ID: 1083643190

View in Genome Browser
Species Human (GRCh38)
Location 11:64156692-64156714
Sequence CTGGAGAGAAGGGGCTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 311}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083643190_1083643195 -10 Left 1083643190 11:64156692-64156714 CCCACAAAGCCCCTTCTCTCCAG 0: 1
1: 0
2: 4
3: 39
4: 311
Right 1083643195 11:64156705-64156727 TTCTCTCCAGCAAAGCCCACAGG 0: 1
1: 0
2: 0
3: 16
4: 255
1083643190_1083643200 21 Left 1083643190 11:64156692-64156714 CCCACAAAGCCCCTTCTCTCCAG 0: 1
1: 0
2: 4
3: 39
4: 311
Right 1083643200 11:64156736-64156758 ACTTCCCAGAGACAGCATGCTGG 0: 1
1: 0
2: 3
3: 33
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083643190 Original CRISPR CTGGAGAGAAGGGGCTTTGT GGG (reversed) Intronic
900751576 1:4401204-4401226 AAGGAGAGGAGGGGCTGTGTTGG - Intergenic
901108784 1:6778842-6778864 TTGGAGAGATTGGGCTTTGCTGG - Intergenic
901206824 1:7502267-7502289 ATGCAGAGAAGCGGCTTTGGAGG + Intronic
902643488 1:17781625-17781647 CTGGAAATAAGGATCTTTGTAGG - Intronic
902799123 1:18818516-18818538 CTGCAGAGAGGTGGCTTTGGGGG - Intergenic
902891593 1:19448210-19448232 CTGGAGAGAAGCGGGTATTTGGG - Intronic
903500294 1:23796783-23796805 CTGCAGAGAAGGGAGTGTGTTGG + Intronic
904642755 1:31942788-31942810 CTTGAGAGCAGGAGCTATGTGGG + Intronic
905901362 1:41583872-41583894 CTGGAGAGAAGGGGCTGCTTGGG + Exonic
906069880 1:43008631-43008653 CAGGAGAGACGGGGCTAGGTGGG - Intergenic
906546236 1:46621188-46621210 CAGCAGAGAAGGGGCTAGGTTGG - Intergenic
907485391 1:54774514-54774536 ATTGAGAGATGGGGCTTTGGGGG - Intergenic
909409176 1:75329190-75329212 CTGGATAGCTGAGGCTTTGTTGG + Intronic
912548276 1:110466632-110466654 ATGGAGTGAACGTGCTTTGTAGG + Intergenic
912799197 1:112710754-112710776 CAGGAGAGAAAGGGCTTGATGGG + Exonic
915634538 1:157177023-157177045 CTGGAGAGAAGAGGCTCAGCAGG + Intergenic
916305395 1:163324622-163324644 CTGGAGAGTAGGGGATCTGAAGG + Intronic
918103946 1:181400526-181400548 CAGGAGACAAGAGGCTTGGTAGG - Intergenic
920037115 1:203073439-203073461 CTAGAGAGGAGGGTTTTTGTGGG + Intronic
920052670 1:203173114-203173136 CAGGAGAGAAGGGGATTTCCTGG - Intronic
920376603 1:205512132-205512154 CTGGAGCTGAGGGGCTTGGTGGG + Intronic
922160283 1:223074619-223074641 CAGAGGAAAAGGGGCTTTGTGGG + Intergenic
922182084 1:223243339-223243361 TTGGAGAGATGGGGCTTCCTGGG + Intronic
922226913 1:223653392-223653414 CTGAAGAGAAAGGGCTTTCTTGG + Intronic
923581007 1:235212747-235212769 CTTTAGAGAAAGGGCATTGTGGG + Intronic
924898928 1:248373598-248373620 GTGGAGGGAAGGGGTTTTTTAGG + Intergenic
1063075918 10:2716394-2716416 CTGCAGAGACTGGGCTGTGTAGG + Intergenic
1063952739 10:11239417-11239439 TTGGAGAGAATGGCCTTTCTCGG - Intronic
1064566630 10:16646471-16646493 CTGGAGAGAAGGGACTTGATCGG - Intronic
1065136231 10:22673110-22673132 ATGGGGATCAGGGGCTTTGTAGG - Intronic
1066350317 10:34631214-34631236 CAGGAGAGGAGGGGCTGAGTGGG - Intronic
1066441381 10:35442468-35442490 CTGGATAGGAGGTACTTTGTTGG + Intronic
1067841083 10:49679884-49679906 CTGGAGAGGTGGCGCTTCGTGGG - Intronic
1068646912 10:59478423-59478445 TTGCAGAGAAGAGGCTTTGTTGG - Intergenic
1069255181 10:66323691-66323713 CTTGAGAGTAGGGGCTTTGCTGG - Intronic
1069750005 10:70739078-70739100 CAGGAGAGAAGGGCCCCTGTGGG + Intronic
1069876543 10:71566651-71566673 ATGTAGAGAATGGGCTTTGAGGG + Intronic
1071369418 10:84935910-84935932 CTTGAGAGAAGGGTATTAGTGGG + Intergenic
1071478188 10:86042485-86042507 GGGGAGAGCAGGGGCTCTGTGGG + Intronic
1072443571 10:95478700-95478722 TGAGAGAGAAGGGGCTCTGTGGG - Intronic
1073026268 10:100489298-100489320 CTGGAGACAGGGGGCTGTGAGGG + Exonic
1073080156 10:100854526-100854548 CTGGAAAGATGGGGCTCTGGAGG - Intergenic
1073542586 10:104325596-104325618 AAAGAGAGAAGAGGCTTTGTTGG + Intronic
1075683453 10:124348372-124348394 CTGGAGGGCAGGGGCCTTGTTGG - Intergenic
1076832985 10:133006258-133006280 CTGGAGACACAGGGTTTTGTGGG + Intergenic
1077392404 11:2306246-2306268 CAGGCAGGAAGGGGCTTTGTGGG - Intronic
1077466602 11:2736485-2736507 CTGGAGAGAAGGTGCACTTTGGG + Intronic
1078919462 11:15815821-15815843 CTGGAGAAAAGGTTCTTTATAGG + Intergenic
1080789975 11:35513920-35513942 CTGGAGGGAAGGTGCCTTTTTGG - Intronic
1081582110 11:44359583-44359605 CTGCTGAGAAGGCACTTTGTCGG + Intergenic
1083399600 11:62414647-62414669 CAGAAGAGCAGGGGCTTTGCAGG + Intronic
1083423952 11:62573460-62573482 TTGAAGAGGAGGGTCTTTGTAGG - Exonic
1083472697 11:62894802-62894824 TTGGAGAGAAGGGGATGGGTTGG + Intergenic
1083590641 11:63891923-63891945 TTGGAGAGAAGGGCATTTCTAGG - Intronic
1083643190 11:64156692-64156714 CTGGAGAGAAGGGGCTTTGTGGG - Intronic
1084430557 11:69108412-69108434 TTGGAAAGAAGGGTCTTTGCAGG + Intergenic
1084669790 11:70598250-70598272 CTGGAGAGAAGGGTATTGGAAGG + Intronic
1085071638 11:73551965-73551987 CTGGAGAGAAAGGAATATGTGGG + Intronic
1087002586 11:93435661-93435683 CTGGAAAGAAAGAGCTGTGTAGG - Intronic
1088596749 11:111446814-111446836 CAGAAGAGAAGTGGCTTTGTGGG + Intronic
1089080771 11:115774518-115774540 CTGGAGAGGAGGGGGCTTGGAGG - Intergenic
1089096435 11:115923536-115923558 AAGGAGGGAATGGGCTTTGTGGG + Intergenic
1089541679 11:119193115-119193137 TTGGAGAGAAGGGGCTTGGAGGG + Intronic
1089614729 11:119688783-119688805 CTGGAGAGTCTGGGCTCTGTAGG + Intronic
1089695626 11:120214638-120214660 CTGGAGAGAGGGGGCTGGATAGG - Intronic
1089853106 11:121517212-121517234 GTGGAGAGAAGCGGCTTAATGGG - Intronic
1090276553 11:125424121-125424143 GGGGACAGAAGGGGGTTTGTGGG + Intronic
1091601817 12:1922445-1922467 CTGGAGAGAACAGGCTGTATGGG + Intergenic
1094213653 12:27918755-27918777 CTGGTGAGAGGGGGCTTGCTTGG + Intergenic
1095900303 12:47320974-47320996 TTGTAGAGATGGGGTTTTGTTGG + Intergenic
1096455061 12:51778044-51778066 ATGGAGAGAAAGGGATTAGTTGG + Intronic
1098990545 12:77060766-77060788 CTGGAAAGAAGGAGAGTTGTTGG - Intronic
1099172506 12:79381491-79381513 CAGGAGAGCAGGGGGTTTGAAGG + Intronic
1101429777 12:104617218-104617240 CTGGAGTGAAGGGGATTTGTGGG + Intronic
1101598417 12:106188252-106188274 CGGGAGAGAATGAGCTCTGTGGG - Intergenic
1102698025 12:114815292-114815314 CTGCTGAGAAGGGACTTTGAGGG - Intergenic
1103013674 12:117477440-117477462 CAGGAGGGAAGGGACCTTGTTGG - Intronic
1103342995 12:120230947-120230969 CCAGAGAGCAGGGGCCTTGTCGG + Intronic
1103968782 12:124656388-124656410 GTGGGGAGTAGGGGATTTGTGGG + Intergenic
1104666734 12:130652967-130652989 CTGTTGGGAAGGGGCCTTGTGGG - Intronic
1110553470 13:76832183-76832205 TTGGAGAGGAGAGGCTCTGTTGG - Intergenic
1110764002 13:79262189-79262211 CATGAGAGCAGGGACTTTGTTGG - Intergenic
1110810346 13:79805818-79805840 CTGGATAGAATAGGCTTTGGGGG + Intergenic
1113506503 13:110820764-110820786 CTGGACAGCAAGGGCTTCGTGGG + Intergenic
1113597175 13:111541486-111541508 CTGACCAGAAGGGGCTTTGATGG - Intergenic
1114613177 14:24055175-24055197 CTGGAGGGAAGGGGCTAAGAAGG + Intronic
1118395658 14:65334352-65334374 CTGGAGAGAAGGGGTATTTTAGG - Intergenic
1119549059 14:75494850-75494872 CTGCAGAGAAGGGGTGGTGTTGG + Intergenic
1121291921 14:92782953-92782975 CTGGAGAGAAAGGCCTTATTTGG + Intergenic
1121457556 14:94048231-94048253 CTGGAGAGAGATGGCTCTGTGGG - Exonic
1122699050 14:103574789-103574811 CTGGAGAGGTGGGGTCTTGTGGG + Intronic
1122793941 14:104196441-104196463 CTGGGGAGAAGGTGCTTTGGAGG + Intergenic
1123011211 14:105350463-105350485 CTGGAGAGGTGGGGCTCTGAGGG - Intronic
1123451036 15:20358754-20358776 CTGCAGATGAGGGGCTTTGTAGG + Intergenic
1125611842 15:40976641-40976663 CAGGAGAGCAGAGGCCTTGTGGG + Intergenic
1127482862 15:59393150-59393172 AGTGAGAGAAGGGGCATTGTAGG + Intronic
1127838132 15:62807043-62807065 GTGGAGAGAAGAGGGTGTGTTGG + Intronic
1129169257 15:73797847-73797869 CTGGAGAGGATGGGCTTTCCTGG + Intergenic
1129407521 15:75329025-75329047 CTGGAGAGAAGGTGCCTACTGGG - Intergenic
1129430971 15:75501796-75501818 CTGGAGAGAAAGAGATTTCTGGG + Intronic
1129831635 15:78674763-78674785 TTGGGGAAAAGGGTCTTTGTAGG + Intronic
1132121302 15:99178372-99178394 CTAGAGGGAAGGGGGTTTGACGG + Intronic
1132515046 16:362336-362358 CTGGAGGGAAGAGGCGTTCTTGG - Intergenic
1132954715 16:2585529-2585551 CAGGAGAGCAGGTGCTTCGTTGG + Intronic
1134142817 16:11736555-11736577 CTGGAGATAAGTGGCTTTTGTGG - Intronic
1134875259 16:17692424-17692446 CTGCATAGAAGGGGCTATGGCGG - Intergenic
1137358001 16:47785170-47785192 CTGGAGAGAAGGGACCCTGTTGG - Intergenic
1138179392 16:54931663-54931685 CTGGCGGGAAGGGGTTCTGTGGG + Intronic
1138565704 16:57831316-57831338 TTGGAGAGAAGGCGCTGGGTGGG - Intronic
1138827979 16:60343818-60343840 CTGGAGAGATGGGTCTTTCAGGG + Intergenic
1139848990 16:69939542-69939564 TTGGAGAGATGGGGCTGTGATGG + Intronic
1140662399 16:77199932-77199954 CTGGAGAAAAGAGGCTGTGGGGG - Exonic
1141554662 16:84829119-84829141 GAGGAGAGAAGGTGCCTTGTGGG + Intronic
1141858334 16:86700313-86700335 CTGGTGAGAAGGGGGCTGGTTGG + Intergenic
1142383690 16:89748768-89748790 CTGGAAAGAAGGGGCTGTATTGG + Intronic
1143598942 17:7931650-7931672 TTGGAGAGGAGGGGCTGGGTTGG + Intronic
1143931929 17:10438170-10438192 CTAAAGAGAAAGGCCTTTGTTGG + Intergenic
1143977043 17:10837679-10837701 CTGGGAAGAAGGGAATTTGTGGG - Intronic
1144471439 17:15545582-15545604 CTGGTGGGAAGGGGTTTTTTAGG + Intronic
1144520598 17:15950123-15950145 CTTGAGAGAAGGAGCTTATTTGG + Intronic
1144632114 17:16879395-16879417 CTGGAGAAATGGAGCTTTGCTGG - Intergenic
1144925035 17:18799124-18799146 CTGGTGGGAAGGGGTTTTTTAGG - Intronic
1145975053 17:28979035-28979057 CTGGACAGGAGTGGCTTTGGGGG + Intronic
1147313224 17:39606958-39606980 CAGGAGAGAACGGGCTTTCAGGG - Intronic
1147387172 17:40089501-40089523 CTGGAGAGAAGGGGCAGAGCTGG + Intronic
1147436232 17:40417861-40417883 CTGTGGAGAAGCGGCTTGGTCGG - Exonic
1148695416 17:49555575-49555597 CAGGAAAGGAGGGGCTTTCTTGG + Intergenic
1148835009 17:50461368-50461390 CTGGTGAGGAGGGGCTTGCTTGG + Exonic
1149027827 17:52050563-52050585 CTGGGAAGAAGAGGCCTTGTAGG - Intronic
1150124172 17:62626139-62626161 GTGGAGTGCAGGGGCTTTGTTGG + Intergenic
1150443749 17:65212487-65212509 CTGGGGAGAGAGGGCTGTGTGGG + Intronic
1151213862 17:72564191-72564213 CAGGAGAGACGGGGCTTTCCAGG - Intergenic
1151986464 17:77547137-77547159 CTGGAGGGAAGGGGCTCTCCGGG + Intergenic
1152021623 17:77782750-77782772 CTGGAGAGAAGGGACCTCGGAGG + Intergenic
1152033355 17:77857143-77857165 TTGCAGAGAAGGGGCTTTTGAGG + Intergenic
1152177436 17:78797251-78797273 CTGGAGAGCAGAGGCTATTTGGG - Exonic
1152337409 17:79706591-79706613 CTGCAGATGAGGGGCTTTGTAGG - Intergenic
1152355106 17:79803099-79803121 CTGGGGAGAAGGGGCTCAGACGG + Intergenic
1152389053 17:79992106-79992128 CTGCAGAGAGGCGTCTTTGTAGG - Intronic
1152514734 17:80816687-80816709 CTGGAGTGAGGGGGCTTGGGAGG + Intronic
1153914528 18:9733896-9733918 CTGGGGAGGGGGGGCTTGGTTGG + Intronic
1155684715 18:28534539-28534561 CTGAAGAGAAGTGGCCTTGGTGG + Intergenic
1156948704 18:42867189-42867211 CTGGTGACAACAGGCTTTGTGGG + Intronic
1157188779 18:45562793-45562815 CTGGGGGGAAGGGGCTGGGTGGG + Intronic
1157259765 18:46167824-46167846 GTGGAGAGAAGTGACTTTGTGGG - Intergenic
1157599082 18:48882471-48882493 AGGGAGAGAATGGGCTTTGGAGG + Intergenic
1157605219 18:48922187-48922209 CTGCAGAGAAGAGGCTTTGTTGG - Intronic
1158540145 18:58346137-58346159 CTGGAGACCAGGGGCTTGGGAGG + Intronic
1160018612 18:75163576-75163598 CGGAAGAGAATGGGCTTTGAAGG + Intergenic
1160148611 18:76383587-76383609 CTGGCGAGAAGGTGCCTGGTGGG - Intronic
1160665609 19:326646-326668 GTGGAGAGAAGGGGTTGTATAGG - Intronic
1161311948 19:3599829-3599851 CTGGTGAGTAGGGGCTCTGCGGG - Exonic
1161455968 19:4369849-4369871 TTGGAGAGAAGGGGCCTTACAGG - Intronic
1161743839 19:6042708-6042730 CTGGAGAGATGGGGCAATGGGGG + Intronic
1162050324 19:8028841-8028863 CTGCGGAGGAGGGGCTTGGTTGG - Intronic
1163171535 19:15534902-15534924 CTGGAGTGAAGGTGATATGTTGG + Intronic
1164441324 19:28282639-28282661 CTGGGGAGAAGGGGGTGGGTCGG - Intergenic
1166205696 19:41267332-41267354 CTGGGGAAAAGAGGCTTTGTGGG + Intronic
1166855594 19:45781399-45781421 CTTGCAAGAAGGGGTTTTGTGGG + Intronic
1167157913 19:47750502-47750524 TTGGAGAGGAGGGGCTGAGTGGG + Intronic
1167765852 19:51481749-51481771 CTGGAGAGAGGGGGCATCCTGGG + Intronic
925215825 2:2095211-2095233 CTGGGGAAAAGGGGCTTTCTGGG + Intronic
925865693 2:8224133-8224155 CTGCAGAGCTGGGGCTTTGATGG - Intergenic
926292493 2:11541898-11541920 CTGAAAAGAAGGGGCTTTCCAGG - Intronic
926696500 2:15772835-15772857 CAAGAGAGAAAGGGCTTTTTGGG - Intergenic
928371588 2:30743927-30743949 CAGGAGAGAAGGGGCTTTAGGGG - Intronic
930179557 2:48339294-48339316 GTGTTGAGAAGGGGCCTTGTGGG + Intronic
931617486 2:64174738-64174760 AAGGAGAGAAGGGGCATTTTGGG + Intergenic
932441221 2:71736834-71736856 CTGAACAGAGGGGGCTTTGATGG + Intergenic
932802382 2:74752360-74752382 ATGGAGAGAAAAAGCTTTGTTGG + Intergenic
933504935 2:83164740-83164762 AAGGAGAGAAGGGGCCTAGTTGG + Intergenic
933897115 2:86821783-86821805 TTGGAGAGGACGGGGTTTGTGGG - Intronic
936532446 2:113285855-113285877 CTGGGGAGAAGGGGCAATGAGGG + Intergenic
937044617 2:118844616-118844638 CTGGAAAGAAGGATCTTTGCCGG + Intronic
937431550 2:121842992-121843014 CAGGAGAGAAAGGGAATTGTTGG - Intergenic
939580473 2:143940491-143940513 CTGAAAATAAGGGGCTTTTTTGG - Exonic
939627773 2:144499194-144499216 CTGGAGTTAAGAGACTTTGTGGG - Intronic
939796378 2:146649868-146649890 CTGGAAAGAAGGGATTTTTTAGG + Intergenic
940141002 2:150490420-150490442 CTGGAGGGAAAGGGCTTGGTAGG + Intronic
940787374 2:157996206-157996228 CTGGAGAGAAGAGCTTTTCTTGG + Intronic
946235182 2:218320083-218320105 CTATTGAGCAGGGGCTTTGTGGG + Intronic
947808567 2:232985049-232985071 CTGAAGGGGAGGGGCTTTCTGGG + Intronic
948179314 2:235967089-235967111 CTGGAGAGGAGGGGGCTTGCGGG - Intronic
948605558 2:239132412-239132434 CAGGAGAGAAGGGGCTTGCAGGG + Intronic
1169269475 20:4188033-4188055 CTGGAGTGAAGGAGTTCTGTGGG + Intergenic
1169456265 20:5755087-5755109 CTTGAGTTAAGGGGGTTTGTGGG + Intronic
1169699167 20:8427440-8427462 ATGGAGGGTAGGGGCTTTGCTGG + Intronic
1172384675 20:34525547-34525569 CAGCAGAGAAGAGGCCTTGTGGG + Intronic
1174735195 20:52959601-52959623 CTGGAGAAGAGGGGCTTGGACGG - Intergenic
1175026490 20:55907910-55907932 CTGGAGAGAAGGCATTTTTTGGG - Intergenic
1175164457 20:57033411-57033433 CTGGAGAGAAGGGGGTGGATTGG + Intergenic
1177709059 21:24747154-24747176 CTGGAAAGAAAGGGCTTTCTAGG + Intergenic
1178074000 21:28998950-28998972 GTGGGAAGAAAGGGCTTTGTAGG - Intergenic
1178271983 21:31199327-31199349 CCAGAGAGAAAGGGCATTGTCGG - Intronic
1179032498 21:37732720-37732742 CTTAAGAGAAGCGGGTTTGTGGG - Intronic
1179255289 21:39710714-39710736 CTGGAGACATGGGGCTATGAAGG - Intergenic
1180576738 22:16782955-16782977 TTTGAGAGAAGGTGCATTGTTGG - Intergenic
1181029152 22:20141623-20141645 CTGGAGAGATGGGGCTCTGGAGG - Intronic
1181061421 22:20283818-20283840 CTGGAGGCAAGGGGCTTGGCAGG + Intergenic
1181895153 22:26100672-26100694 ATGGCAAGAAGGGGATTTGTAGG - Intergenic
1182306044 22:29369215-29369237 CTGGAGAGGAGGTGCTGTGTTGG - Intronic
1182433256 22:30313266-30313288 CTGGAGGGCAGGGGCTCTCTTGG + Intronic
1182739739 22:32558888-32558910 CTGGAGAGAAGAGGCTGGGGAGG + Intronic
1183362435 22:37389690-37389712 CAGGAGAGAAGCTGCTTGGTGGG - Intronic
1184471651 22:44699357-44699379 CAGGAGAGGACTGGCTTTGTGGG - Intronic
1184528822 22:45041544-45041566 CTGGAGGGAAGGGGCTATTCTGG - Intergenic
1184554636 22:45226498-45226520 CAGGAGGTAGGGGGCTTTGTGGG - Intronic
1184772257 22:46604532-46604554 CTGGAGAGTCAGTGCTTTGTGGG - Intronic
1184846763 22:47092477-47092499 CTGGAGTGGAGGGGCTTGGTGGG + Intronic
949099369 3:125628-125650 CTGGACACACAGGGCTTTGTAGG + Intergenic
949419722 3:3853109-3853131 CTGGAGAGCAGGGGCAGGGTAGG - Intronic
949509064 3:4752882-4752904 CTGGAGGGCAGGGGCTATGTTGG - Intronic
951390647 3:22099516-22099538 CCAGAGAGAATGGGATTTGTAGG + Intronic
952327405 3:32333926-32333948 GAGGAGAGAAGGGGATATGTGGG + Intronic
952849680 3:37717573-37717595 CAGGAGAGAAGGGGGCTGGTGGG + Intronic
952976982 3:38704920-38704942 CTGGGAAGAAGGGTCTTAGTTGG + Intronic
954411447 3:50372958-50372980 CTGGAGAGCAGGGGTTTGGCTGG + Intronic
954655633 3:52192510-52192532 CTGGAGTGGGGGGGCTTTGCAGG - Intergenic
954743246 3:52771225-52771247 CAGGAGGGCAGGGACTTTGTTGG - Intergenic
954789451 3:53120659-53120681 CTTGTGAAAAGGGGCTTTTTTGG - Intronic
955333952 3:58069756-58069778 CAGGAGAGCAGGGGCCTTGGAGG + Intronic
956332856 3:68130616-68130638 CCAGACAGAAAGGGCTTTGTAGG - Intronic
956777523 3:72577810-72577832 CTGGAGAGCTGGGGCCTTGGTGG - Intergenic
957312729 3:78541366-78541388 CTGGAGGGAAGGGGCACTGTTGG - Intergenic
957804333 3:85127508-85127530 CTGGAGAGAAGGGGGCTTCTGGG + Intronic
959591419 3:108086047-108086069 TGGGAAAGAAGGGGCTTTCTAGG + Intronic
960869014 3:122230687-122230709 CTGCATAGAAGGGGCTTCCTGGG + Intronic
960910869 3:122648181-122648203 CAGGAAAGTGGGGGCTTTGTTGG + Intergenic
961027116 3:123568160-123568182 GGGGTGAGAAGGGCCTTTGTTGG + Intronic
962195788 3:133362363-133362385 CTGGAAAGAAGGGGCTCCATGGG - Intronic
963015723 3:140822043-140822065 CAGGTGGGAAGGGGCTTTGAAGG + Intergenic
963265852 3:143239256-143239278 CTGGAATGAAGGGAATTTGTTGG + Intergenic
964344779 3:155744789-155744811 CAGGAGAGAAGGGGGTGTGCAGG - Intronic
965590277 3:170356408-170356430 GTGGAGAAAAGGGGATTTCTTGG + Intergenic
968887252 4:3341418-3341440 GTGGAGAGATGGGGGTATGTGGG + Intronic
968959638 4:3736647-3736669 CTGGGGAGAAGATGCTTTCTCGG - Intergenic
968979079 4:3837045-3837067 CTGGGGAGATGGAGCTTGGTAGG - Intergenic
969410366 4:7024263-7024285 CTGCAGTTCAGGGGCTTTGTGGG + Intronic
969459136 4:7318680-7318702 CTGTGGATAAGGGGCTGTGTGGG - Intronic
969725574 4:8916233-8916255 CTGGAGAGCTGTGGCTGTGTGGG + Intergenic
970687019 4:18580228-18580250 CTGGAGAGAAAGTGTTTTGGGGG + Intergenic
970757895 4:19449204-19449226 TTGGAGAAAAGGGGATTTTTAGG - Intergenic
971478877 4:27096817-27096839 CTGGACAGAAGTGGCATTCTTGG + Intergenic
973108504 4:46370940-46370962 TTAGATAGAAGGGGCATTGTAGG + Intronic
973235515 4:47898990-47899012 GTGGACAGAAGTTGCTTTGTGGG - Exonic
973733378 4:53845232-53845254 TTGGAGAAAAGGGGCTTATTGGG - Intronic
980724749 4:136743517-136743539 CTGCTGAGGAGGGGCATTGTCGG + Intergenic
980813180 4:137910276-137910298 GTGGAGAAAAGTGGCTTAGTTGG - Intergenic
980854999 4:138429144-138429166 CTGGAGACAAGGAACTTCGTTGG - Intergenic
982858884 4:160422501-160422523 CTGGTGTGAAGGTGCTGTGTGGG + Intergenic
983498568 4:168473445-168473467 CTGGAGAGATGTGGATTTATTGG + Intronic
984842809 4:184083516-184083538 CTGGGGAGAAGGGGCTTGTGGGG + Intergenic
984849731 4:184143401-184143423 CTGCAGAGAAGAGGCTTTGCAGG - Intronic
985946650 5:3190272-3190294 CTGGAGAGAAGGGCACTGGTAGG + Intergenic
987049358 5:14136477-14136499 CTGGAGAGGAGGTGCTTTCTAGG + Intergenic
988035049 5:25817129-25817151 CTGGACAAAAAGGGCTTTCTGGG + Intergenic
988660316 5:33259400-33259422 CACGAGAGAAAGGCCTTTGTTGG - Intergenic
988878329 5:35472935-35472957 CTGGAGTGAAGGGTATCTGTGGG - Intergenic
988927083 5:36000575-36000597 CTGGAGGTAAAGGTCTTTGTTGG - Intergenic
989403852 5:41038791-41038813 CTGGAGAGAAGTTGCTTCTTGGG + Exonic
990442786 5:55863295-55863317 CTGGAGAGAACAGGCTATTTAGG + Intronic
990604904 5:57399073-57399095 CTGAAGAGAACGTGCTTTTTTGG + Intergenic
991063943 5:62406035-62406057 CTGTAGAGAAGGAGCTGTGGAGG + Intronic
992549811 5:77849772-77849794 CTGGAGAGAAAGCATTTTGTGGG - Intronic
992711588 5:79463509-79463531 CTGGAGATAAGGTGATTTGTTGG - Intronic
992760883 5:79950140-79950162 CTGAAGGGAAGAGTCTTTGTGGG - Intergenic
992777959 5:80104799-80104821 CTGCTGGGAAGGGGCTTTGCAGG - Intergenic
992913009 5:81416780-81416802 CTGGAGGGAAAGGGCTGTTTTGG + Exonic
994622020 5:102175028-102175050 CTGGAGAGAAATCACTTTGTAGG + Intergenic
996705886 5:126497990-126498012 CAGGAGAGAAGTAGATTTGTTGG + Intergenic
997645236 5:135477527-135477549 CTGCTGAGAAGGGGCTCGGTGGG + Intergenic
998628853 5:143876229-143876251 ATGAAGAGAAGGGGCTTGGATGG + Intergenic
1001358004 5:171050523-171050545 TTGTAGAGACGGGGCTTTGCTGG - Intronic
1002643377 5:180641087-180641109 CTGGAGAGCAGGGGCCTGGGAGG - Intronic
1003068316 6:2921661-2921683 ATGCTGAGAAGGGGCATTGTGGG + Intergenic
1004185335 6:13416513-13416535 GTGGAGAGGAGGGGCTTGATGGG + Intronic
1005944212 6:30583902-30583924 GGGGAGAAAAGGGGCTTGGTGGG + Intronic
1006191677 6:32213253-32213275 CTGGAGAGAGGAGGCTGTGAGGG + Intronic
1006317039 6:33297390-33297412 CTGGGGAGAAGGGGCTTTGGGGG - Intronic
1006357806 6:33571085-33571107 CGGGAGTGTAGGGGCTCTGTGGG - Intergenic
1006951299 6:37822876-37822898 CTAGAGATAAGGGGGTCTGTTGG + Intronic
1007536613 6:42596836-42596858 ATGGAGAGAAATGGCTTAGTAGG + Intronic
1007759556 6:44125840-44125862 TTGGTGGGAAGGGTCTTTGTAGG - Intronic
1008881412 6:56384059-56384081 ATGCTGAGAAGGGGCTTTGGAGG - Intronic
1011287193 6:85737468-85737490 CAGGAGAGAAGCAGCTTTGAGGG + Intergenic
1011549682 6:88519600-88519622 ATTGAGAGAAGGGAGTTTGTTGG + Intergenic
1011626353 6:89286735-89286757 CTGCAGAGGAGGGGCTGTGTGGG + Intronic
1013267207 6:108511719-108511741 CTAAATTGAAGGGGCTTTGTGGG + Intronic
1013386423 6:109636207-109636229 CAGGAGAGGAGGGGCTGTGCAGG - Intronic
1014098881 6:117488069-117488091 TTGAAGAGGAGGGGTTTTGTGGG + Intronic
1015839936 6:137466235-137466257 CTTGAGAGTAGGGCCTTTGCGGG + Intergenic
1016000291 6:139034389-139034411 CTGGAGACACGGGGCTTTTGGGG + Intronic
1017975444 6:159353087-159353109 CTGGGGAGAAGGGACTTTCTGGG - Intergenic
1018028833 6:159826285-159826307 CTGGAGAGAAGCTGCATTGTAGG - Intergenic
1018871209 6:167783969-167783991 CTGGACAGAATAGGCTTTTTTGG - Intergenic
1020038646 7:4983858-4983880 GTGGGAAGAAGGTGCTTTGTTGG + Intronic
1020971722 7:14951743-14951765 CTGGGGAGAAGAGGCATTGAGGG + Intronic
1022124326 7:27340975-27340997 AGGGAGAGAAGGGGCTGTGAGGG - Intergenic
1024638296 7:51308929-51308951 CTGGAAAGCATAGGCTTTGTAGG + Intronic
1026063667 7:67049478-67049500 TTGGAGAGGATGGGTTTTGTGGG + Intronic
1028137076 7:87233067-87233089 TTGGAGAGAAGGCTCTTTGCAGG + Intergenic
1029793134 7:102866403-102866425 CTGGAGAGAAGGGCCTGAGGAGG + Intronic
1030386499 7:108873928-108873950 CTTGAGGGTAGGGCCTTTGTGGG - Intergenic
1030661476 7:112223671-112223693 CTGGACAAAAGCGCCTTTGTGGG - Intronic
1032468040 7:132159130-132159152 CTGGAAAGAAGGGGATTTAAGGG - Intronic
1032651278 7:133881281-133881303 CTGGGGTGAAGGGGGTATGTGGG - Intronic
1033397905 7:140993189-140993211 CTGGTGAGATAGGGCCTTGTGGG - Intergenic
1035286869 7:157812278-157812300 CCAGAGGGAAGGGGCTTTGTGGG + Intronic
1035388288 7:158489005-158489027 CTGGAGGGAAGGGGCTCTGCAGG + Intronic
1036002980 8:4629925-4629947 CTAGAGAGAAGGAGCTTCCTGGG - Intronic
1038002361 8:23403124-23403146 CTGGTGAGAAGGGGCGCGGTGGG + Intronic
1039574285 8:38611177-38611199 CTGCAGAGTAGGGGTTTTGATGG + Intergenic
1040859434 8:51984009-51984031 CTGGAGAGAAAGGAAGTTGTGGG - Intergenic
1041942211 8:63401094-63401116 ATGAAGAGAAAGGACTTTGTGGG - Intergenic
1042693662 8:71531806-71531828 ATGGAGAGGAGGAGGTTTGTGGG - Intronic
1043175354 8:77018059-77018081 CTGCAGAGAAGGTGCTATGAGGG + Intergenic
1045427135 8:102078235-102078257 CTGGCGAGAAGGGGCTGTGTAGG - Intronic
1047043438 8:121024694-121024716 CTGGAGAGAAAAGGCAGTGTTGG - Intergenic
1048531363 8:135253301-135253323 CTTGAGGGAGGGGCCTTTGTTGG - Intergenic
1049269841 8:141688970-141688992 GAGGAGAGAATGGGCATTGTAGG + Intergenic
1049302283 8:141877966-141877988 CTGGAGAGAAGGAGACTAGTGGG - Intergenic
1049393244 8:142382741-142382763 CAGGAGAGAAGGGGCCCGGTAGG + Intronic
1049542783 8:143215960-143215982 CTGGAGGGAAGGGGATTTGGAGG + Intergenic
1049653441 8:143787412-143787434 ATGGAAAGAAGGGGCAGTGTAGG - Intergenic
1049780378 8:144426067-144426089 CCGGAGAGAGCGGGCTCTGTGGG + Intronic
1052716281 9:32121591-32121613 CTGGAGAGAGTGGGCTTCTTGGG - Intergenic
1053050878 9:34959252-34959274 CTGGAGGGAAAGGCCTTTGAAGG + Intronic
1053054289 9:34985072-34985094 CTGGAGAGAAGCAGATTTGAAGG + Intergenic
1053423687 9:37997378-37997400 CAGGAGGGAAGGGGCTGTCTAGG - Intronic
1056058271 9:82852344-82852366 CTGAAGAGAAAGAGCTGTGTGGG + Intergenic
1056404221 9:86258799-86258821 GTGCAGAGAAGGGGGGTTGTGGG - Intronic
1056579170 9:87877794-87877816 CTGGAGAGCAGGAGCTATTTTGG - Intergenic
1056611588 9:88128822-88128844 AGGGAGAGAAGGGGCTTTCCAGG + Intergenic
1057320238 9:94005999-94006021 CTAGAGAGAAGAGGCTTTTTGGG + Intergenic
1057320438 9:94007661-94007683 CTAGAGAGAAGAGGCTTTTTGGG - Intergenic
1057785789 9:98086467-98086489 TGGGAGGGAAGGGGCTTTCTGGG + Exonic
1057929833 9:99184056-99184078 CTGGAGAAGGTGGGCTTTGTGGG - Intergenic
1061278251 9:129581842-129581864 CTGGAGAGAAGGGGATGAGAAGG + Intergenic
1061362473 9:130152360-130152382 CTAGAGAGAAGGGAATATGTAGG - Intergenic
1061663866 9:132148834-132148856 CTGGAGACAAGGGGCCAGGTCGG - Intergenic
1062539232 9:137034327-137034349 CTGGAGAGAGGGGGGTTTGGAGG + Intronic
1186750751 X:12619432-12619454 ATGGACAAAAGTGGCTTTGTGGG + Intronic
1186815863 X:13237457-13237479 CAAGAGAGAAAGGGCTTTCTTGG + Intergenic
1187334860 X:18373217-18373239 CGGGAGAGAAAGGGAGTTGTGGG - Intergenic
1188049665 X:25469184-25469206 ATGGAAAGTAGTGGCTTTGTAGG + Intergenic
1190598805 X:52069300-52069322 CTGGAGGAAAGGGCTTTTGTTGG - Intergenic
1190610019 X:52184773-52184795 CTGGAGGAAAGGGCTTTTGTTGG + Intergenic
1192556130 X:72091114-72091136 CTGGAAAGAAGTGGAATTGTTGG + Intergenic
1193294749 X:79821196-79821218 CTGGAGGTGAGGGTCTTTGTTGG + Intergenic
1194176472 X:90655336-90655358 CTGCTGAGGAGGGGCATTGTGGG - Intergenic
1195453818 X:105045289-105045311 CTGGGTAGAAGGGGCCTTTTAGG + Intronic
1195654023 X:107317176-107317198 CTGGAGAGAGGTGGCTTATTTGG + Intergenic
1196815170 X:119659844-119659866 CTGGAGAAAAGGGGATTTAAGGG - Intronic
1199543485 X:148983289-148983311 ATGAAGAGAATGGGCTTTGGAGG + Intronic
1200523099 Y:4236248-4236270 CTGCTGAGGAGGGGCATTGTGGG - Intergenic