ID: 1083652550

View in Genome Browser
Species Human (GRCh38)
Location 11:64211630-64211652
Sequence TCTGCCGCGGCCCAGGTGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 157}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083652533_1083652550 24 Left 1083652533 11:64211583-64211605 CCCCTCCCCACCCCACGGCCGTA 0: 1
1: 0
2: 0
3: 57
4: 779
Right 1083652550 11:64211630-64211652 TCTGCCGCGGCCCAGGTGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 157
1083652532_1083652550 25 Left 1083652532 11:64211582-64211604 CCCCCTCCCCACCCCACGGCCGT 0: 1
1: 0
2: 7
3: 124
4: 1357
Right 1083652550 11:64211630-64211652 TCTGCCGCGGCCCAGGTGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 157
1083652546_1083652550 -10 Left 1083652546 11:64211617-64211639 CCTGACTGCTGCTTCTGCCGCGG 0: 1
1: 0
2: 0
3: 11
4: 154
Right 1083652550 11:64211630-64211652 TCTGCCGCGGCCCAGGTGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 157
1083652529_1083652550 30 Left 1083652529 11:64211577-64211599 CCAGCCCCCCTCCCCACCCCACG 0: 1
1: 6
2: 82
3: 660
4: 5029
Right 1083652550 11:64211630-64211652 TCTGCCGCGGCCCAGGTGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 157
1083652545_1083652550 -9 Left 1083652545 11:64211616-64211638 CCCTGACTGCTGCTTCTGCCGCG 0: 1
1: 0
2: 0
3: 12
4: 197
Right 1083652550 11:64211630-64211652 TCTGCCGCGGCCCAGGTGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 157
1083652539_1083652550 17 Left 1083652539 11:64211590-64211612 CCACCCCACGGCCGTACCTGGCG 0: 1
1: 1
2: 0
3: 5
4: 106
Right 1083652550 11:64211630-64211652 TCTGCCGCGGCCCAGGTGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 157
1083652534_1083652550 23 Left 1083652534 11:64211584-64211606 CCCTCCCCACCCCACGGCCGTAC 0: 1
1: 0
2: 2
3: 30
4: 381
Right 1083652550 11:64211630-64211652 TCTGCCGCGGCCCAGGTGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 157
1083652540_1083652550 14 Left 1083652540 11:64211593-64211615 CCCCACGGCCGTACCTGGCGCAG 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1083652550 11:64211630-64211652 TCTGCCGCGGCCCAGGTGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 157
1083652538_1083652550 18 Left 1083652538 11:64211589-64211611 CCCACCCCACGGCCGTACCTGGC 0: 1
1: 0
2: 1
3: 12
4: 188
Right 1083652550 11:64211630-64211652 TCTGCCGCGGCCCAGGTGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 157
1083652543_1083652550 6 Left 1083652543 11:64211601-64211623 CCGTACCTGGCGCAGCCCTGACT 0: 1
1: 0
2: 0
3: 14
4: 233
Right 1083652550 11:64211630-64211652 TCTGCCGCGGCCCAGGTGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 157
1083652536_1083652550 19 Left 1083652536 11:64211588-64211610 CCCCACCCCACGGCCGTACCTGG 0: 1
1: 0
2: 1
3: 43
4: 922
Right 1083652550 11:64211630-64211652 TCTGCCGCGGCCCAGGTGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 157
1083652535_1083652550 22 Left 1083652535 11:64211585-64211607 CCTCCCCACCCCACGGCCGTACC 0: 1
1: 0
2: 5
3: 40
4: 647
Right 1083652550 11:64211630-64211652 TCTGCCGCGGCCCAGGTGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 157
1083652544_1083652550 1 Left 1083652544 11:64211606-64211628 CCTGGCGCAGCCCTGACTGCTGC 0: 1
1: 0
2: 3
3: 46
4: 355
Right 1083652550 11:64211630-64211652 TCTGCCGCGGCCCAGGTGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 157
1083652541_1083652550 13 Left 1083652541 11:64211594-64211616 CCCACGGCCGTACCTGGCGCAGC 0: 1
1: 0
2: 0
3: 3
4: 51
Right 1083652550 11:64211630-64211652 TCTGCCGCGGCCCAGGTGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 157
1083652531_1083652550 26 Left 1083652531 11:64211581-64211603 CCCCCCTCCCCACCCCACGGCCG 0: 1
1: 0
2: 18
3: 267
4: 2554
Right 1083652550 11:64211630-64211652 TCTGCCGCGGCCCAGGTGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 157
1083652542_1083652550 12 Left 1083652542 11:64211595-64211617 CCACGGCCGTACCTGGCGCAGCC 0: 1
1: 0
2: 1
3: 11
4: 99
Right 1083652550 11:64211630-64211652 TCTGCCGCGGCCCAGGTGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083652550 Original CRISPR TCTGCCGCGGCCCAGGTGGC TGG Exonic