ID: 1083647275

View in Genome Browser
Species Human (GRCh38)
Location 11:64179520-64179542
Sequence CTGGAGCCCGCACTATGTTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083647271_1083647275 1 Left 1083647271 11:64179496-64179518 CCAAGACAGCTTCCTTCATGTTA No data
Right 1083647275 11:64179520-64179542 CTGGAGCCCGCACTATGTTGCGG No data
1083647270_1083647275 2 Left 1083647270 11:64179495-64179517 CCCAAGACAGCTTCCTTCATGTT No data
Right 1083647275 11:64179520-64179542 CTGGAGCCCGCACTATGTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083647275 Original CRISPR CTGGAGCCCGCACTATGTTG CGG Intergenic
No off target data available for this crispr