ID: 1083649404

View in Genome Browser
Species Human (GRCh38)
Location 11:64192668-64192690
Sequence CCTCACAGGAAGAAGGTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 364}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083649404_1083649414 10 Left 1083649404 11:64192668-64192690 CCGCCCACCTTCTTCCTGTGAGG 0: 1
1: 0
2: 2
3: 38
4: 364
Right 1083649414 11:64192701-64192723 GCTGTGCTCTGTTTGTCATTTGG 0: 1
1: 0
2: 0
3: 18
4: 188
1083649404_1083649416 29 Left 1083649404 11:64192668-64192690 CCGCCCACCTTCTTCCTGTGAGG 0: 1
1: 0
2: 2
3: 38
4: 364
Right 1083649416 11:64192720-64192742 TTGGATGCTTTGGAAATCTGTGG 0: 1
1: 0
2: 0
3: 18
4: 242
1083649404_1083649415 19 Left 1083649404 11:64192668-64192690 CCGCCCACCTTCTTCCTGTGAGG 0: 1
1: 0
2: 2
3: 38
4: 364
Right 1083649415 11:64192710-64192732 TGTTTGTCATTTGGATGCTTTGG 0: 1
1: 1
2: 0
3: 21
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083649404 Original CRISPR CCTCACAGGAAGAAGGTGGG CGG (reversed) Intronic
900489945 1:2942827-2942849 CCTGACAGGAAGAGGCTGGTCGG + Intergenic
900593780 1:3471383-3471405 CCCCACAGGCAGCAGATGGGTGG - Intronic
901419661 1:9142483-9142505 CCTGTCAGGATGAAGGCGGGAGG - Intergenic
902018861 1:13328910-13328932 CCGCCCAGGAGGGAGGTGGGGGG + Intergenic
902114336 1:14108525-14108547 CCTCCCAGGAGGCAGGTGGTGGG + Intergenic
902478226 1:16699162-16699184 CCACACAGCTAGAGGGTGGGAGG + Intergenic
903269163 1:22177053-22177075 CCTCATTGGAAGGGGGTGGGTGG + Intergenic
903637771 1:24833538-24833560 CCGCCCAGGAGGGAGGTGGGGGG - Intronic
904102158 1:28040585-28040607 CATCAAAGGAGAAAGGTGGGAGG + Intronic
904323493 1:29711821-29711843 CCTCTCAGGAAGTAGGTGGAGGG + Intergenic
905970184 1:42135972-42135994 ACAGAAAGGAAGAAGGTGGGGGG - Intergenic
906610871 1:47201361-47201383 CCTCTGCGGAAGAATGTGGGAGG - Intergenic
908650913 1:66332227-66332249 CCTCTGAGGAAGAAGGCGGAGGG - Intronic
910466540 1:87506189-87506211 ACAGAAAGGAAGAAGGTGGGGGG + Intergenic
911882233 1:103254560-103254582 CCTGACAGGAGAGAGGTGGGGGG + Intergenic
911971395 1:104442213-104442235 CATCACAGAAAGAAGTTGGAAGG + Intergenic
913173329 1:116251766-116251788 GCTCAAAGGAAGAAGGAGAGAGG + Intergenic
913225239 1:116693345-116693367 CCTCAGAGGGTGAAGGGGGGAGG - Intergenic
914720533 1:150285173-150285195 CCTCACTGGAAGTAGGGGAGGGG + Intronic
915589313 1:156861566-156861588 CCTCATAACAAGAAAGTGGGCGG - Intronic
915626708 1:157118378-157118400 CCTCACAGGCAGTAAGTGGCAGG + Intergenic
916725515 1:167518966-167518988 CCACACAGCAAGTAGGTGGTAGG - Intergenic
916725567 1:167519663-167519685 CCACACAGCAAGTAGGTGGTAGG + Intergenic
917658683 1:177155449-177155471 CCTCACTGGAAGGGGTTGGGGGG + Intronic
917963486 1:180164421-180164443 CCTCGAAGGAGGGAGGTGGGTGG - Intronic
918867145 1:189916696-189916718 CCAAAAAGGGAGAAGGTGGGAGG - Intergenic
921250314 1:213291253-213291275 CCTCACACAAAGAAGTTGGAAGG - Intergenic
922523946 1:226283062-226283084 ACTCACAAGACCAAGGTGGGAGG - Intronic
922994267 1:229943693-229943715 CCGGACAGAGAGAAGGTGGGAGG + Intergenic
923050778 1:230390000-230390022 TCACACAGCCAGAAGGTGGGAGG + Intronic
923071150 1:230565491-230565513 ACTCACTGGGAGAAGCTGGGAGG + Intergenic
923545925 1:234923254-234923276 CCTCTCAGGGAAAAGGTGGGGGG - Intergenic
1063915821 10:10880990-10881012 TGTGACATGAAGAAGGTGGGTGG - Intergenic
1065208767 10:23382338-23382360 CCACACAGAAACAAGGTGAGGGG + Intergenic
1066085535 10:31970348-31970370 CCGCCCAGGAGGGAGGTGGGGGG + Intergenic
1066086823 10:31979322-31979344 CCTGGCAGGAGGGAGGTGGGGGG - Intergenic
1066382445 10:34912909-34912931 CCTCACATGAGGCAGGTGGTCGG - Intergenic
1067056961 10:43058085-43058107 CCCCACGGGAAGATGGGGGGAGG - Intergenic
1067204318 10:44200321-44200343 CTTCAGAGGAAGAGAGTGGGAGG - Intergenic
1067841213 10:49680768-49680790 CCTGAGAGGATGGAGGTGGGAGG + Intronic
1067842479 10:49691900-49691922 CCTCACAGGTGGAGGTTGGGGGG + Intronic
1067907178 10:50304883-50304905 CCTCTCAGGAGACAGGTGGGAGG - Intergenic
1069137559 10:64783878-64783900 CCTCAGAGAAGGGAGGTGGGAGG + Intergenic
1069699039 10:70408037-70408059 CCGTCCAGGAAGGAGGTGGGGGG - Intronic
1069699114 10:70408212-70408234 CCGTCCAGGAAGGAGGTGGGGGG - Intronic
1069825866 10:71254635-71254657 CCAGCCAGGAGGAAGGTGGGAGG - Intronic
1069934576 10:71906341-71906363 CCTCCCAGGAAGCAGGGGTGAGG - Intergenic
1070138344 10:73715605-73715627 CCTTCCAGGAGGGAGGTGGGGGG - Intergenic
1070338118 10:75472866-75472888 CCTAACAGGAAGCAGGAGGGTGG + Intronic
1070819477 10:79346656-79346678 CCTCACTGCAAGGTGGTGGGAGG - Intergenic
1070843406 10:79503567-79503589 AATTACAGGAAGATGGTGGGGGG + Intergenic
1070930259 10:80256034-80256056 AATTACAGGAAGATGGTGGGGGG - Intergenic
1071264219 10:83949856-83949878 ACTCACAGGCAGAAGGTGAAGGG - Intergenic
1075282940 10:121156304-121156326 CCTCCCAGGTAGAAGATGGGAGG + Intergenic
1075451897 10:122557431-122557453 CCTCAGAGGTGGGAGGTGGGAGG + Intergenic
1075904061 10:126065292-126065314 CCTCAGAGGAAGAAGAAGGAGGG + Intronic
1076634663 10:131874317-131874339 CCTCCCAGGAAGAAGCCAGGAGG - Intergenic
1076857934 10:133126756-133126778 CCTCAGGGGAAGAAGGTCGGAGG - Intronic
1077032261 11:473831-473853 TCTCCCAGGAGGGAGGTGGGAGG - Intronic
1077564731 11:3290350-3290372 CATTACAGAAAGATGGTGGGGGG + Intergenic
1077570620 11:3336167-3336189 CATTACAGAAAGATGGTGGGGGG + Intergenic
1077995483 11:7448947-7448969 CTTCACAGAATGAAGGAGGGTGG + Intronic
1079300620 11:19275857-19275879 CCTCCCAGGAAGAAGCTCGGGGG - Intergenic
1080530719 11:33173195-33173217 CCTCCCAGACAGAAGCTGGGAGG + Intergenic
1080639392 11:34149927-34149949 CTGCACAGGAAGATGGTGTGGGG + Intergenic
1081615919 11:44591189-44591211 CCACACAGGAGGCAGCTGGGTGG - Intronic
1081915204 11:46726283-46726305 CCTTACAGTAACCAGGTGGGGGG + Intronic
1083118909 11:60491718-60491740 CCGTCCAGGAGGAAGGTGGGGGG + Intergenic
1083170858 11:60923502-60923524 CCCCACAGGGAGAAATTGGGAGG - Intergenic
1083523855 11:63342433-63342455 CATCCCTGGAAGAAGGTGGAAGG + Intronic
1083649404 11:64192668-64192690 CCTCACAGGAAGAAGGTGGGCGG - Intronic
1084347592 11:68565634-68565656 CCACCCAGAAAGAAGATGGGTGG - Intronic
1085759102 11:79226485-79226507 CCTCACGGGAAGAATGTGGCTGG + Intronic
1088261458 11:107948072-107948094 CCTCCCAGGAAGATGGTGAAGGG + Intronic
1088432466 11:109773915-109773937 CCTCAGAGGGAGAAGGAGGAAGG - Intergenic
1089706148 11:120279449-120279471 CCACACAGGGAGAAGGGTGGTGG - Intronic
1090939344 11:131373653-131373675 TCTCAGTGGCAGAAGGTGGGCGG - Intronic
1091111204 11:132970128-132970150 CCTCTAAGGTAGAAGGTGAGGGG - Intronic
1091137486 11:133205102-133205124 CCTCCCAGGAAGAAGAGGGTGGG - Intronic
1092526119 12:9311276-9311298 GCTGCCAGGAAGAAGGTGAGTGG + Intergenic
1092541161 12:9420507-9420529 GCTGCCAGGAAGAAGGTGAGTGG - Intergenic
1092750337 12:11713010-11713032 CATCTCAGGTAGCAGGTGGGAGG - Intronic
1093297958 12:17415441-17415463 CCTCACAGGGAGAATGGGCGAGG + Intergenic
1094108838 12:26839631-26839653 GCTAAAAGGAAAAAGGTGGGCGG + Intergenic
1094141963 12:27190589-27190611 CTTCACTGGAAGAAGGTGTTTGG + Intergenic
1094198953 12:27778759-27778781 CATCCCAGGAAGGGGGTGGGGGG - Intergenic
1094360038 12:29620796-29620818 CAGCACAGGAAAAAGGTGGCAGG + Intronic
1094499373 12:31008644-31008666 CCTCCCAGGAGGATGGTGGAGGG - Intergenic
1094511882 12:31101968-31101990 GCTGCCAGGAAGAAGGTGAGTGG + Exonic
1095722634 12:45417409-45417431 TCTTAAAGGAGGAAGGTGGGTGG + Intronic
1096911554 12:54989536-54989558 CCTCACAGCAGGAAGGTGAGTGG - Intergenic
1097689856 12:62724526-62724548 CCTCAGAGGGAGAGGGTAGGTGG - Intronic
1097767340 12:63541504-63541526 CTTCACAGGAATGGGGTGGGTGG + Intergenic
1097783711 12:63736544-63736566 CTTCACAGGAATGGGGTGGGTGG + Intergenic
1097883461 12:64706589-64706611 CATTACAGGAAGAAGGAGAGGGG + Intergenic
1098393009 12:69989392-69989414 CCTCAAGGGAGGAAGGTGGAAGG + Intergenic
1098582926 12:72122052-72122074 ACTCACACCAAGAAGGAGGGAGG + Intronic
1098934955 12:76467950-76467972 CCTCACAGAAAGAAGTTAAGTGG - Intronic
1101436674 12:104670143-104670165 CCTCACAGGGAGAGGGAGGAAGG + Intronic
1102096582 12:110246145-110246167 TCTTACAGGAAGAAGGCAGGAGG - Intergenic
1102176815 12:110882099-110882121 CAGCACAGGGAGAAGGTGTGTGG + Intronic
1102757012 12:115349691-115349713 CCTCACAGGAAGATTTAGGGTGG + Intergenic
1104122382 12:125811756-125811778 CCTTAGAGGAGGAAGGTAGGAGG + Intergenic
1104797859 12:131532143-131532165 GCTCACAGGTAGAAGATGGAGGG - Intergenic
1104908403 12:132227896-132227918 GCTCAGAGCAAGAAGGTGTGGGG - Intronic
1106250943 13:27981067-27981089 CCTAACAAGAAAAAGGTGTGAGG + Intronic
1107438899 13:40406459-40406481 TGGCACAGGAAGAAGGAGGGTGG + Intergenic
1108167662 13:47709955-47709977 CCACAGAGGCAGAGGGTGGGTGG - Intergenic
1109776893 13:67052608-67052630 GCACACAAGAAGAAGGTAGGAGG + Intronic
1111305214 13:86402769-86402791 TCTCACAGGAACAAGGTTTGGGG - Intergenic
1111795192 13:92910495-92910517 CCTCAGAGGAAGACTGAGGGAGG + Intergenic
1112167673 13:96937000-96937022 CCTAACCCGAAGAAAGTGGGAGG - Intergenic
1113486014 13:110652782-110652804 GCCCACAGAGAGAAGGTGGGAGG + Intronic
1113667319 13:112149732-112149754 CCTCACAGGGGGAAGGTGGTGGG - Intergenic
1114405208 14:22450026-22450048 GCTGACGGGAAGAAGGTAGGTGG + Intergenic
1114673523 14:24427347-24427369 CCTCACAGGAAGAAGCCTGCAGG + Exonic
1117073239 14:52075055-52075077 CCTCACAGTGAGAAGATGGCTGG - Intergenic
1117536300 14:56706254-56706276 CCACTGAGGAAGAAGGTGGTGGG + Intronic
1117747467 14:58885183-58885205 CCTCTCATGAAGAATGTGGGAGG - Intergenic
1118084572 14:62399719-62399741 CCTGTCAGGAAGACGGTTGGTGG + Intergenic
1118341049 14:64895404-64895426 CCGCCCAGGAGGGAGGTGGGGGG - Intergenic
1119894378 14:78207307-78207329 GTGCGCAGGAAGAAGGTGGGTGG - Intergenic
1120055854 14:79923467-79923489 CCTTACAGAAAGAAGGTGAGGGG - Intergenic
1121344962 14:93128856-93128878 CCTCACAGTAAGAAGGATGGTGG - Intergenic
1121405611 14:93717648-93717670 CCTCACAGGAAGCAGCCGTGGGG - Intergenic
1125611812 15:40976523-40976545 CCTCAGGGGAAGAAGGAAGGGGG - Intergenic
1125967678 15:43887356-43887378 CCTCACAGGCAAAGGGAGGGTGG + Intronic
1127521487 15:59747094-59747116 TCTCAGAAGAAGAAAGTGGGAGG - Intergenic
1127885330 15:63194079-63194101 CCTAACAGGAAGAAGGGGGCAGG - Intronic
1129032521 15:72629303-72629325 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129407291 15:75328051-75328073 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129470477 15:75750914-75750936 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129734526 15:77952224-77952246 CCTCACAGGCAGAAAGAGGGAGG + Intergenic
1129841064 15:78743767-78743789 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1131881249 15:96864719-96864741 CCTCACAGGAACAGGTGGGGAGG + Intergenic
1132720207 16:1312046-1312068 CCAGACAGGGAGAAAGTGGGGGG - Intronic
1133171465 16:3984900-3984922 ACTCCCAGGAACTAGGTGGGAGG + Intronic
1134400346 16:13904180-13904202 CCCCACGGGTAGAAGGAGGGAGG - Intergenic
1135105366 16:19645137-19645159 CTTAAGAGGAAAAAGGTGGGGGG + Intronic
1136176851 16:28523033-28523055 CCCCAGAGCAGGAAGGTGGGGGG - Intergenic
1136356318 16:29746633-29746655 CCTCCCAGGAGGAACGGGGGAGG - Intergenic
1136403581 16:30030967-30030989 CCCCAAAGGAAGGAGGTGGGCGG + Exonic
1136545119 16:30950151-30950173 CCTCACAGGAAGTGGGATGGAGG + Intronic
1136631288 16:31490567-31490589 CCTCACAGGAAGTGGGGGTGAGG + Exonic
1137244896 16:46694496-46694518 CCGTCCAGGAAGGAGGTGGGGGG - Intronic
1139115377 16:63944924-63944946 CCTCACAAAAAGAAGGTGACTGG + Intergenic
1139673178 16:68505536-68505558 TCTCAGAGGCAGAAGGTGAGGGG + Intergenic
1140690301 16:77477398-77477420 CCTCACATGGTGAAGGTGGAGGG + Intergenic
1141126312 16:81403614-81403636 AGTCACAGGGAGAAGGTGGCCGG - Intergenic
1141434213 16:83990004-83990026 CCTTGCAGGAGGAAGGAGGGAGG + Intronic
1141802451 16:86320041-86320063 GCTCACATGCCGAAGGTGGGAGG - Intergenic
1142198602 16:88750528-88750550 ACTCTCAGGATGAGGGTGGGAGG - Intronic
1142291124 16:89194042-89194064 CCGCAGAGGAAGATGGTGTGCGG + Intronic
1143265720 17:5635663-5635685 CCTTCCAGGAAGGAGGTGTGAGG - Intergenic
1143762665 17:9116312-9116334 CCACACAGCAAGCTGGTGGGTGG - Intronic
1144795695 17:17889596-17889618 CCTCACAGGCAGGAGGTGTTAGG + Intronic
1145001904 17:19311261-19311283 CAGCCCAGGAAGAAGGTGCGTGG + Intronic
1145920121 17:28604137-28604159 CCTTCCAGGAGGGAGGTGGGGGG - Intronic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1146503952 17:33388458-33388480 CCACAGAGAATGAAGGTGGGTGG + Intronic
1146550665 17:33777775-33777797 CCTCCCAGGTAGCAGGTGTGCGG + Intronic
1147970264 17:44215646-44215668 CCGGAGAAGAAGAAGGTGGGGGG - Exonic
1148738308 17:49877554-49877576 ACCCACAGGAAGAGGGTGAGGGG - Intergenic
1149293550 17:55239888-55239910 CCTAACATGGACAAGGTGGGAGG + Intergenic
1150589663 17:66551169-66551191 ACTCACAGGGCTAAGGTGGGAGG - Intronic
1151305854 17:73262298-73262320 CCTCATGGGAAGAAGCGGGGAGG - Intronic
1151787069 17:76280183-76280205 CCTCTAAGGAAGCAGGTAGGGGG + Intronic
1152551243 17:81031412-81031434 GCTGCCAGGCAGAAGGTGGGAGG + Intergenic
1152560067 17:81073396-81073418 GCTCCCAGGAAGAAGGCTGGCGG - Intronic
1157802067 18:50628729-50628751 GCCCACAGGAGGAATGTGGGTGG - Intronic
1158896189 18:61915934-61915956 CCTCTGGGGGAGAAGGTGGGTGG - Intergenic
1159580805 18:70232601-70232623 GCTCACAGGAAGAAAGAGGGGGG + Intergenic
1160343714 18:78111931-78111953 CCTCACGGAAAGAAAGTGTGGGG - Intergenic
1160418916 18:78731062-78731084 CCTCACAGACAGGCGGTGGGAGG - Intergenic
1160680130 19:408574-408596 TCTCTCCGGAAAAAGGTGGGGGG - Intronic
1161368896 19:3898132-3898154 TCTCACAGGAAGTAGATGTGTGG - Intronic
1161453759 19:4360312-4360334 CCCCTCAGGAAGGCGGTGGGTGG + Intergenic
1162940259 19:14005349-14005371 CCTCCCAGAGAGAAGGTGGCAGG + Intronic
1163201112 19:15769846-15769868 CATCTCAGGAACATGGTGGGTGG - Intergenic
1163415000 19:17181024-17181046 ACTCACAGGATGAAGGCGCGGGG - Exonic
1163463506 19:17453432-17453454 GCTGACAGGAAGAAGGAGGCTGG - Intronic
1163945479 19:20530411-20530433 CCGCCCAGGAGGGAGGTGGGGGG - Intergenic
1164066640 19:21721622-21721644 CCGCCCAGGAGGGAGGTGGGGGG + Intergenic
1165441579 19:35831371-35831393 CCTTCCAGGATGAAGGTGTGGGG + Exonic
1165779724 19:38425530-38425552 CCACAGAGGCAGATGGTGGGTGG - Intronic
1166296949 19:41894054-41894076 TCTCACAGGAAGTAGTTGTGGGG + Intronic
1166368208 19:42287750-42287772 CCCCACCAGAAGAAGCTGGGAGG - Intronic
1168411734 19:56144439-56144461 CATCACAGGAAGCAGTTGGAGGG + Intronic
1202712247 1_KI270714v1_random:24990-25012 CCACACAGCTAGAGGGTGGGAGG + Intergenic
925111396 2:1341411-1341433 CCTCACAGAAAGGAGGAGTGGGG + Intronic
926667460 2:15541738-15541760 CTTCACGGGAGGGAGGTGGGGGG + Intronic
927684138 2:25159256-25159278 TCTCAGAGGGAGAAGGTGTGGGG + Intergenic
927750486 2:25665283-25665305 ACTGACAGGGAGATGGTGGGAGG - Intronic
928087117 2:28352835-28352857 CGTCACAGCAGGATGGTGGGGGG + Intergenic
930089599 2:47521856-47521878 CCTCACTGGGCGAGGGTGGGGGG + Intronic
931018050 2:58008975-58008997 ACTCACAGGGAGAAGGTAGAAGG + Intronic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
933189221 2:79314415-79314437 CCTCTCAGGAAGAATATGCGTGG + Intronic
934522737 2:95030197-95030219 CCTCACAGGAAGAGGAAGGCAGG + Intronic
935418856 2:102845986-102846008 CCTCACAGGAAGGTACTGGGAGG - Intergenic
935491010 2:103720238-103720260 CCTCACAGAATGAATGGGGGAGG - Intergenic
935698331 2:105789090-105789112 CCTCAGCTGAGGAAGGTGGGTGG - Intronic
936344625 2:111665888-111665910 CATCACAGAAGGAAGGTGGAAGG - Intergenic
937223855 2:120357059-120357081 CCCCACAGGAAGAGGTGGGGAGG - Intergenic
937341020 2:121090596-121090618 CCTCTGAGGAGGAAGCTGGGTGG + Intergenic
937907841 2:127061038-127061060 CCCCTCAGGAAGGAGGTGGAGGG - Intronic
938613858 2:132977566-132977588 CCTGGTTGGAAGAAGGTGGGAGG - Intronic
939851484 2:147311293-147311315 CCACACAGTGAGAAGGTGAGAGG + Intergenic
940283541 2:152011283-152011305 CCTCAAAGGAAGAAGGTGGAGGG - Intronic
941204955 2:162560474-162560496 CATCAGAGCAAGTAGGTGGGTGG + Intronic
941966930 2:171310077-171310099 TCTCCCAGGAAGGAGGAGGGTGG - Intergenic
942630527 2:177946490-177946512 CGTCCCGGGAAGGAGGTGGGGGG + Intronic
943536789 2:189162091-189162113 CCTCTCAGGCAGTATGTGGGAGG + Intronic
943777450 2:191781895-191781917 GCTCACAGGAAGGAGGTGAAGGG + Intergenic
944300011 2:198112899-198112921 ATTACCAGGAAGAAGGTGGGTGG + Intronic
944598552 2:201283099-201283121 CCGCCCAGGAGGGAGGTGGGGGG - Intronic
945970314 2:216226452-216226474 CCGCCCAGGAGGGAGGTGGGGGG - Intergenic
946979434 2:225192079-225192101 TCTCACAGGTAGCAGGTGGTGGG + Intergenic
947528469 2:230893825-230893847 CCTTACAGCAGGAGGGTGGGAGG + Intergenic
1168970363 20:1926735-1926757 CCTCACAGCCAGGAGGTGGTGGG + Intronic
1169085866 20:2824348-2824370 CCGCCCAGGAGGGAGGTGGGGGG + Intergenic
1171011245 20:21510524-21510546 CCTCACGCTAAGAAAGTGGGTGG - Intergenic
1171041984 20:21773061-21773083 CCATACAGCAAGAAGGTGAGTGG + Intergenic
1171275627 20:23854755-23854777 ACACACAGGGAGAAGTTGGGGGG + Intergenic
1171465038 20:25321402-25321424 CCTTTCAGGAAGCTGGTGGGAGG + Intronic
1173132558 20:40408373-40408395 CCTCAGAGGAAGAACCTGGGTGG - Intergenic
1174392532 20:50226754-50226776 CCTCCTAGGGAGCAGGTGGGTGG + Intergenic
1174581138 20:51572659-51572681 GCTCTCAAGAAGAATGTGGGTGG - Intergenic
1175080854 20:56419181-56419203 CTTAAAAGGAGGAAGGTGGGAGG + Intronic
1175114733 20:56674036-56674058 GCTCTCAGGCAGAGGGTGGGTGG + Intergenic
1175590207 20:60183746-60183768 GCTCTCAGGAGGAAGCTGGGAGG + Intergenic
1176861935 21:14015591-14015613 CCCCACAGGAAGAAGGTCCCTGG + Intergenic
1178084602 21:29100120-29100142 GCTCAGAGGACAAAGGTGGGAGG - Intronic
1178485792 21:33019659-33019681 CCTCACTGGAAAGAGGCGGGCGG + Intergenic
1178528676 21:33356132-33356154 GCTCACAGGAGGAAGACGGGTGG - Exonic
1178749038 21:35283248-35283270 CCTGACAGGAAGCAGGTCTGTGG - Intronic
1179043765 21:37827972-37827994 CCTCACAGCTAGGAGGTGGCTGG + Intronic
1179398020 21:41059158-41059180 CCTTATAGGAAGAAAGTAGGAGG - Intergenic
1179883992 21:44305721-44305743 GCTCTCGGGAAGAAGGTGTGGGG + Intronic
1180836772 22:18933829-18933851 CCTCACCTGAAGAAGATGTGGGG - Intronic
1182153704 22:28049409-28049431 CCTCACAGGAAGAAAGTTTAAGG - Intronic
1182373830 22:29831593-29831615 GCTCACTTGAACAAGGTGGGAGG - Intronic
1183351523 22:37337287-37337309 TCTCACAGAAAGCAGGCGGGTGG - Intergenic
1183361990 22:37387633-37387655 CAGCCCAGGAAGAAGGTGGCAGG - Intronic
1183505603 22:38207065-38207087 CCACACAGGGAGGAGGTGTGTGG + Intronic
1183871575 22:40745238-40745260 CCGCCCAGGAGGGAGGTGGGGGG - Intergenic
1184249839 22:43253771-43253793 CTTCCCAGGAAGAGGATGGGTGG - Intronic
1184571027 22:45325091-45325113 CGTCATAGGAAGAAGAAGGGAGG + Intronic
1203286865 22_KI270734v1_random:159128-159150 CCTCACCTGAAGAAGATGTGGGG - Intergenic
950240485 3:11365683-11365705 CCTAGCTGGCAGAAGGTGGGTGG - Intronic
950575797 3:13831456-13831478 CCGAACAGAAGGAAGGTGGGTGG + Intronic
950683593 3:14601840-14601862 GCAGACTGGAAGAAGGTGGGAGG + Intergenic
952274798 3:31866690-31866712 CCTCACAGCTAGAAGGGGTGAGG + Intronic
953883477 3:46703143-46703165 CCACACAGGGCTAAGGTGGGTGG - Intronic
954053319 3:48000950-48000972 CCTCACAGCATGTAAGTGGGAGG - Intronic
954107010 3:48414882-48414904 CCTCATAGGAGAAAGGTGTGGGG + Exonic
954281266 3:49580187-49580209 ACTCAGGGGAATAAGGTGGGAGG - Intronic
954481275 3:50803795-50803817 CCTTCCAGGAGGGAGGTGGGGGG - Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954647182 3:52138730-52138752 CCACACAGGAAGGACGTGTGTGG + Intronic
955160271 3:56458673-56458695 CCTGACAGGAAGCAGGAGGTTGG - Intronic
955631511 3:60980496-60980518 TCCCACAGTAAGTAGGTGGGAGG - Intronic
955750470 3:62181220-62181242 CCACATCGGAAGAAGGTGGCGGG + Intronic
956462330 3:69484983-69485005 CCTCCTGGGCAGAAGGTGGGGGG - Intronic
956899339 3:73698090-73698112 CCTAACAGGTATAAGGTGTGAGG - Intergenic
958863590 3:99473217-99473239 CCACACAGGAATAATGAGGGTGG + Intergenic
959393066 3:105800681-105800703 GCTCACAGGAAGTGGGTGGGGGG - Intronic
959919026 3:111850288-111850310 ACTCAAAGGGAGAAGGTGAGGGG + Intronic
961045809 3:123707190-123707212 CCTCACTGGTTGTAGGTGGGAGG - Intronic
961190950 3:124960998-124961020 CCTGAAAGGAAGCAGGTGTGAGG - Intergenic
963113785 3:141708486-141708508 GCTCACAGGAGGAAGGTGCCTGG + Intergenic
963466388 3:145687429-145687451 CCTGACAGGAAGTAGATGGCAGG + Intergenic
964389774 3:156185048-156185070 CCACACAGAAAGAAAGTGGTGGG + Intronic
964879791 3:161410710-161410732 CCTCAGAGGGAGAGAGTGGGAGG + Intergenic
965478104 3:169183312-169183334 TCTCACAGGAGAAAGGTGGAAGG - Intronic
965560573 3:170058318-170058340 TCCCACAGGAAGTGGGTGGGTGG + Intronic
966723250 3:183085702-183085724 TCTTACAGGAAGAAAGTGGTAGG - Intronic
967147517 3:186618538-186618560 CCACATAGGTAGAAGGTGGGAGG - Exonic
967799366 3:193639119-193639141 GGTCACAGGAAGAAGGTATGGGG + Intronic
968022922 3:195410890-195410912 CCTCAATGGCAGAAGGTGGAAGG - Intronic
968434522 4:577507-577529 CCTCTCAGGAAGAGGCTGGAGGG - Intergenic
968927842 4:3559209-3559231 CCTCACCAGAAGAAGGGGGAGGG + Intergenic
969541201 4:7789810-7789832 CCCCTCAGGAAGCAGTTGGGAGG - Intronic
970124076 4:12789786-12789808 CCACACATCAAGAAGGTGGCTGG - Intergenic
971300205 4:25435519-25435541 TCTCACAGGAAGTAGGAGAGAGG - Intergenic
971824250 4:31600037-31600059 CCTAACAAGAAAAAGGTGAGAGG - Intergenic
973851142 4:54962896-54962918 TCAGAAAGGAAGAAGGTGGGAGG + Intergenic
974789361 4:66667147-66667169 CAGCACAGGAAGTAGATGGGAGG - Intergenic
975898002 4:79117891-79117913 CCACACAGGACCAAAGTGGGTGG + Intergenic
976505848 4:85846325-85846347 CCTCACAGAAAGCAGATTGGGGG - Intronic
976772975 4:88674230-88674252 GGTTACAGGAAGAGGGTGGGGGG + Intronic
981595808 4:146420522-146420544 CCTGAGAGGAAGAAAGTGGATGG + Intronic
981645741 4:146996725-146996747 CCTTACAGAAAGAAACTGGGTGG - Intergenic
982643268 4:157989286-157989308 CCTCACAGGAAGAAGGCTGGAGG + Intergenic
983903677 4:173163401-173163423 CCTCACTGGCAGGCGGTGGGAGG - Intergenic
985405137 4:189630503-189630525 CCCCACAGGAGCAAGGAGGGCGG + Intergenic
985653001 5:1115714-1115736 CCTGCCAGGCAGAAGGCGGGTGG - Intergenic
985674108 5:1221513-1221535 CATCCCAGGAGGGAGGTGGGTGG + Intronic
985848071 5:2368555-2368577 CCCCTGAGGAACAAGGTGGGCGG + Intergenic
985875801 5:2592958-2592980 CCTCACAGGAATACGGCGGAGGG - Intergenic
985887263 5:2689147-2689169 CAGCACAGGAAGGAGGTGGCTGG + Intergenic
986010849 5:3713892-3713914 TCTCACAAGAAGCTGGTGGGAGG + Intergenic
987150882 5:15038537-15038559 CCTCATAAGAGGAAGGTAGGAGG - Intergenic
988000882 5:25346562-25346584 CATGACAGGAAGAAGGATGGAGG + Intergenic
988909678 5:35826726-35826748 CCTCACAGGATGATGGAGTGAGG - Intergenic
991257354 5:64629745-64629767 CCTGACAGGAGGGAGGAGGGAGG + Intergenic
991653903 5:68883667-68883689 TCTTTCAGGGAGAAGGTGGGAGG - Intergenic
992426370 5:76662158-76662180 CCTCACAGGGAGAAGGAAGAGGG + Intronic
992462342 5:76972884-76972906 TATCACAGAAAGAATGTGGGTGG + Intronic
992739972 5:79763828-79763850 CTCCACAGCAAGGAGGTGGGAGG - Intronic
993364618 5:87020332-87020354 CATCACAGGACGGAAGTGGGAGG - Intergenic
994195544 5:96918882-96918904 CCTTAAAAGAAGGAGGTGGGGGG - Exonic
995942219 5:117599661-117599683 CCGTCCAGGAAGGAGGTGGGGGG - Intergenic
997603593 5:135156953-135156975 CGCCCCAGGAAGAAGGTGGAGGG + Intronic
997660536 5:135586196-135586218 CCTCCCAGGAGGAGGGTGGGGGG + Intergenic
999331202 5:150674517-150674539 CCTCACAGGAACAGGCTGGGTGG - Intronic
1000758949 5:165197162-165197184 CCACACAGGAAGAATGCGGAGGG - Intergenic
1001758720 5:174190321-174190343 GCTCTCAGGAAGCTGGTGGGGGG + Intronic
1001763590 5:174227081-174227103 CCTCACAGAGGGAAGTTGGGAGG - Intronic
1004058966 6:12171732-12171754 CCTCACAGCAAGAAGCTAGTGGG + Intergenic
1004457147 6:15801650-15801672 CCTTTCAGGATGAAGGTGGGGGG + Intergenic
1008926469 6:56894860-56894882 CCGCCCAGGAGGGAGGTGGGGGG - Intronic
1009675180 6:66810733-66810755 CCTATCAGGAAGAAGGAGAGTGG - Intergenic
1010891640 6:81319878-81319900 CCTCACTGGAAGAAAGTAGAAGG - Intergenic
1012391367 6:98744475-98744497 CCTAACAGTCAGAAGGTGGCTGG - Intergenic
1013349988 6:109296972-109296994 ACGCACAGGAAGAAGGAGTGTGG + Intergenic
1014079750 6:117272354-117272376 CCTACAGGGAAGAAGGTGGGCGG - Intronic
1014764038 6:125388849-125388871 CCGCCCAGGAGGGAGGTGGGGGG - Intergenic
1015969972 6:138734008-138734030 CTTCACAGGTACAAGATGGGTGG - Intergenic
1016133452 6:140507169-140507191 CCTTACAGGATCAAGGTGGGAGG - Intergenic
1017719871 6:157236605-157236627 CCCCACGGAAAGAAGGTGAGGGG - Intergenic
1018073754 6:160191206-160191228 CTTCACAGGGAGTGGGTGGGAGG - Intronic
1018427199 6:163694219-163694241 CCTCACAGGGAGGAGGTGGCTGG + Intergenic
1019328327 7:450653-450675 TCTCAGAGCAGGAAGGTGGGAGG - Intergenic
1020284798 7:6671357-6671379 CCGCCCAGGAGGGAGGTGGGGGG - Intergenic
1020567254 7:9813103-9813125 ACTCAAAGGAAGATGGTGGGTGG + Intergenic
1021385713 7:20027512-20027534 CCTCAAAGGAAGGAAGTGAGTGG - Intergenic
1024538956 7:50460343-50460365 CCGTCCAGGAAGGAGGTGGGAGG + Intronic
1024969331 7:55054148-55054170 CCTTCCAGAAAGAAGGCGGGTGG - Intronic
1027375907 7:77549308-77549330 CATCTCTGAAAGAAGGTGGGTGG - Intronic
1028794114 7:94885003-94885025 CCTAAAAGGAAGAAGCTGGCCGG - Intergenic
1029413280 7:100428694-100428716 CCTCATTGGCAGAAGCTGGGGGG + Intronic
1029973191 7:104809435-104809457 CCTCAAAGGCAGAACGTGGATGG - Intronic
1030968599 7:116025355-116025377 CCTCAAAGGAAAAAGGAGAGAGG + Intronic
1032061096 7:128726019-128726041 CCACAAAGGAAGAAGCTTGGTGG + Intronic
1032546032 7:132743483-132743505 CCTTAGAGTAAGAAGGTGGCAGG + Intergenic
1033322139 7:140349525-140349547 CATCAAAGGAAAAAGGGGGGGGG + Intronic
1034895780 7:154875579-154875601 CCCCGCAGGGAGAAGGTGGGAGG + Intronic
1035289438 7:157828163-157828185 ACTCAGAGGAAGATGGTGGGAGG + Intronic
1036383315 8:8254448-8254470 CCGCCCAGGAAGAAGATGGAAGG - Intergenic
1037617648 8:20533974-20533996 CCTAAAGGGAAGGAGGTGGGAGG + Intergenic
1038439909 8:27564529-27564551 TCTCACAGGTAAAAGATGGGAGG - Intergenic
1038580899 8:28748506-28748528 CCAGAAAGGAAGCAGGTGGGAGG + Intronic
1039790832 8:40874349-40874371 GCTCACCTGAAGATGGTGGGTGG + Intronic
1039908715 8:41807474-41807496 ATTCACAGGAAGAAGGTGAAAGG - Intronic
1040797222 8:51299572-51299594 GCTCATAGGCAGAAGGTGAGAGG - Intergenic
1041259333 8:56006583-56006605 CCTCACCAGAAGGAGGTGGTGGG - Intronic
1041862413 8:62529572-62529594 GCTTACAGTGAGAAGGTGGGAGG + Intronic
1046945986 8:119974768-119974790 CCTCAAAAAAAAAAGGTGGGGGG + Intronic
1047031150 8:120882499-120882521 CCTCTCAGGAAGAAGGTGTTTGG - Intergenic
1047927774 8:129697964-129697986 CCTCACTGGAAGAAGCTGCTTGG + Intergenic
1048210941 8:132453621-132453643 GCTCACAGGAAGAGAGTTGGAGG - Intronic
1048581766 8:135734841-135734863 CTAGACAGGAAAAAGGTGGGGGG - Intergenic
1049302732 8:141880260-141880282 CCTCCCTGGAAGGGGGTGGGAGG - Intergenic
1049314762 8:141958606-141958628 CCGCACAGGAGGAAGGCGGAAGG - Intergenic
1049632431 8:143665798-143665820 AGGGACAGGAAGAAGGTGGGTGG + Intergenic
1050353700 9:4763467-4763489 CCTCCTAGGAGGAAGGCGGGGGG + Intergenic
1051249720 9:15147104-15147126 TCTAACAGAAAGGAGGTGGGGGG + Intergenic
1053423632 9:37997031-37997053 GCTGACAGGCAGGAGGTGGGTGG + Intronic
1053802693 9:41774290-41774312 CCTCACCAGAAGAAGGGGGAGGG + Intergenic
1054190999 9:61985636-61985658 CCTCACCAGAAGAAGGGGGAGGG + Intergenic
1054462292 9:65471930-65471952 CCTCACCAGAAGAAGGGGGAGGG - Intergenic
1054647370 9:67602081-67602103 CCTCACCAGAAGAAGGGGGAGGG - Intergenic
1055393189 9:75845444-75845466 CCACACAGGATGAAGGGGGCAGG + Intergenic
1055736574 9:79336876-79336898 CCTCACAGGCCTAGGGTGGGAGG - Intergenic
1056548906 9:87635487-87635509 CTTCCCAGGAAGAAGGTGAGGGG - Intronic
1056756490 9:89385174-89385196 CCTCAAAGGCAGAAGGGGGTAGG - Intronic
1057231797 9:93325688-93325710 CCTCGCAGGAAGGAGCTGGGAGG + Intronic
1057263133 9:93597437-93597459 CCTGACAGAGAGCAGGTGGGAGG - Intronic
1057472294 9:95368567-95368589 CCTCACTAGAGGGAGGTGGGCGG + Intergenic
1057811734 9:98262659-98262681 TCTCACAGGAAAAAGTTGGAAGG + Intergenic
1057818630 9:98314596-98314618 CCTCACCGGGAGCAGGAGGGAGG - Intronic
1058538686 9:105990041-105990063 CCTGAAAGGAAGGAGGTGAGGGG - Intergenic
1060216403 9:121741099-121741121 CATCAGAGGAAACAGGTGGGTGG - Intronic
1060661324 9:125406906-125406928 GCTCACACGAAGCAGGTGAGTGG - Intergenic
1061559102 9:131391391-131391413 CCTCACAAGAGGAAGGAAGGAGG - Intergenic
1061758442 9:132832870-132832892 TCTAAAAGGAAGAAGGTGGGGGG + Intronic
1061883457 9:133579206-133579228 TCCTGCAGGAAGAAGGTGGGGGG + Exonic
1062215905 9:135389771-135389793 GCTCATATGAAGAAGGAGGGGGG + Intergenic
1187950585 X:24466209-24466231 CCGGACAGGGAGAATGTGGGTGG - Intronic
1188984676 X:36758574-36758596 CCTGACAGAAAGAGTGTGGGTGG - Intergenic
1189308248 X:40003393-40003415 GTTCTCAGGAAGAAGGTGTGTGG - Intergenic
1189438959 X:41017480-41017502 AATCAAAGGAAGAATGTGGGAGG - Intergenic
1190914877 X:54803936-54803958 GTTCACAAGGAGAAGGTGGGAGG + Intergenic
1191068911 X:56380153-56380175 CCACCCAGGAGGGAGGTGGGGGG - Intergenic
1191669443 X:63735428-63735450 CACCACAGGCAGAGGGTGGGTGG + Intronic
1192749529 X:73974777-73974799 TTTCACAGTAAGTAGGTGGGTGG + Intergenic
1193898481 X:87144961-87144983 CCAGACAGCAAGAAAGTGGGTGG - Intergenic
1194714602 X:97275327-97275349 CCACCCAGGAGGGAGGTGGGCGG - Intronic
1194714624 X:97275375-97275397 CCACCCAGGAGGGAGGTGGGGGG - Intronic
1195015786 X:100779122-100779144 CCTCACAGAATGAATTTGGGAGG + Intergenic
1195232443 X:102863955-102863977 CATCACAGTAGGAAAGTGGGAGG + Intergenic
1196991651 X:121335817-121335839 CCTCAGAGGAAGGAGGAAGGTGG - Intergenic
1200334638 X:155336651-155336673 TCTCACATGATGAAAGTGGGAGG + Intergenic
1201616828 Y:15909685-15909707 CCTCAGAGGAAGCAGGTGAATGG + Intergenic