:63283115-63283137 CCTGCTCCCAACAAGGTGGCCGG - Intronic
1176346166 21:5749940-5749962 CATCCTCCAAACAAGGAATCCGG + Intergenic
1176352980 21:5870524-5870546 CATCCTCCAAACAAGGAATCCGG + Intergenic
1176498661 21:7574515-7574537 CATCCTCCAAACAAGGAATCCGG - Intergenic
1176540487 21:8148010-8148032 CATCCTCCAAACAAGGAATCCGG + Intergenic
1176559438 21:8331055-8331077 CATCCTCCAAACAAGGAATCCGG + Intergenic
1177031228 21:15983701-15983723 TTTCCTCTTAAGAAGGTGGCTGG - Intergenic
1177119509 21:17123278-17123300 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
1178001145 21:28163006-28163028 TTTCCTCTTAAAAAGGAGGCTGG + Intergenic
1178814808 21:35919428-35919450 CTTCCTCTCAACATGGTGGCTGG + Intronic
1179650425 21:42804945-42804967 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
1179717247 21:43295758-43295780 CTTCCTCACAACATGGCGGCTGG + Intergenic
1179879146 21:44286257-44286279 CTCCCTCCCCACAAGGAGCCAGG + Intronic
1182009473 22:26988522-26988544 TTTCCTCCTAACAGTGTGGCAGG + Intergenic
1182271661 22:29157690-29157712 CTTCCTGAAAACACGGAGGCTGG + Intronic
1182998552 22:34836130-34836152 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
1183027235 22:35074505-35074527 CTGCCTCCTTACAAGGAGTGGGG - Intronic
1184280983 22:43437358-43437380 AATCCTCCTGACAATGAGGCAGG + Intronic
1203245430 22_KI270733v1_random:64428-64450 CATCCTCCAAACAAGGAATCCGG + Intergenic
949573973 3:5320793-5320815 CTTCCTCCCAGCATGGTGGCTGG + Intergenic
949861632 3:8510319-8510341 GATCCTCTTAACAAGGAGACTGG - Intronic
950554510 3:13687141-13687163 CTCCCTCCACACAAGGAGGAAGG - Intergenic
950643827 3:14365341-14365363 CTTCCTCACAACATGGTGGCTGG + Intergenic
950703206 3:14764737-14764759 CTTCCTCACAACATGGTGGCTGG + Intronic
950994354 3:17479877-17479899 CCTCTTCCTATCAAGTAGGCAGG + Intronic
951762853 3:26164280-26164302 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
951889039 3:27552052-27552074 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
952116562 3:30188825-30188847 CTTTCTCCTAGCATGGTGGCTGG - Intergenic
952865242 3:37850856-37850878 CTTCCTCACAACATGGTGGCTGG - Intergenic
952929529 3:38348220-38348242 CGTGCACCTGACAAGGAGGCGGG - Intronic
953007979 3:38995499-38995521 CTGCCTCCCAACATGGAGGAAGG - Intergenic
953576473 3:44116777-44116799 TTTCCTCCTCATAAGCAGGCAGG + Intergenic
953609127 3:44433025-44433047 CAACATCCTAACAAGGAGACGGG + Intergenic
954185668 3:48915427-48915449 CTTCCTGGTAACATGGTGGCTGG - Intergenic
955015667 3:55066504-55066526 CTCCCTCCAAACAAGCACGCGGG - Intronic
955727383 3:61947860-61947882 CCTCCTCTGAAAAAGGAGGCAGG - Intronic
956125201 3:66004434-66004456 CTTCCTCATAGCATGGTGGCTGG + Intronic
956750836 3:72342622-72342644 GGTCCTTCTAAGAAGGAGGCAGG - Intergenic
956756082 3:72388346-72388368 TTTGCTCCTTCCAAGGAGGCAGG - Intronic
958843943 3:99242481-99242503 CTTCCTCCTGAGTATGAGGCAGG + Intergenic
959288405 3:104443802-104443824 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
959485825 3:106926614-106926636 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
960365778 3:116770598-116770620 TTTCCTCCTAAAAAGCAGACAGG + Intronic
961243150 3:125429801-125429823 CTTCCTCACAACATGGAGGCTGG - Intergenic
961363379 3:126382279-126382301 CTTCCTCACTACATGGAGGCTGG + Intergenic
962090679 3:132241217-132241239 CTTCCTCATAGCATGGTGGCTGG - Intronic
963058563 3:141206765-141206787 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
963128023 3:141833213-141833235 CCTCCTCATAAAAGGGAGGCAGG + Intergenic
963304425 3:143635238-143635260 CTTCCTCACAGCAAGGTGGCTGG + Intronic
963319679 3:143799073-143799095 TTTCCTCTTAAAAAGGTGGCTGG + Intronic
963850339 3:150204615-150204637 CTTTCTCTTTACAAGGAGGGAGG + Intergenic
963901693 3:150739078-150739100 GTTCCTCCTTACAAGAACGCTGG + Intergenic
963974111 3:151461223-151461245 CTTTCTCCTAGCAAGTTGGCAGG + Intergenic
964300309 3:155279108-155279130 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
964906564 3:161725755-161725777 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
964941013 3:162158065-162158087 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
964983583 3:162714191-162714213 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
966066788 3:175829534-175829556 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
966397597 3:179518655-179518677 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
967315139 3:188144905-188144927 CATCCTCCTCACAAGAAGGCTGG + Intergenic
967643892 3:191899292-191899314 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
969003867 4:4004127-4004149 TTTCCTCTTAATAAGGTGGCTGG - Intergenic
969749001 4:9096057-9096079 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
970256474 4:14174415-14174437 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
970532673 4:16999480-16999502 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
970854104 4:20634194-20634216 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
972346343 4:38195644-38195666 CTTCTTCCTCTCAAGGTGGCAGG + Intergenic
973840191 4:54853206-54853228 TTTTCTCCTACCAAGAAGGCAGG - Intergenic
974456360 4:62133736-62133758 CTTCCTCCAGAGAAGGAAGCAGG - Intergenic
974849472 4:67387444-67387466 TTTTCTCCCAACAAGTAGGCAGG + Intergenic
975504715 4:75125151-75125173 CTTCCTCCTAGCATGGAGACTGG - Intergenic
976558514 4:86476370-86476392 TTTCCTCTTAAAAAGGTGGCTGG + Intronic
976864010 4:89702366-89702388 CTTCCTCACAACATGGTGGCTGG + Intergenic
978031423 4:103942936-103942958 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
979108340 4:116716969-116716991 TTTCCTCACAACAAGAAGGCTGG - Intergenic
980472492 4:133267607-133267629 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
980823721 4:138048808-138048830 CTTCCTCCGAGAAAGGAGGTGGG - Intergenic
984322133 4:178208943-178208965 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
984437205 4:179722241-179722263 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
985682343 5:1263013-1263035 CTCCCTCCCCACAAGGATGCCGG - Intronic
985877375 5:2610183-2610205 CATCCTCCTGACATGGCGGCTGG + Intergenic
986206591 5:5630405-5630427 CTTTCTCTTAACAAAGATGCTGG + Intergenic
986437248 5:7746204-7746226 CCTCCTCCTCACAAGAAGCCTGG + Intronic
986456844 5:7928150-7928172 CTTCCTGCGGACTAGGAGGCTGG - Intergenic
986464677 5:8008991-8009013 CTTCCTTATAAGAAGAAGGCAGG - Intergenic
990335902 5:54772564-54772586 CTTCCTCAGAACATGGAGGCTGG + Intergenic
990549712 5:56862225-56862247 CTTCCTCCTAGCACGAAGACTGG + Intronic
991948768 5:71927456-71927478 CTTCCTCACAGCATGGAGGCAGG - Intergenic
992748303 5:79839875-79839897 CTTCCTAAAAGCAAGGAGGCTGG + Intergenic
992950991 5:81857742-81857764 TTTCCTCCTGCCTAGGAGGCTGG + Intergenic
992960775 5:81955070-81955092 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
993205735 5:84875877-84875899 ATTCCTCCTAATTAGGAGGAAGG - Intergenic
994126168 5:96170798-96170820 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
994153080 5:96472594-96472616 CTGTCTCCTCACAATGAGGCTGG - Intergenic
994295090 5:98080860-98080882 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
994989495 5:106980202-106980224 CTTACTCTTAAAAAGGTGGCTGG + Intergenic
995885867 5:116893590-116893612 CTTCCCCCTACCAAGGGGACTGG + Intergenic
996358684 5:122622795-122622817 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
996509849 5:124305582-124305604 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
996575059 5:124970520-124970542 TTTCCTCTTAAAAAGGTGGCAGG - Intergenic
996624806 5:125557723-125557745 CTTCCTCTTATAAAGGAGGAAGG - Intergenic
998693760 5:144615268-144615290 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
999748933 5:154611703-154611725 CTTCCTTCTCACGAGGAGGGGGG + Intergenic
999945093 5:156587176-156587198 TTTCCTCCTAACAAAAGGGCAGG - Intronic
1000849571 5:166323326-166323348 CTTCCTCCTAAGACTGTGGCTGG - Intergenic
1000885382 5:166743011-166743033 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
1001482761 5:172099942-172099964 CTTCCTCCTCCTAAGGACGCTGG - Intronic
1002279533 5:178122336-178122358 CTTCCTCCAGGGAAGGAGGCTGG + Exonic
1003332584 6:5142266-5142288 CTTCCTCACAACATGGCGGCTGG - Intronic
1003514244 6:6805046-6805068 ATTCCTGCTAACAAGGATGGTGG - Intergenic
1003718408 6:8673265-8673287 GTTCATCCTAACAAGGAGCTAGG - Intergenic
1006098081 6:31668675-31668697 CTTACTGCTCAGAAGGAGGCAGG - Intronic
1006503839 6:34475527-34475549 CTTCCTCCAGACAAGGGGCCAGG + Intronic
1006739401 6:36296679-36296701 CTTTCTCCCAACAAGGGGGGTGG + Intronic
1006849194 6:37085270-37085292 CTTTCTCCTGCCAAGGAGGAAGG - Intergenic
1007488550 6:42199626-42199648 CTTCCTCACAACATGGTGGCTGG - Intergenic
1008151270 6:47954920-47954942 CTTCCTCACAACATGGTGGCTGG - Intronic
1008476467 6:51939968-51939990 TTTCCTCTTAAAAAGGTGGCTGG + Intronic
1009379090 6:63007101-63007123 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
1010829748 6:80514221-80514243 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
1010841371 6:80651725-80651747 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
1011104675 6:83766442-83766464 TTTCCTATTAATAAGGAGGCTGG + Intergenic
1011284291 6:85706714-85706736 CTGCCCCCTAACAAGTTGGCAGG - Intergenic
1012675044 6:102103771-102103793 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
1014612030 6:123558436-123558458 TTTCCTCTTAAAAAGGTGGCTGG + Intronic
1015165168 6:130194155-130194177 TTTCCTCTTAAAAAGGTGGCTGG + Intronic
1015269603 6:131325224-131325246 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
1015606976 6:134967998-134968020 CTTCCTCCTAACAGAGAAACAGG + Intronic
1017389441 6:153923307-153923329 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
1017779387 6:157704572-157704594 TTTCCTCTTAAAAAGGTGGCTGG - Intronic
1018077533 6:160230280-160230302 TTTCCTCTTAAAAAGGTGGCTGG + Intronic
1018495458 6:164342627-164342649 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
1018564666 6:165138599-165138621 CATCTTCTTCACAAGGAGGCAGG - Intergenic
1018776820 6:167024766-167024788 CTTCCTCCTAACAAGAAACAAGG - Exonic
1018826262 6:167409846-167409868 GCTCCTCCTTCCAAGGAGGCCGG + Intergenic
1019501274 7:1366055-1366077 CTTCCTCACAACATGGTGGCAGG + Intergenic
1019515230 7:1436939-1436961 CTTCCTCCAAAAGAGGAGCCTGG - Intronic
1020794149 7:12661380-12661402 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
1021172614 7:17415612-17415634 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
1022021614 7:26404979-26405001 CTTCCTACTTACAAGGTGCCAGG + Intergenic
1022709013 7:32834191-32834213 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
1023079302 7:36512816-36512838 CTTCCTCCTATGCAGGCGGCTGG - Intergenic
1024764127 7:52636524-52636546 CTTCCTACTTACAAAGAGACAGG - Intergenic
1024868790 7:53937321-53937343 ATTTCTCCTAACAAGAAGGTGGG + Intergenic
1025073055 7:55918178-55918200 TTTCCTCCTGACAAGGTGGTCGG - Intronic
1025988076 7:66473622-66473644 GTTCCTCCTTTCAACGAGGCTGG + Intergenic
1026178442 7:68018016-68018038 CTTCCTCCAAACATGGTGGCTGG + Intergenic
1026189269 7:68109878-68109900 CTCCCTCTTCACAAGGTGGCAGG + Intergenic
1027157823 7:75780939-75780961 TTTCCTCTTAAAAAGGTGGCGGG + Intronic
1027211061 7:76149519-76149541 GTTCCTCCTTTCAAAGAGGCTGG + Intergenic
1027234087 7:76287490-76287512 CTTCCTCCCAGCCTGGAGGCCGG + Intergenic
1028048261 7:86151272-86151294 CTTGTCCCTAACAAGGTGGCAGG - Intergenic
1029132663 7:98344637-98344659 CTTCTTCCTAAGAAGTAGGCTGG + Intronic
1029500158 7:100923959-100923981 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
1030198175 7:106874080-106874102 CTTCCTCCTAAAAATGATGATGG + Intronic
1031355254 7:120781040-120781062 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
1031668662 7:124517245-124517267 CATCTTCTTCACAAGGAGGCAGG - Intergenic
1032442339 7:131951576-131951598 CTTCCTCACAACATGGTGGCTGG - Intergenic
1032706857 7:134427536-134427558 CTTCCTCAGAACATGGTGGCTGG - Intergenic
1033239213 7:139663322-139663344 TTTCTTCCTAACTAGGAAGCGGG + Intronic
1033465094 7:141582711-141582733 TTTCCTCTTAAAAAGGTGGCTGG - Intronic
1034084890 7:148313963-148313985 TTTCCTCTTAAAAAGGTGGCTGG - Intronic
1036472390 8:9063361-9063383 TTTCCTCTTAAAAAGGTGGCTGG - Intronic
1036639433 8:10573068-10573090 TTTCCTCCTAAAAAGGTGGCTGG + Intergenic
1039430632 8:37522398-37522420 TTTCCTGATAACAATGAGGCTGG + Intergenic
1039752731 8:40493014-40493036 CCTCCTCCCACCAAGTAGGCAGG - Intergenic
1039806594 8:41005143-41005165 CTTCCACATAACAAGGGGCCTGG - Intergenic
1041350729 8:56945800-56945822 CTTCTTCTTCACAGGGAGGCAGG + Intergenic
1041917599 8:63152226-63152248 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
1042307154 8:67343758-67343780 TTTCCTCCCAACATGGCGGCCGG - Intergenic
1042810771 8:72823040-72823062 CTGGCTCCTAAGAAGGAGGAAGG + Intronic
1043347773 8:79319999-79320021 GTTACTCCTAGCAAAGAGGCTGG + Intergenic
1043837674 8:85064751-85064773 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
1046030115 8:108773669-108773691 TTTCCTCCAAACAAGGCTGCTGG - Intronic
1046294065 8:112197643-112197665 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
1047215005 8:122869180-122869202 CTTTCTCCTGGGAAGGAGGCAGG - Intronic
1047856317 8:128916213-128916235 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
1048143717 8:131820977-131820999 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
1048439280 8:134448009-134448031 ATTCCACCTGACAAGGATGCTGG + Intergenic
1049376550 8:142292077-142292099 TTTCCTCCTGGCATGGAGGCTGG - Intronic
1052163028 9:25289494-25289516 TTTCCTCTTAATAAGGTGGCTGG + Intergenic
1052191776 9:25670722-25670744 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
1052282650 9:26750731-26750753 CTTCCTCCTAGGAAGGAGGTTGG + Intergenic
1052720696 9:32168444-32168466 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
1053294499 9:36903049-36903071 CTTCCTCCTCTCAGGCAGGCCGG + Intronic
1055347775 9:75355696-75355718 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
1056016384 9:82392683-82392705 CTTCCTTCTATCCAGGATGCAGG + Intergenic
1056363644 9:85882477-85882499 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
1056740210 9:89247965-89247987 CAGCCTCCTGACAAGGAGGCAGG + Intergenic
1057812637 9:98269734-98269756 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
1058382871 9:104397387-104397409 CTACCTCCTAACAAGATAGCTGG - Intergenic
1060008086 9:120018153-120018175 CTGCCTCCTATCAGGGAGCCTGG + Intergenic
1060898308 9:127234243-127234265 CTTCCTCCAAGAAAGGAAGCTGG - Intronic
1061306092 9:129734201-129734223 CTTCCTCCTAAGAAGGTGTGTGG + Intergenic
1061583003 9:131548874-131548896 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
1062028839 9:134352887-134352909 CTTCCTCACACCAAGGAAGCAGG - Intronic
1062054058 9:134461781-134461803 CATCCTCTCAACATGGAGGCTGG + Intergenic
1203461766 Un_GL000220v1:47500-47522 CATCCTCCAAACAAGGAATCCGG + Intergenic
1185763241 X:2704325-2704347 CTTCATCCTAACTAGGACGACGG - Intronic
1186880159 X:13857100-13857122 CATCCTTATAAGAAGGAGGCAGG - Intronic
1187926935 X:24259033-24259055 CTGGCTTCTACCAAGGAGGCAGG + Intergenic
1188552596 X:31379310-31379332 TTTCCTCTTAAAAAGGTGGCTGG + Intronic
1189345751 X:40240065-40240087 CTTCCTCATAGCATGGAGGCTGG + Intergenic
1189928405 X:45982119-45982141 CTTCCTCATAGCATGGTGGCTGG - Intergenic
1190054656 X:47174636-47174658 CTGCCTCCAAAGAAGGAGGGAGG - Intronic
1192185911 X:68946755-68946777 CTTTCTCCCAACATGGAGGCAGG - Intergenic
1192659435 X:73026827-73026849 CTTCTCCCTAAGAGGGAGGCTGG + Intergenic
1194568256 X:95520854-95520876 ATACCTCCTCACAGGGAGGCAGG + Intergenic
1194873855 X:99163335-99163357 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
1195470544 X:105224943-105224965 CTTCATCCAAACAAGAAAGCAGG + Intronic
1195841426 X:109180214-109180236 TTTCCTCCTAAAAAGGTGGCTGG + Intergenic
1196221043 X:113112621-113112643 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
1196496808 X:116332609-116332631 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
1196525535 X:116724881-116724903 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
1196992741 X:121346903-121346925 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
1197499667 X:127228381-127228403 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
1198074943 X:133185251-133185273 ATTCCTCCTAGCATGCAGGCTGG - Intergenic
1198965861 X:142228334-142228356 TTTCCTCTTAAAAAGGTGGCTGG + Intergenic
1198983811 X:142427485-142427507 TTTCCTCTTAAAAAGGTGGCTGG - Intergenic
1202095026 Y:21240976-21240998 CATCCTCCGAAGAAGGAGTCTGG + Intergenic