ID: 1083646586

View in Genome Browser
Species Human (GRCh38)
Location 11:64174963-64174985
Sequence GGGAAGGGCCTTAGTGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083646574_1083646586 -4 Left 1083646574 11:64174944-64174966 CCCACGCCACCCTCCCCAGGGGA No data
Right 1083646586 11:64174963-64174985 GGGAAGGGCCTTAGTGGGCCAGG No data
1083646578_1083646586 -10 Left 1083646578 11:64174950-64174972 CCACCCTCCCCAGGGGAAGGGCC No data
Right 1083646586 11:64174963-64174985 GGGAAGGGCCTTAGTGGGCCAGG No data
1083646575_1083646586 -5 Left 1083646575 11:64174945-64174967 CCACGCCACCCTCCCCAGGGGAA No data
Right 1083646586 11:64174963-64174985 GGGAAGGGCCTTAGTGGGCCAGG No data
1083646570_1083646586 21 Left 1083646570 11:64174919-64174941 CCAGACAGATACTGAGTGTTCTT No data
Right 1083646586 11:64174963-64174985 GGGAAGGGCCTTAGTGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083646586 Original CRISPR GGGAAGGGCCTTAGTGGGCC AGG Intergenic
No off target data available for this crispr