ID: 1083647270

View in Genome Browser
Species Human (GRCh38)
Location 11:64179495-64179517
Sequence AACATGAAGGAAGCTGTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083647270_1083647279 23 Left 1083647270 11:64179495-64179517 CCCAAGACAGCTTCCTTCATGTT No data
Right 1083647279 11:64179541-64179563 GGAACAGTTGGCTTGCCACAAGG No data
1083647270_1083647275 2 Left 1083647270 11:64179495-64179517 CCCAAGACAGCTTCCTTCATGTT No data
Right 1083647275 11:64179520-64179542 CTGGAGCCCGCACTATGTTGCGG No data
1083647270_1083647278 11 Left 1083647270 11:64179495-64179517 CCCAAGACAGCTTCCTTCATGTT No data
Right 1083647278 11:64179529-64179551 GCACTATGTTGCGGAACAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083647270 Original CRISPR AACATGAAGGAAGCTGTCTT GGG (reversed) Intergenic
No off target data available for this crispr