ID: 1083648338

View in Genome Browser
Species Human (GRCh38)
Location 11:64185995-64186017
Sequence CCTCCCCCGCACCTCAGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 165}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083648338_1083648349 23 Left 1083648338 11:64185995-64186017 CCAATCCTGAGGTGCGGGGGAGG 0: 1
1: 0
2: 0
3: 13
4: 165
Right 1083648349 11:64186041-64186063 GCTGTCCAATGAGAAGGAAGTGG 0: 1
1: 0
2: 1
3: 25
4: 304
1083648338_1083648345 17 Left 1083648338 11:64185995-64186017 CCAATCCTGAGGTGCGGGGGAGG 0: 1
1: 0
2: 0
3: 13
4: 165
Right 1083648345 11:64186035-64186057 CTCCCCGCTGTCCAATGAGAAGG 0: 1
1: 0
2: 0
3: 8
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083648338 Original CRISPR CCTCCCCCGCACCTCAGGAT TGG (reversed) Intronic
900500379 1:3001601-3001623 CCACCCCCACCCCTCAGGATCGG + Intergenic
900931591 1:5741587-5741609 CTTCCTCCTCACCTCAGGAATGG - Intergenic
901012899 1:6211154-6211176 CCTCCCCCACACCCCAGTGTTGG - Intronic
901058440 1:6460518-6460540 CCTCCCCCGCACCCCGGAACCGG + Exonic
902325731 1:15699340-15699362 CCTGCCCCCCACCTCACGATGGG + Intronic
903129045 1:21266400-21266422 CCTTCCCCCCAGCACAGGATGGG - Intronic
904830100 1:33300789-33300811 CCTCCCCCGCCCCCCAGACTTGG + Intergenic
907359702 1:53904542-53904564 CCTACCCCCCACCCCAGGATGGG - Intronic
907370291 1:53997977-53997999 CCTGCCCCGCACCCCACGACAGG - Intergenic
909658424 1:78056037-78056059 CCTCCCCACTACCTCAGGACTGG + Intronic
910892059 1:92028837-92028859 CCTCCCCCTCACCCCAAGACAGG + Intergenic
911392663 1:97266677-97266699 CCTGCCCCCCACCTCATGACAGG + Intronic
912369744 1:109164764-109164786 CCTCCGCTGCCCCTCAGGCTGGG + Intronic
912764549 1:112396547-112396569 CCCACCCCGCACCTCAGCCTTGG + Intronic
915182029 1:154070044-154070066 CCATCCCCGCACCCCATGATAGG - Intronic
918661803 1:187097875-187097897 CCTTCCCCCCACCTCATGACAGG + Intergenic
919377582 1:196814212-196814234 CCTGCCCCCCACCCCATGATAGG + Intergenic
919387096 1:196936109-196936131 CCTGCCCCCCACCCCATGATAGG + Intronic
922721814 1:227903502-227903524 CATCCCCCGGACCACAGGGTAGG - Intergenic
924477594 1:244395387-244395409 CCTCACCCCCACCTCGGGAGAGG + Intergenic
1065963562 10:30753242-30753264 CCTCCCGCTCACTGCAGGATGGG + Intergenic
1067713383 10:48668201-48668223 CCTTCCCCATACCTCAGAATTGG + Intergenic
1069946086 10:71986761-71986783 CCTCCCCTGCAGCCCAGCATGGG + Intronic
1070326180 10:75390706-75390728 ACTCCCCCGCACCCCACGAGTGG - Intergenic
1072882047 10:99237120-99237142 CCTTTCCCGCGCTTCAGGATAGG - Intergenic
1074241414 10:111643071-111643093 CCTCCCCCCCACCCCACGACAGG - Intergenic
1074413560 10:113247835-113247857 CCTTCTCCACACATCAGGATGGG - Intergenic
1077461941 11:2715150-2715172 CCTCCCATGAACCTCAGCATGGG + Intronic
1077757207 11:5045297-5045319 CCCCCTCCACACCTCAGAATGGG + Intergenic
1077963941 11:7107056-7107078 CCTTCCCCCCACCTCACGACAGG + Intergenic
1080386505 11:31813941-31813963 CCGCGCCCGCACCTCAGTCTCGG - Intronic
1081708082 11:45197864-45197886 CCTTCCCCGCACCCCACGACAGG - Intronic
1083648338 11:64185995-64186017 CCTCCCCCGCACCTCAGGATTGG - Intronic
1083748025 11:64745810-64745832 CCGCCCCCGCACCTCAGTCTTGG + Intergenic
1084956588 11:72694884-72694906 CCTACCCTGCACATGAGGATGGG - Intronic
1091450595 12:570057-570079 CCTCGCCCGCAAGTCTGGATGGG + Intronic
1092702745 12:11250831-11250853 CCTTCCCCCCACCTCCTGATAGG + Intergenic
1094200877 12:27793497-27793519 GCTCCCCTGCACCCCAGGCTGGG + Intronic
1096747572 12:53738698-53738720 CCTCCCCCGCCGCTCAGGGGAGG + Intergenic
1096924294 12:55125197-55125219 CCCCCCCGCCACCTCAGGACAGG + Intergenic
1098042759 12:66368857-66368879 CCTCCCCAGCACTTCAAAATTGG + Intronic
1099129679 12:78811485-78811507 CCTCCCCCGCCCCCCATGACAGG - Intergenic
1101044881 12:100794700-100794722 CCTCCCCTGCACCTGGGGAGGGG + Intronic
1103596007 12:122024547-122024569 CCTTCCCCGCGCCTTCGGATTGG + Intronic
1105404054 13:20119029-20119051 CCTCCCCCGCCCCTGTGGAAGGG + Intergenic
1115916947 14:38325925-38325947 CCATCCCCGCACCCCAGGACAGG - Intergenic
1116964263 14:50998227-50998249 CCTCCCTCGCCCCTCAGAAGGGG - Intronic
1118778097 14:68986466-68986488 CCTCCCCCACAACACAGCATTGG + Intergenic
1122688083 14:103519356-103519378 CCTCCCCCACCCTGCAGGATGGG + Intergenic
1122710110 14:103650285-103650307 CCTCCACCACACCCCAGGGTAGG + Intronic
1124431856 15:29615027-29615049 CCTCCCCTGAACCTGAGAATTGG - Intergenic
1131498070 15:92932441-92932463 CCTCCCCCCCACCCCATGACAGG + Intronic
1132670523 16:1100568-1100590 CCTCCCGCACCCCCCAGGATGGG - Intergenic
1132672649 16:1108068-1108090 ACTGCCCCGCAAATCAGGATGGG - Intergenic
1132828155 16:1915052-1915074 CCTGCCCCACACCTCAGGCCTGG + Intronic
1132878202 16:2149477-2149499 CCTCCCCCCAACCTCAGACTTGG + Intronic
1138184153 16:54963561-54963583 CCTCCCCTGGCCCTCAGCATGGG + Intergenic
1139459536 16:67110554-67110576 CCTCGCCGGCACCTGAGGATAGG + Intronic
1143167122 17:4902321-4902343 CATCCCCCACCCCTTAGGATTGG - Exonic
1143204701 17:5133627-5133649 CCACCCCCCCACCCCAGGGTGGG - Intronic
1143509700 17:7388673-7388695 CTTCCTCTGCAACTCAGGATCGG - Exonic
1143570596 17:7755598-7755620 CCTCCCCTGCATCCCAGCATTGG - Intronic
1143974168 17:10817944-10817966 AATCCCCAGCACCTCAGAATTGG + Intergenic
1144101204 17:11943747-11943769 CCTCCACCGCACCTCAACATGGG + Intronic
1144124341 17:12188679-12188701 CCCCACCCCCACCTCAGGAAGGG + Intergenic
1147342832 17:39764802-39764824 CCTCCCCCTCCCCACAGGAGAGG - Intergenic
1147413832 17:40273939-40273961 CCTCCACCGCCCCTGAGGAATGG + Exonic
1148751189 17:49946839-49946861 CCTGCCTCTCACCTCAGGCTAGG + Intergenic
1149488982 17:57068412-57068434 CCACCCCCGCACCGCTGGATGGG + Intergenic
1150218541 17:63483342-63483364 CTTCCCCAGTTCCTCAGGATGGG + Intergenic
1150915509 17:69432646-69432668 CCTCCCCCACCCCTCCCGATAGG - Intronic
1151344940 17:73495712-73495734 CCTTCCCCGATCCTCAGGAGTGG + Intronic
1151416822 17:73972021-73972043 CCTCCTATGCTCCTCAGGATAGG + Intergenic
1152987802 18:335435-335457 AACCCCCAGCACCTCAGGATGGG + Intronic
1157189398 18:45568081-45568103 CCCCCACCGCCTCTCAGGATTGG - Intronic
1158236508 18:55321882-55321904 CCTCCCCCGCCCGCCAGGAATGG - Intronic
1161084022 19:2325645-2325667 CCTCCCCCGCACCACCGCACAGG - Intronic
1161420367 19:4173271-4173293 CCTTCCCCGCAACTCCGGAGGGG - Intergenic
1162731864 19:12722969-12722991 CCTCCCAAGTACCTCTGGATGGG - Intronic
1163365453 19:16873520-16873542 CCTCCCCCCCCCCCCAGGCTGGG + Intronic
1165124361 19:33583385-33583407 CCTGCCCCTCACCTCAGTTTGGG + Intergenic
1166726953 19:45034339-45034361 CCTCCCCAGAACCTGGGGATGGG - Intronic
1167254424 19:48418727-48418749 GCTCCCACGCTCCTCATGATGGG - Intronic
925921225 2:8639245-8639267 TGTCCCCAGCCCCTCAGGATAGG - Intergenic
929588597 2:43131225-43131247 CCTCCCCAGCCCCACAGGCTGGG - Intergenic
931885203 2:66609792-66609814 CCTGCCCCCCACCCCAGGACAGG + Intergenic
933052617 2:77618407-77618429 CCTCCCCCGCACCCCACGTCAGG - Intergenic
934945647 2:98539439-98539461 CCTCCCCCGGCCCTCAGGGATGG - Intronic
936371371 2:111904883-111904905 CCTCCCGGGCACCTGAGGGTTGG - Intronic
936777062 2:115986421-115986443 CATCCCCCCAACCCCAGGATAGG - Intergenic
939826710 2:147024150-147024172 CCTCCTCCAGACCTCAGAATGGG - Intergenic
940797633 2:158097639-158097661 CCTCCCCAGGGCCTCAGCATGGG + Intronic
942171270 2:173291772-173291794 CCCCCCCCCCGCCTCAGGAGTGG + Intergenic
942640428 2:178055340-178055362 CCTCCCCCCCACCCCATGACAGG - Intronic
943965086 2:194321913-194321935 CCTTCCCCAAACCTCAGGATTGG - Intergenic
947385586 2:229587322-229587344 CCTCTCCCGCCTCTCCGGATGGG + Intronic
948368345 2:237472968-237472990 CCTCCCCCACACCTGAAGATGGG + Intergenic
948496513 2:238353405-238353427 CCTCCCCCTCCTCTAAGGATGGG - Intronic
948894787 2:240923065-240923087 CCTCCCCCGCTCCACAGGCCAGG + Intronic
1168964179 20:1889173-1889195 CCTCCCCAACACCTCTGGGTGGG - Intergenic
1170395605 20:15922026-15922048 ACTCCCCAGCACCTCAGTATTGG + Intronic
1170565745 20:17603096-17603118 CCTTCCCTGGACCTTAGGATTGG + Intronic
1172962202 20:38806867-38806889 GCTCCCGGGCACCTCAGGAGCGG + Intronic
1174487767 20:50871895-50871917 CCTCCCCCACAGCTCAGGCTGGG - Intronic
1175804177 20:61818266-61818288 CCTCCCCCACACCCCAGCAAGGG - Intronic
1176450736 21:6858905-6858927 CCTCCCCCGCACCTAGGGTCCGG - Intergenic
1176828905 21:13723923-13723945 CCTCCCCCGCACCTAGGGTCCGG - Intergenic
1178565128 21:33676999-33677021 CCCTCCCCGCACCTCACGACAGG - Intronic
1180055389 21:45356381-45356403 CAGCCCCGGCAGCTCAGGATGGG - Intergenic
1184502241 22:44881042-44881064 CATCCCTCCCTCCTCAGGATGGG + Intergenic
1185139422 22:49092115-49092137 CCTCCCCCAGACCTGGGGATGGG + Intergenic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
954934419 3:54313506-54313528 CCACCTCCCCACATCAGGATGGG + Intronic
958751391 3:98196079-98196101 CCTCCCCTACACATCAAGATGGG + Intronic
958758409 3:98276789-98276811 CTTCCCCGGAACCTCAGCATGGG + Intergenic
968085732 3:195873126-195873148 CCTCCCCGTCTCCTCAGGAGGGG + Intronic
968662911 4:1806180-1806202 CCACCCCCGCACCCCAGGGCCGG - Intronic
976401003 4:84607434-84607456 CTCCCCCCGCCCCTCAGTATCGG + Intronic
978963803 4:114716695-114716717 CTTCCCACTCACCTCAGGTTAGG + Intergenic
979566946 4:122165220-122165242 TCTCCCCCGCACCCTATGATAGG + Intronic
984730785 4:183066263-183066285 ACTCCCCAGTACCTCAGAATGGG + Intergenic
985124593 4:186680479-186680501 CCTCCCCTGCCCCTCTGGAAGGG + Intronic
985747554 5:1655703-1655725 CCCTCCCCACACCTCAGAATGGG + Intergenic
989978368 5:50612182-50612204 CCTCCCCCCCACCCCAGAATAGG - Intergenic
994717318 5:103337242-103337264 ACTCCCCCACATCTAAGGATGGG - Intergenic
997615522 5:135243753-135243775 CATCCCCCTCACCTCAGGTTTGG + Intronic
998142997 5:139710201-139710223 GCTCCCCAGCACCTCAGCCTAGG - Intergenic
1000423890 5:161068328-161068350 CCTGCCCCCCACCCCAGGACAGG + Intergenic
1000949645 5:167465367-167465389 TCTCCCCCTCACTTAAGGATAGG - Intronic
1001278944 5:170372122-170372144 CCTCCCCTACACCTCCAGATAGG + Intronic
1002314597 5:178334933-178334955 CCTCCCCCACACCCCAGACTTGG + Intronic
1002536685 5:179879766-179879788 CTTCCCCAGCTCCTCAGGAGGGG - Exonic
1004929411 6:20447411-20447433 CCACCCCCACCCCTCAGCATAGG + Intronic
1005266032 6:24113102-24113124 CCCCCCCTGGACCGCAGGATGGG - Intergenic
1006733214 6:36252191-36252213 CCTCCCCTGCAGCTCAGGCATGG + Intronic
1007570942 6:42890556-42890578 CCCCCTCCGACCCTCAGGATAGG - Exonic
1007813153 6:44500486-44500508 CCTCCCACCCACCTTAGGAAAGG + Intergenic
1009485787 6:64220024-64220046 CCTCCCCCTCACCCCACAATAGG - Intronic
1014680984 6:124429827-124429849 ACTCCCCAGCAATTCAGGATAGG - Intronic
1016038998 6:139412480-139412502 CCTGCCCCTCACCCCAGGACAGG - Intergenic
1017901345 6:158720903-158720925 CATCCCACGCACCACAGGCTGGG + Intronic
1019165446 6:170095108-170095130 CCTCCCCTCCAGCCCAGGATGGG - Intergenic
1019276837 7:180210-180232 CCTCCCTCCCTCCTCAGGGTGGG - Intergenic
1023779329 7:43641696-43641718 CATCCCCAGCACCACAGGCTGGG + Intronic
1023939054 7:44758426-44758448 GCTCCCCTGCACTTCAGGCTGGG + Intronic
1027534414 7:79379109-79379131 CCTCCCCCCCACCCCACAATAGG + Intronic
1028329787 7:89576004-89576026 CCTCCCCCCTACCTCATGACAGG - Intergenic
1031760836 7:125711249-125711271 CCTCCCCCCCACCACACGACAGG - Intergenic
1033320370 7:140333594-140333616 CCACCCCAGCACCTCAGGTGAGG + Intronic
1033657365 7:143382519-143382541 CCTCCCCTGCACCTCTGCCTTGG + Intronic
1034394736 7:150813547-150813569 CCAGCCCCACACCTCATGATAGG - Intergenic
1034448903 7:151127063-151127085 CCTCCCCCTCACCTCCTGTTGGG + Intronic
1034887016 7:154805833-154805855 CCTCCCCCGTGCCTCTGCATGGG + Intronic
1038141407 8:24849313-24849335 CCTCCCCCCCACCCCATGACAGG + Intergenic
1038270055 8:26067721-26067743 CCTCCCCTGCACCCCATGACTGG - Intergenic
1042956479 8:74256385-74256407 CCTTCCCCCCACCCCATGATAGG - Intronic
1045123828 8:99067486-99067508 CCTGCCCCCCACATCATGATAGG - Intronic
1045459385 8:102412727-102412749 CCTCCCCCGCCGCTCCGGAGCGG - Exonic
1045867598 8:106885720-106885742 ACTCCCCCCCACCTCACGACAGG - Intergenic
1048878147 8:138852682-138852704 CATCCCCCGCATTTCAAGATTGG - Intronic
1049603118 8:143517281-143517303 CTTCCCCTGCACCTGAGGCTGGG - Intronic
1049798172 8:144505831-144505853 CCTCCCCGGCACCCCAGGGCAGG + Exonic
1050325324 9:4491916-4491938 CCGCCCCCTCCCCTCAGGGTGGG + Intronic
1053614033 9:39745067-39745089 CCTCCCCAGCAGCTCAGAAGCGG + Intergenic
1054239483 9:62597326-62597348 CCTCCCCAGCAGCTCAGAAGCGG - Intergenic
1054553615 9:66631853-66631875 CCTCCCCAGCAGCTCAGAAGCGG - Intergenic
1054938519 9:70714631-70714653 CCTCCCCCCCACCCCACGACAGG - Intronic
1054940210 9:70732624-70732646 CCTCCCCCCCACCCCACGACAGG - Intronic
1056754461 9:89373195-89373217 CCTCCACCGCACCCCACGTTGGG + Intronic
1057932890 9:99211761-99211783 CCTCCCAGGCACCTATGGATGGG - Intergenic
1057996309 9:99823893-99823915 CCGCCCCCGCTCCCCAGGGTTGG + Intronic
1060813012 9:126620482-126620504 CCTCTCCTGCACCTCAAGAGAGG + Intronic
1061078331 9:128355214-128355236 CCTCCCCCAACCCTCAGGAAGGG - Intronic
1203518446 Un_GL000213v1:25612-25634 CCTCCCCCGCACCTAGGGTCCGG + Intergenic
1195138150 X:101931687-101931709 CCGCCCCCGCACCCCGGGACGGG + Intronic
1196668200 X:118338407-118338429 CCTCCCCCTCACCCCACGACAGG + Intergenic
1199550161 X:149052174-149052196 CCTCCCCCCACCCTCAGGACAGG - Intergenic
1201175770 Y:11307641-11307663 CCTCCCCGGCTCCTCTGGAAGGG + Intergenic
1201619661 Y:15942283-15942305 ACTCCCCCGCACCCCATGACAGG + Intergenic