ID: 1083641744

View in Genome Browser
Species Human (GRCh38)
Location 11:64149400-64149422
Sequence CTCCATTTGCACCAGGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 188}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083641744_1083641751 23 Left 1083641744 11:64149400-64149422 CCCTGGCCCTGGTGCAAATGGAG 0: 1
1: 0
2: 4
3: 18
4: 188
Right 1083641751 11:64149446-64149468 GAGCTGCTGCATCCAAAACCTGG 0: 1
1: 0
2: 0
3: 14
4: 160
1083641744_1083641749 1 Left 1083641744 11:64149400-64149422 CCCTGGCCCTGGTGCAAATGGAG 0: 1
1: 0
2: 4
3: 18
4: 188
Right 1083641749 11:64149424-64149446 TGGCACTAAACCGCTTCTGATGG 0: 1
1: 0
2: 0
3: 8
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083641744 Original CRISPR CTCCATTTGCACCAGGGCCA GGG (reversed) Intronic
900124792 1:1064600-1064622 CTCCACAGGCACCAGGGCCGTGG + Intergenic
900412762 1:2520409-2520431 CTCCACCTGCAACAGAGCCAGGG + Exonic
901040061 1:6358359-6358381 CTCCATTTTGGCCAGGGGCAGGG + Intronic
901797491 1:11688927-11688949 CTCCACTCCCACCAGTGCCATGG + Intronic
903283171 1:22261739-22261761 CTCCATAAGCACTAGGGGCAGGG - Intergenic
904206167 1:28856679-28856701 CCCCTTCTGCACCAGGGCCTGGG - Intronic
904354051 1:29927011-29927033 CACCACCTGCACCAGGGCCAAGG + Intergenic
905347838 1:37323478-37323500 CTCCATTACCACCCTGGCCATGG + Intergenic
908121924 1:60993980-60994002 CTCCACTTGCCCCTGGTCCAAGG - Intronic
909232345 1:73106194-73106216 CACCAGCTCCACCAGGGCCATGG + Intergenic
911492273 1:98585140-98585162 CTGCATTTGTACCAGTACCATGG - Intergenic
917540667 1:175910693-175910715 CTCTATTTGGAAAAGGGCCAAGG + Intergenic
922910125 1:229208865-229208887 CCCCACTTGCACCACAGCCAAGG + Intergenic
923095866 1:230774675-230774697 CTCCTTACGCCCCAGGGCCATGG - Intronic
923463571 1:234228694-234228716 GTCCATTTGTACTAGGGGCACGG + Intronic
923513223 1:234671697-234671719 CTCTAATTACACCAGGGCAAGGG - Intergenic
924196916 1:241617606-241617628 CTCCATTTGCATCAGCAGCAGGG - Intronic
1063494164 10:6491393-6491415 CTTCATTTCCCCCAGGGCTATGG + Intronic
1063562977 10:7147365-7147387 GTATATTTGCACCAGAGCCAAGG + Intergenic
1065293823 10:24256434-24256456 CTGCACTTACTCCAGGGCCAGGG - Intronic
1066041677 10:31554448-31554470 CTCCATGGGAACCAGTGCCAGGG + Intergenic
1067750420 10:48967940-48967962 CTCCATTTGCCCCAGGACTGGGG + Intronic
1069779663 10:70946746-70946768 CTCCATCTGCACCTTCGCCAAGG + Intergenic
1069896923 10:71685687-71685709 CTCCGGCTGCCCCAGGGCCAGGG - Intronic
1070306882 10:75245023-75245045 CTCTATTTGCCCCAGGGCCAGGG + Intergenic
1073437382 10:103527719-103527741 CTCCATCTTCAACAGGGCCTGGG - Intronic
1074148828 10:110740462-110740484 CTCCCTCTGCAGCAGGGCCTTGG - Intronic
1076537342 10:131188084-131188106 CTCTAATTGCACCAGAGTCAGGG - Intronic
1076676096 10:132148538-132148560 CACCAGCTGCAGCAGGGCCACGG - Intronic
1077537424 11:3131125-3131147 CTCCAGTTCCACCTGGGCCAAGG + Intronic
1079333599 11:19552580-19552602 CTCCATTTGTCACAAGGCCATGG + Intronic
1081617279 11:44598302-44598324 TTCCTTTTGCCCCAGGGCCCAGG - Intronic
1083022731 11:59523655-59523677 GTCCATTTGTATCAGAGCCAGGG - Intergenic
1083160296 11:60850273-60850295 CTGCTTCTGCAGCAGGGCCAGGG - Exonic
1083470396 11:62880519-62880541 CTCCATTTGCCCCTGGTTCACGG - Intronic
1083641744 11:64149400-64149422 CTCCATTTGCACCAGGGCCAGGG - Intronic
1087526173 11:99316139-99316161 CTAGATTTGCTCCAAGGCCAAGG + Intronic
1089555680 11:119314991-119315013 TTCCGTGTGCGCCAGGGCCAGGG - Exonic
1092529273 12:9331341-9331363 CTCCGTGGGCACCAGGGACATGG - Intergenic
1095992216 12:48043097-48043119 CTGTATTTGGACCAGGTCCAGGG + Exonic
1096883062 12:54688270-54688292 CTCCATCTGTACCATGCCCAAGG - Intergenic
1099890533 12:88584150-88584172 CTCCCTTTTTTCCAGGGCCAAGG + Intergenic
1105979464 13:25503536-25503558 CTCCATTTGCACATGGGGCCAGG + Intronic
1106379825 13:29225243-29225265 CTTCATTTGCAAGAGGACCATGG + Intronic
1111402624 13:87761090-87761112 CACCATTTGCTCCTAGGCCAGGG - Intergenic
1111524683 13:89452799-89452821 CTCCACTTGCCGCTGGGCCAGGG - Intergenic
1111639411 13:90947936-90947958 CTACATTTGCTCCAGGCCCTAGG - Intergenic
1113774220 13:112933527-112933549 CTGAATCTGCAGCAGGGCCAGGG - Intronic
1114082152 14:19210718-19210740 TTCCGCTTGGACCAGGGCCAGGG + Intergenic
1114955621 14:27814597-27814619 CTTCATTTTCACCAGGGGAAGGG - Intergenic
1116274068 14:42807778-42807800 ATCCATCTGCACCAGGGTCTTGG - Intergenic
1116353093 14:43891409-43891431 ATTCATTTGCACTAGGGCGAAGG + Intergenic
1118896840 14:69952427-69952449 CACCCCTTCCACCAGGGCCAAGG + Intronic
1120119496 14:80661246-80661268 CTCCATTTTCAACAATGCCATGG + Intronic
1121284802 14:92726770-92726792 CTTCCTTTCCACCAGGGCCCTGG + Intronic
1122153971 14:99739324-99739346 CTCCCTCTCCACCAGGGACATGG + Intronic
1122588377 14:102826913-102826935 CTCCATTTGCCCAAGGCACATGG - Intronic
1122935649 14:104954851-104954873 CTCCATCTGTCCCTGGGCCAGGG - Intronic
1124022808 15:25939524-25939546 CTGCATTTTCACAAGGGCCTTGG + Intergenic
1126691526 15:51292635-51292657 CTTCACTTGCACGGGGGCCAAGG + Intronic
1128866994 15:71121547-71121569 CTCCCTTTGCTCCAGCTCCATGG + Intronic
1133986928 16:10675849-10675871 CTGCTTTGGCACCAGGGGCAGGG + Intronic
1134040073 16:11061634-11061656 CTCCATTTGCTACAGGGCACAGG + Intronic
1134097532 16:11428538-11428560 CTACATTCCCACCAGCGCCATGG - Intronic
1136559127 16:31028337-31028359 CCCACTGTGCACCAGGGCCAGGG - Intergenic
1137783345 16:51116020-51116042 CTCCAGTGGCACCAGAGCAAGGG - Intergenic
1138596225 16:58030450-58030472 TTCCATTCCCACGAGGGCCATGG - Intronic
1141937259 16:87249163-87249185 CTCCATTTGCAGAAAGGGCATGG - Intronic
1142024763 16:87806539-87806561 CTCCCTTTGCAGCCGGGGCACGG + Intergenic
1143995814 17:11005651-11005673 CTACAAGTGCCCCAGGGCCATGG - Intergenic
1145322723 17:21775834-21775856 CTCAATCTGCAGCAGGGACAGGG + Intergenic
1148150458 17:45394005-45394027 CCCCATTGCCAACAGGGCCAGGG - Exonic
1151504309 17:74516531-74516553 CTCCATCTCCTCCAGGGCCATGG - Intergenic
1151716580 17:75834247-75834269 CTCCAGCAGCACCTGGGCCAAGG - Intronic
1152575658 17:81139746-81139768 CCCCATTCTCACCATGGCCAGGG - Intronic
1155838948 18:30624523-30624545 CTCCATTTCCTCCAGGATCAGGG + Intergenic
1155972005 18:32092100-32092122 CTCCATTTGCCCCGGGGCCTCGG + Exonic
1160195796 18:76754085-76754107 CTCCATAGGCACCATAGCCAAGG + Intergenic
1162041802 19:7975275-7975297 CTCCACTGGCGCCAGGGTCATGG - Intronic
1162793315 19:13074059-13074081 CTCCACTCCCCCCAGGGCCAGGG + Intronic
1163698614 19:18776167-18776189 CTGAATGTGCACCAGGGTCAGGG + Intronic
1163751417 19:19080443-19080465 CTTCATTTGGACCAGGCTCAGGG + Intronic
1165695115 19:37895023-37895045 GTCCTTATGCACCAGGGCAAGGG - Exonic
1168289219 19:55348927-55348949 CTCCCTCTCCACCAGGGCCAAGG - Intergenic
925671289 2:6312181-6312203 CTGAATTTGCACCTGGGCTAAGG + Intergenic
926195404 2:10760832-10760854 GGCCATTTGCACCAAGTCCAAGG - Intronic
932471275 2:71961048-71961070 CTCCAAGGGAACCAGGGCCAGGG - Intergenic
933981284 2:87552975-87552997 CCCCACTTCCACCATGGCCATGG - Intergenic
934481654 2:94653467-94653489 CTTCATTTTCACCAGGGGAAGGG + Intergenic
936312546 2:111397824-111397846 CCCCACTTCCACCATGGCCATGG + Intergenic
936895767 2:117425845-117425867 ATCCATTTGCATCAGGGCATTGG - Intergenic
937475175 2:122208727-122208749 CTCCATATTCCCCAGAGCCAAGG - Intergenic
938494430 2:131785882-131785904 TTCCACTTGGACCAGGGCCAGGG - Intergenic
938632671 2:133185324-133185346 CTGCTTTTGCACCAGTACCACGG + Intronic
946320822 2:218953473-218953495 CACCAGCTCCACCAGGGCCATGG - Intergenic
948351908 2:237347699-237347721 CTTCACTTGCACCCTGGCCAGGG - Intronic
948883790 2:240873157-240873179 CCCCATCTCCACCAGGCCCAGGG + Intronic
1168931391 20:1627167-1627189 CTCCATGGGAACCAGTGCCAGGG + Intergenic
1170148147 20:13199882-13199904 CACCTTTTGCACTAGTGCCAAGG + Intergenic
1170608118 20:17888965-17888987 CTCCATGACCACCAGGGCAACGG + Intergenic
1171493512 20:25538495-25538517 CACCATCTACACCAGGTCCAGGG - Intronic
1171520316 20:25770625-25770647 CTCAAGTAGCATCAGGGCCAAGG + Intronic
1171556603 20:26085868-26085890 CTCAAGTAGCATCAGGGCCAAGG - Intergenic
1172009312 20:31837197-31837219 CACCACAGGCACCAGGGCCATGG + Intergenic
1172029195 20:31969369-31969391 CTCCCCTTCCAACAGGGCCAAGG + Intronic
1172169251 20:32918925-32918947 CTCCCTCTGCACCTGGGCCAAGG - Intronic
1173345033 20:42191490-42191512 CTCCATTTGGTCCATGCCCACGG - Intronic
1175928260 20:62481228-62481250 CTCCATTCGCCCGAAGGCCAAGG + Intergenic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1176613507 21:9008495-9008517 TTCCACTTGGTCCAGGGCCAGGG + Intergenic
1176654451 21:9576912-9576934 CTCAAGTAGCATCAGGGCCAAGG + Intergenic
1176711686 21:10155388-10155410 TTCCACTTGGACCAGGGCCAGGG - Intergenic
1178486612 21:33023434-33023456 TCCGATTGGCACCAGGGCCAAGG + Intergenic
1180024043 21:45148449-45148471 CTGCCTTAGCACCAGGGCCTGGG + Intronic
1180498622 22:15911952-15911974 TTCCGCTTGGACCAGGGCCAGGG - Intergenic
1180859762 22:19071070-19071092 TTCCACCTCCACCAGGGCCATGG + Intronic
1182285019 22:29241192-29241214 CTCCAGAGGAACCAGGGCCAGGG - Intronic
1183363133 22:37393333-37393355 CTCCACTCGCACCTGGGCCTGGG + Intronic
949393314 3:3587369-3587391 CTCCATTTGCAGAAGGGGAATGG - Intergenic
949513945 3:4790256-4790278 AGCCATTTGTCCCAGGGCCATGG - Intronic
950262982 3:11555332-11555354 CTCCCGCTCCACCAGGGCCAGGG - Exonic
950428439 3:12937300-12937322 CTCAAGATGCACCAGGGCCAGGG - Intronic
952875469 3:37941096-37941118 CTGCAGTGACACCAGGGCCAGGG + Intronic
953311436 3:41883942-41883964 CTCCATTTACAGACGGGCCAAGG - Exonic
954345314 3:49992283-49992305 CTTTATTTGCACCAGGGCTAAGG + Intronic
954661460 3:52229045-52229067 CCCCATTTTCACCCGGGCCGCGG + Exonic
954745814 3:52787032-52787054 CTCCATGAGCATCAGGGGCATGG + Exonic
957070761 3:75566177-75566199 CACCATGAGGACCAGGGCCATGG - Intergenic
959024440 3:101224207-101224229 CTCCATTTTCACCATTGCAATGG - Exonic
959363568 3:105427133-105427155 CTCCATTTTCACCCTGGGCATGG - Intronic
959859005 3:111195477-111195499 CTTCATTTGCACCAGAGAAAGGG + Intronic
961058406 3:123808200-123808222 GTCCATTCTCACCAGGGGCAGGG + Intronic
961796259 3:129411200-129411222 CTCCATCTCCTCCAGGGTCATGG + Exonic
968948154 4:3676333-3676355 CTTTCTTTACACCAGGGCCAGGG + Intergenic
968977400 4:3829143-3829165 CTGCATTTGAACCAGGTCCAGGG + Intergenic
969099331 4:4757082-4757104 CTCCATGTGCACCACAGCCCTGG - Intergenic
969258649 4:6020317-6020339 CTCCAACTGCCCCAGGTCCACGG - Intergenic
978462836 4:108976594-108976616 CTCCATTTTCAGCAGGGCTGAGG + Intronic
978515908 4:109568345-109568367 CTGCAGTTGAACCAGAGCCATGG + Intronic
984719220 4:182954561-182954583 CTCAGTTTTCACCAGGGTCAGGG - Intergenic
985285759 4:188335204-188335226 CTCTATTTTCACCAGGGCTGGGG - Intergenic
985756945 5:1724957-1724979 CCCCATTTGCACCACAGCCGAGG + Intergenic
989069401 5:37494911-37494933 CTGGATTTGCCCCAAGGCCATGG - Intronic
990426170 5:55691433-55691455 TTCCATTTTCCCCAGGGCCTAGG - Intronic
992641842 5:78774465-78774487 CTCCCATGGCACCAGGGCAAAGG + Intergenic
993030879 5:82704389-82704411 CTCCATCTCTACCAGGGCCCAGG + Intergenic
998887127 5:146706269-146706291 CACCAGCTCCACCAGGGCCATGG - Intronic
1000415518 5:160980196-160980218 CTACATTCCCACCAGTGCCATGG + Intergenic
1003684849 6:8292289-8292311 CTCCATGTGGACCCTGGCCATGG - Intergenic
1003960945 6:11208635-11208657 CTCCATCAGCACAGGGGCCATGG - Intronic
1005637817 6:27768049-27768071 CTCTAACTGCCCCAGGGCCATGG - Intergenic
1007328197 6:41080028-41080050 CTCCATTCACACCAGTGCCCTGG + Intronic
1013512608 6:110858502-110858524 CTCCAATTTCATCAAGGCCATGG + Intronic
1018317317 6:162569638-162569660 CACCAGCTCCACCAGGGCCATGG + Intronic
1019449590 7:1090444-1090466 CCCCACTCGCAGCAGGGCCAGGG + Intronic
1019826041 7:3285170-3285192 CTCCATTTGCCCCACTGACAGGG + Intergenic
1021706839 7:23376117-23376139 CTCCACTTGCAAAAGGGCAAAGG + Intronic
1022470390 7:30678504-30678526 TTCCAGATGCAGCAGGGCCAAGG - Intronic
1023412650 7:39903046-39903068 CTCCATGGGAACCAGTGCCAGGG + Intergenic
1026373707 7:69728210-69728232 CTCCATGTGCCCCAGGGAGAGGG - Intronic
1029693565 7:102198595-102198617 CTCCTTTTGCAGCAGAGCCACGG + Intronic
1031618832 7:123911716-123911738 CTCCATCTACACCAGTCCCAGGG + Intergenic
1034235029 7:149560009-149560031 CTCCCCTTCCACCAAGGCCACGG + Intergenic
1036295918 8:7537091-7537113 CCCCATTTGCCCCAAAGCCAGGG - Intergenic
1036326648 8:7783928-7783950 CCCCATTTGCCCCAAAGCCAGGG + Intergenic
1038797540 8:30723122-30723144 CTCCCTTTGCCCCAGGGCCTGGG - Intronic
1039131989 8:34275593-34275615 CTCCTTGGGAACCAGGGCCAGGG + Intergenic
1041715142 8:60925455-60925477 CTCCACTTCCACCAGTGCCTGGG + Intergenic
1041941244 8:63390472-63390494 CTCCATTGTCATCAGTGCCAAGG + Intergenic
1044925825 8:97208075-97208097 CTCCATTTCCAGTGGGGCCAAGG - Intergenic
1045496873 8:102716635-102716657 AGCCACTGGCACCAGGGCCAGGG - Intergenic
1046542488 8:115604303-115604325 CTACAATTACATCAGGGCCATGG + Exonic
1046733940 8:117755737-117755759 CTTCATTTGTACCTGGGCCATGG + Intergenic
1046993638 8:120489788-120489810 CGCCATTTGCACCACAGCTAAGG + Intronic
1047672984 8:127169356-127169378 ATCCATTGGAACCAGTGCCAGGG - Intergenic
1047907423 8:129487269-129487291 CTCCATTTACACCAGGGATGAGG + Intergenic
1049566251 8:143340611-143340633 CACCCTTTGCCCCAGGGCAATGG + Intronic
1049603323 8:143518088-143518110 CTCCTGCAGCACCAGGGCCATGG - Intronic
1049686172 8:143940154-143940176 CCCCACTGGCCCCAGGGCCAGGG - Intronic
1051000868 9:12280286-12280308 CTCCTTTTGCACAAGGGTAATGG - Intergenic
1053648677 9:40141079-40141101 TTCCACTTGGACCAGGGCCAGGG - Intergenic
1053676179 9:40430636-40430658 CTTCATTTTCACCAGGGGAAGGG - Intergenic
1053757069 9:41322763-41322785 TTCCACTTGGACCAGGGCCAGGG + Intergenic
1053925952 9:43056748-43056770 CTTCATTTTCACCAGGGTAAGGG - Intergenic
1054287542 9:63194257-63194279 CTTCATTTTCACCAGGGGAAGGG + Intergenic
1054289247 9:63266160-63266182 CTTCATTTTCACCAGGGGAAGGG - Intergenic
1054329659 9:63739020-63739042 TTCCACTTGGACCAGGGCCAGGG - Intergenic
1054387280 9:64570707-64570729 CTTCATTTTCACCAGGGGAAGGG - Intergenic
1054508443 9:65945658-65945680 CTTCATTTTCACCAGGGGAAGGG + Intergenic
1054535906 9:66235091-66235113 TTCCATTTGGACCAGGGCCAGGG + Intergenic
1054956555 9:70917476-70917498 CACCACCAGCACCAGGGCCAAGG + Intronic
1061551433 9:131337027-131337049 CTCCATGGCCACCTGGGCCAGGG - Intergenic
1062279731 9:135746632-135746654 GTCCAGCTGCACCAGGTCCACGG + Intronic
1202796441 9_KI270719v1_random:124377-124399 TTCCACTTGGACCAGGGCCAGGG - Intergenic
1203632171 Un_KI270750v1:80370-80392 CTCAAGTAGCATCAGGGCCAAGG + Intergenic
1187104776 X:16230184-16230206 GTCCATCTGCACCAGGTCAATGG + Intergenic
1189407131 X:40735392-40735414 CTCCAGCTGCACTGGGGCCATGG + Exonic
1189588514 X:42487421-42487443 CTCCCTTTGCCTCAGGTCCAAGG + Intergenic
1189893719 X:45632355-45632377 CACCAGCTTCACCAGGGCCATGG - Intergenic
1190053740 X:47170307-47170329 CTCCATTCCCACCCTGGCCAGGG - Intronic
1190594813 X:52042004-52042026 CTCCCATTCCACCAGGGCCTGGG - Intergenic
1190614011 X:52212069-52212091 CTCCCATTCCACCAGGGCCTGGG + Intergenic
1196437603 X:115688991-115689013 CTGCATTCACACCTGGGCCATGG + Intergenic
1198113293 X:133521793-133521815 ACACATTTGCACAAGGGCCATGG - Intergenic
1199982196 X:152927365-152927387 CTCCACTTCCACCCTGGCCAGGG - Intronic
1200683019 Y:6235400-6235422 CCCCACTTGGACTAGGGCCAGGG - Intergenic
1200691953 Y:6314763-6314785 CTCCACTTGGACCAGGGCCAGGG + Intergenic
1200832483 Y:7700481-7700503 CCCCAGTTGGACCAGGGACAGGG + Intergenic
1201020159 Y:9647887-9647909 CCCCACTTGGACCAGGACCAGGG + Intergenic
1201043319 Y:9859960-9859982 CTCCACTTGGACCAGGGCCAGGG - Intergenic
1201885819 Y:18880462-18880484 CTCCCCCTGCTCCAGGGCCACGG + Intergenic