ID: 1083652672

View in Genome Browser
Species Human (GRCh38)
Location 11:64212194-64212216
Sequence AAGAGTGAACAGGGCACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 387}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083652672_1083652676 -5 Left 1083652672 11:64212194-64212216 CCCTCTGTGCCCTGTTCACTCTT 0: 1
1: 0
2: 1
3: 32
4: 387
Right 1083652676 11:64212212-64212234 CTCTTCCTCCCTTCCTCCATTGG 0: 1
1: 0
2: 6
3: 67
4: 562
1083652672_1083652682 13 Left 1083652672 11:64212194-64212216 CCCTCTGTGCCCTGTTCACTCTT 0: 1
1: 0
2: 1
3: 32
4: 387
Right 1083652682 11:64212230-64212252 ATTGGCAACCAACATGCTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083652672 Original CRISPR AAGAGTGAACAGGGCACAGA GGG (reversed) Intronic
901105093 1:6749119-6749141 AAGAGAGAAAAGGGCAGAGAGGG - Intergenic
901372987 1:8816929-8816951 AAGAGAGAGCAGGGGTCAGAAGG + Intronic
901663910 1:10815829-10815851 AAGTGGGCACTGGGCACAGAGGG - Intergenic
902933897 1:19750641-19750663 GAGAGGGATCAGGACACAGAGGG - Intronic
903050128 1:20594459-20594481 GAGAGTGGAGATGGCACAGAAGG + Intronic
904013966 1:27406309-27406331 AAGAGGGAAGAGGGCACACTTGG + Exonic
904019135 1:27448965-27448987 AAGAGAGAACATGGTACAGTGGG - Intronic
904340370 1:29830240-29830262 ATGAGGGGACTGGGCACAGAGGG + Intergenic
904455854 1:30647668-30647690 ATGAGGGGACTGGGCACAGAGGG - Intergenic
906124320 1:43417786-43417808 AAGATTTATCAGGGTACAGATGG + Intronic
906612468 1:47212915-47212937 GAGAGAGGCCAGGGCACAGAAGG - Intergenic
906982131 1:50642806-50642828 AAAAGGGAACAGAGAACAGATGG - Intronic
907435164 1:54441023-54441045 AAAAGTGAACAAGGGAGAGAAGG - Intergenic
907625634 1:56026644-56026666 AATAGTGAATAGTGCACAGTAGG + Intergenic
907716337 1:56929745-56929767 AAGAGTGTTCTGGGCACAGGGGG - Intronic
908392364 1:63695372-63695394 AAGAGTGTACAAGGCACTCATGG - Intergenic
910327118 1:86022572-86022594 CAGGGTGAACAAGGCACAGCAGG - Exonic
910457220 1:87410932-87410954 AAGAATGAACTGGGCCCAGCTGG + Intergenic
911810258 1:102267440-102267462 AATGGTGAACAGGGCAGATAAGG - Intergenic
911956209 1:104238300-104238322 AAGAGTGAACAAGCCAGAGAGGG + Intergenic
915740100 1:158112795-158112817 AACATTGAAGAGGGCAGAGAGGG - Intergenic
916246208 1:162690811-162690833 AAGAATGCCCAGGGCTCAGAGGG - Intronic
916291828 1:163175288-163175310 CAGAGGGAAGAGGGCCCAGAGGG + Intronic
916862473 1:168820990-168821012 AAGAAAGAAAAGGGCAAAGAAGG + Intergenic
920259760 1:204680862-204680884 AAGAGTCAACCAGGCAGAGATGG - Intronic
920682660 1:208084604-208084626 CAGCATGAACAGGGGACAGATGG - Intronic
921100485 1:211924495-211924517 CAGTTTGGACAGGGCACAGAGGG + Intergenic
921173125 1:212566564-212566586 AACTGTGACCAGGGCATAGAGGG + Intronic
921961125 1:221035369-221035391 AAGTGTGAGCAGAGCACTGAGGG - Intergenic
922788210 1:228294181-228294203 AGGAATGAAGAGGCCACAGAAGG + Exonic
922789778 1:228305152-228305174 AGGAATGAAGAGGCCACAGAAGG + Exonic
922974498 1:229772512-229772534 TAGAATGAAAAGGGCACAGTCGG - Intergenic
923610670 1:235490036-235490058 ATGACTGAGCAGGCCACAGAAGG - Intronic
923860820 1:237890345-237890367 AAGATGCAACAGGGCTCAGAAGG + Intronic
1062920287 10:1274002-1274024 CAGAGGGGACAGGGCACTGAAGG + Intronic
1064075105 10:12262525-12262547 AAGAGTGAAAAAAACACAGAAGG + Intergenic
1064960896 10:20964092-20964114 AAAAGAGAACAGAGGACAGAGGG + Intronic
1065862167 10:29881112-29881134 AGGAGTGGACAGGAGACAGATGG + Intergenic
1066086971 10:31980521-31980543 AAGAGTGATGAAGGCAAAGAAGG - Intergenic
1067289937 10:44933190-44933212 CTGGGTGAACAGGGCACAGCTGG + Intronic
1067346073 10:45440050-45440072 AAGAGGGAGCAGGGCAAGGAGGG + Intronic
1067546344 10:47195124-47195146 AGAAGTGATTAGGGCACAGATGG + Intergenic
1068617260 10:59132808-59132830 CAGGGAGAACAGGGCACAGAGGG + Intergenic
1069020757 10:63485857-63485879 AAAAGTGAACAGGACATATATGG + Intergenic
1069656640 10:70094658-70094680 AACAGTGAACAGGCCAGAGAGGG - Intronic
1069877597 10:71572641-71572663 GAGAGTGAACTGGGAACAAATGG - Intronic
1070851162 10:79562559-79562581 GAGAGTGAGAAGGGCACTGAAGG - Intergenic
1072196667 10:93121971-93121993 AAGAGGGAAGAGTACACAGAGGG - Intergenic
1072302885 10:94078771-94078793 AAGAATGAGCAGGCCACACATGG - Intronic
1072613609 10:97035259-97035281 TGGACTAAACAGGGCACAGATGG - Intronic
1072704374 10:97669786-97669808 AAGAGTGAAGAGGCCCCACAGGG + Intronic
1072736335 10:97881969-97881991 CAGTGTGATCAGGGCCCAGATGG - Intronic
1072764510 10:98084597-98084619 AAGTGTGAAGAAGCCACAGAAGG + Intergenic
1073222622 10:101888615-101888637 AAGGAAGAACAGGGCACATATGG + Intronic
1074383335 10:112997616-112997638 AAGAGTGACCAGGGACCTGAGGG + Intronic
1074453297 10:113576692-113576714 ATAAGTGAAGAGGGCACCGAGGG - Intronic
1075574130 10:123566324-123566346 AGGAGTGTGCAGGGCATAGAAGG - Intergenic
1075874250 10:125793390-125793412 GAGAGGCAGCAGGGCACAGAGGG + Intronic
1077032334 11:474187-474209 AAGAGTGAAAGGGCCAGAGAAGG - Intronic
1077088600 11:767380-767402 AAGAGAGAACTGTGCACAGCGGG + Exonic
1078404988 11:11062764-11062786 AAGAGTGCAGAGAGCAGAGAGGG - Intergenic
1078522739 11:12076375-12076397 ATGAGTGAACATGGTACACAGGG + Intergenic
1080783915 11:35457317-35457339 AAGAGTGCTGAGGGCAGAGATGG - Intronic
1081179587 11:39969327-39969349 ATGAGATAACAGGGAACAGAAGG + Intergenic
1081607904 11:44538606-44538628 AGCAGTGAGCAGGGCCCAGACGG + Intergenic
1082697815 11:56391635-56391657 AAAAGTGTTCTGGGCACAGAAGG + Intergenic
1083652672 11:64212194-64212216 AAGAGTGAACAGGGCACAGAGGG - Intronic
1084464217 11:69312944-69312966 CACAGTGACCAGGGCACAGAAGG - Intronic
1084625981 11:70307525-70307547 AAGAGTGAACAGGGCTGAAAGGG + Intronic
1085885539 11:80517606-80517628 AAGAGTGTGGAGGGCTCAGAAGG + Intergenic
1085941508 11:81211170-81211192 AAGAGTGAAAAGAGTACAAATGG - Intergenic
1085956384 11:81401375-81401397 AAAGGTGAATAAGGCACAGAAGG - Intergenic
1086058979 11:82681212-82681234 AAGAGTGAAGAGGGGAGAGTAGG + Intergenic
1087859197 11:103132854-103132876 AGGAGTCAACAGGGCCCAGTAGG - Intronic
1088299723 11:108344181-108344203 AAGTCTGTACAGGGCACACAGGG + Intronic
1088456781 11:110041242-110041264 GAGAGTGATGAGGGCTCAGAGGG + Intergenic
1088467566 11:110157778-110157800 AAGTGTGAGCTGGGTACAGATGG - Intronic
1088526084 11:110756570-110756592 AACAGTGAACAGGACAAATATGG - Intergenic
1089261852 11:117229173-117229195 TACAGTGCTCAGGGCACAGATGG - Intronic
1091094080 11:132802188-132802210 AAGAGTTAAGAGGGTAGAGATGG - Intronic
1092105512 12:5919281-5919303 AAGAGTGCCCAAAGCACAGAGGG + Intronic
1092295715 12:7198621-7198643 AGGAGTGAAGGGAGCACAGAAGG - Intronic
1093881081 12:24405408-24405430 AAGGGAAAACAGGGCACTGAGGG + Intergenic
1094488513 12:30943825-30943847 AAGAGGGAAACGGGCACAGAAGG + Intronic
1094711306 12:32965587-32965609 AAGACTCCACAGTGCACAGAAGG - Intergenic
1094835177 12:34318893-34318915 AAGAGGCAAGAGGGCCCAGAAGG - Intergenic
1095593880 12:43937236-43937258 AAGAGTGAAAAGGGCTTAGTGGG + Intronic
1095809214 12:46354263-46354285 AAGAGGGGACAGGCCATAGATGG + Intergenic
1096057076 12:48662617-48662639 AAGAGTTAACAGGTCACCAATGG + Intronic
1096059748 12:48686670-48686692 AAGAGTGAAGGAGGCCCAGACGG + Intergenic
1096850034 12:54429340-54429362 AAGACTGCACAGGGGCCAGATGG + Intergenic
1097307444 12:58085176-58085198 AAATTTGAACAGAGCACAGAGGG - Intergenic
1098868635 12:75790183-75790205 AGGAGAGAGCATGGCACAGAGGG - Intergenic
1101094857 12:101327656-101327678 CAGAGTGTCCAGGGCACAGGAGG - Intronic
1101184481 12:102260079-102260101 AAATGTTAAAAGGGCACAGAAGG - Intergenic
1102152348 12:110697463-110697485 TAGGGTGAACAGCGCAGAGAGGG + Intronic
1102462153 12:113106492-113106514 AAGAGTGAACTGGGGGCAGTGGG - Intronic
1102955527 12:117056206-117056228 AAGAATTAGCAGGGCACAGTGGG - Intronic
1103202422 12:119098928-119098950 AAGGGAGAAAAGGGCAGAGATGG - Intronic
1104596315 12:130122470-130122492 AAGTGTGGACGGGGCGCAGAAGG + Intergenic
1104693580 12:130846382-130846404 ATGAATGAACAGGGCAAGGAAGG + Intergenic
1105834892 13:24201322-24201344 AACAGTGAACAGGGGAGAGGGGG - Intronic
1106256113 13:28023226-28023248 AACAGTGAACAGGGGAGAAAAGG + Intronic
1106415784 13:29544796-29544818 AATACAGAAGAGGGCACAGATGG + Intronic
1107104532 13:36629115-36629137 AAGAGAGAAAAGGGCACATGTGG + Intergenic
1107132958 13:36916025-36916047 TAGAATGACCAAGGCACAGAAGG + Intronic
1108250981 13:48567681-48567703 GAGAGGGAACAGAGCAGAGAGGG + Intergenic
1109595220 13:64544072-64544094 AAAAGTAAAGAGGGGACAGAAGG + Intergenic
1109715994 13:66223077-66223099 AATAGGTAACAGGGTACAGATGG - Intergenic
1110739328 13:78976342-78976364 AAGAGAGAAGAGGGAGCAGAAGG + Intergenic
1112717515 13:102203903-102203925 TTAAGTGAACAGTGCACAGAAGG - Intronic
1114419674 14:22570873-22570895 AAGGGTGAACTGGGCCCAAAGGG - Intronic
1114512355 14:23273025-23273047 AAGGGTGAATAGGGTAAAGATGG - Exonic
1114517484 14:23309134-23309156 AAGAGTGAGCAGGACACAGAGGG + Exonic
1114651989 14:24291077-24291099 AGGAGTGGGCAGGGAACAGAGGG + Intronic
1117659969 14:57993165-57993187 GAGAGTGAAAGGGGCACAGCTGG - Intergenic
1117785554 14:59280955-59280977 AATAGGAAACAGGGAACAGAGGG - Intronic
1117980759 14:61340132-61340154 AAAAATGAACAGGGCAGGGAAGG - Intronic
1119321173 14:73731386-73731408 AAGGGAAAAGAGGGCACAGATGG - Intronic
1119411218 14:74431961-74431983 AAGAGTGAACAGGTGAGGGAGGG + Intergenic
1120690173 14:87583597-87583619 AAGAATAAACAGACCACAGAAGG + Intergenic
1121782158 14:96628895-96628917 AACAGAGGACAGGTCACAGAGGG + Intergenic
1122225584 14:100276000-100276022 AAGAGAGAAGAGGGAACAGTAGG + Intronic
1122253433 14:100458000-100458022 AAGAGGGAACAAGGAACAGATGG + Intronic
1123587521 15:21772872-21772894 AAGAGGGGAAAGGGGACAGAGGG + Intergenic
1123624159 15:22215437-22215459 AAGAGGGGAAAGGGGACAGAGGG + Intergenic
1123852034 15:24367794-24367816 AATAGTTCACAGAGCACAGAGGG - Intergenic
1124514056 15:30351075-30351097 AAGGTTGACCAGGGCACAGGGGG + Intergenic
1124728864 15:32179689-32179711 AAGGTTGACCAGGGCACAGGGGG - Intergenic
1125034075 15:35103708-35103730 AAGAGTGAACAAGACAGACAAGG + Intergenic
1125422758 15:39521087-39521109 AAGAGTGAACAGGCCAAGGTGGG - Intergenic
1125486126 15:40112085-40112107 AAGGGGGAAAAGGGCATAGAGGG - Intergenic
1128372912 15:67053630-67053652 AAGTCTGAACAGGGCAGAGTGGG + Intergenic
1128386400 15:67152133-67152155 AAAAGTGTAAAGGGAACAGAGGG - Intronic
1129047187 15:72746123-72746145 AAGGATGAACAGAGCACAGAGGG + Intergenic
1129379563 15:75156608-75156630 AACAGTGACCCAGGCACAGAGGG - Intergenic
1130015525 15:80183211-80183233 AAGAGGGAAATGGGAACAGATGG + Intronic
1130075031 15:80681287-80681309 AAGAGATAAAAGTGCACAGAAGG + Intronic
1130241613 15:82198566-82198588 GATAGAGAAGAGGGCACAGAGGG + Intronic
1130458822 15:84142589-84142611 GATAGAGAAGAGGGCACAGAGGG - Intergenic
1130941071 15:88509724-88509746 AAGAGTACACAGGACACAGCTGG + Intergenic
1131098304 15:89669697-89669719 AAGAGAAAACAGGTCAGAGAGGG + Intronic
1131101935 15:89698478-89698500 AAAAGGGAACAAGGAACAGACGG - Intronic
1131551649 15:93362397-93362419 GAGGGTGAACGGGGCAGAGAGGG + Intergenic
1132255735 15:100374046-100374068 AAGAGTGAATGGGAGACAGAGGG - Intergenic
1132853733 16:2035750-2035772 TAGTGTGGACAGGGCACAGAGGG - Intronic
1133670553 16:8014900-8014922 AAGAGGGAAAAGGCCACACAAGG - Intergenic
1135463448 16:22664797-22664819 AAGAGTGAACCAGGCATAAAAGG + Intergenic
1136120597 16:28130883-28130905 AAAAGTAAACAGGACACTGAAGG + Intronic
1136542395 16:30935445-30935467 AAGAGTGAAGAGTGGAGAGAGGG + Intronic
1136621779 16:31434227-31434249 GAGAGAGCACAGGCCACAGAGGG + Intronic
1138339684 16:56280567-56280589 CAGAGTGGACAGGGCAGGGAGGG + Intronic
1138493165 16:57389537-57389559 AGAAGTGAACAGGGCACGGGTGG - Intergenic
1139120640 16:64012175-64012197 AAGAGAGAGAAGGACACAGATGG - Intergenic
1139654104 16:68377017-68377039 GAGAGCAAACAGGGCACACAAGG - Intronic
1141104123 16:81219145-81219167 AAGTGTGAACAGGGCCCTGCAGG + Intergenic
1141322784 16:83027412-83027434 AAGAGTTAACAGGGTGAAGAAGG + Intronic
1142978108 17:3657081-3657103 AGGAGGGAGGAGGGCACAGAAGG + Intronic
1142978116 17:3657105-3657127 AGGAGGGAGGAGGGCACAGAAGG + Intronic
1143301314 17:5912585-5912607 AAGGGTGCACAAGGCACAGAAGG + Intronic
1143660247 17:8320285-8320307 AAAAGTGAGCAGAGCAAAGAAGG + Intronic
1144092126 17:11867260-11867282 AAGAGTAAACAGTAAACAGAAGG - Intronic
1144748067 17:17628913-17628935 ATGAGTGAGCAGGGTACAGAGGG - Intergenic
1145924118 17:28633185-28633207 GTGAGTGACCAGGGCACTGAGGG - Intronic
1147555972 17:41479310-41479332 AAAGGTGAACACGGCACAGCAGG - Intronic
1147637920 17:41975196-41975218 AAGACTGAGCTGGGCACAGAAGG - Exonic
1149851763 17:60040914-60040936 AAGAGTCATCCAGGCACAGATGG - Intergenic
1151262529 17:72927714-72927736 AAAAGAGCACAGGGCTCAGATGG + Intronic
1151338113 17:73452263-73452285 AGGGGTGTGCAGGGCACAGAAGG - Intronic
1151349707 17:73524557-73524579 TAGAGGGAAGAGGGCACAGTAGG - Intronic
1151380160 17:73720200-73720222 AGGATAGAACAGGGCACACAAGG + Intergenic
1151403011 17:73868493-73868515 AAGCCTGATCAGAGCACAGATGG + Intergenic
1152051782 17:77984704-77984726 AAGAGGGAACAGGGAAGAGGTGG - Intergenic
1152256563 17:79243421-79243443 AAGAGTCAACTGGTCACAGAAGG - Intronic
1152346334 17:79754523-79754545 AAGAGAAAACTCGGCACAGAGGG - Intergenic
1152419262 17:80183225-80183247 AATGGTGAGCAGTGCACAGAAGG - Intronic
1152547785 17:81010948-81010970 AAGAGTGTGGAGGGCTCAGAAGG + Intergenic
1152572826 17:81128022-81128044 ATGAGTGGACGGGGCACAGGAGG - Intronic
1153235393 18:2981194-2981216 AGGAGTGTTCAGGTCACAGAAGG + Intronic
1154937922 18:21079557-21079579 AAGAGTGAAGAGGGGAGAGTAGG + Intronic
1155710063 18:28865741-28865763 AAGTTTGAACAGGGCAAAGCAGG - Intergenic
1157206445 18:45704202-45704224 AAGAGTGTGGAGGGCTCAGAAGG - Intergenic
1157992243 18:52510936-52510958 AAGAGGGAAGAGGGCAGTGAAGG + Intronic
1158121888 18:54057643-54057665 AAGAGGGAACAAGGAATAGAAGG - Intergenic
1159186732 18:64984390-64984412 AAGGGTGAGCAAGACACAGAGGG - Intergenic
1159436911 18:68429840-68429862 GAGGGAGGACAGGGCACAGAGGG + Intergenic
1160468528 18:79104321-79104343 AAGTGGGAACTGGGCACTGATGG + Intronic
1160795207 19:942200-942222 AAGAGTGGACAGGGCTCTGCCGG - Intronic
1161930669 19:7337383-7337405 AAGACTCATCAGGGCACACAGGG - Intergenic
1162385320 19:10357501-10357523 CAGAGTGACCAGGGCAGCGATGG - Intronic
1166037790 19:40181760-40181782 AAGAGTGAACAGGGTTTAGCAGG + Intergenic
1166734804 19:45077742-45077764 AAGAGGGAACTGGGGACAGATGG - Intergenic
1167665448 19:50820796-50820818 AAGAGGGAACAGAACACGGAAGG + Intronic
925051717 2:820725-820747 AATATTGAACATGGCACTGAGGG - Intergenic
925058670 2:874397-874419 AGGAGGGCACAGGGCGCAGAGGG - Intergenic
925328192 2:3038900-3038922 TGGGGTGACCAGGGCACAGAGGG + Intergenic
926419353 2:12681669-12681691 AAGAGTAAACAAGACACAAAGGG + Intergenic
927121154 2:19964641-19964663 AAGAGTGAACAGGCCACTTTGGG - Intronic
927247221 2:20967068-20967090 AAGAGCCATGAGGGCACAGAAGG + Intergenic
928358332 2:30641221-30641243 ACGAGAGAAAAGGGCACAGGTGG - Exonic
928433398 2:31238698-31238720 AGGAGTGACCAGGGGCCAGATGG - Intronic
929282446 2:40095705-40095727 TAGAGAGAAGAGGGCTCAGAGGG + Intergenic
931193788 2:60030473-60030495 AAGAGTTAACAGGTCACAGGAGG + Intergenic
931562954 2:63583319-63583341 AAGAGAGAACAGAGAACAAATGG + Intronic
931807051 2:65817648-65817670 AAGATTGAAAAGGGCAGAAAGGG + Intergenic
932111599 2:69006676-69006698 ATGACTTACCAGGGCACAGAAGG - Intergenic
932672609 2:73751562-73751584 AAGACTGAACAGGGCAAATTTGG + Intergenic
933592066 2:84243999-84244021 AATGTTGAACAGGGCACAGCCGG + Intergenic
933592095 2:84244476-84244498 GAAAGTGAAAAGGGCAGAGAGGG - Intergenic
934612715 2:95752926-95752948 AAGAGGAAACAGGGCTCAGGAGG - Intergenic
934648199 2:96071497-96071519 AAGAGGAAACAGGGCTCAGGAGG + Intergenic
936116582 2:109707623-109707645 AAGGGAGAACAGGGCCCAGCAGG + Intergenic
936339321 2:111617419-111617441 AACAGTGGAGAGGGCACTGAGGG + Intergenic
937216159 2:120314958-120314980 AAGAGTGTTCAGGACAGAGATGG - Intergenic
937217682 2:120323097-120323119 AAGTGTGCACAGGGCAGAGCTGG - Intergenic
939107348 2:137964419-137964441 AAGAGGGAACTGGGAAGAGAAGG + Exonic
940848746 2:158668328-158668350 AAGAGGGAAGAGGTCAGAGAAGG - Intronic
941542858 2:166808304-166808326 AAGAGTGAAAAGCACAGAGATGG - Intergenic
941574119 2:167209427-167209449 GAGGAAGAACAGGGCACAGAGGG + Intronic
943107169 2:183560049-183560071 AAGAGAGAACAGAGCAGAAAAGG + Intergenic
945994634 2:216425655-216425677 GAGAGTGAGCAAGGCAGAGAAGG + Intronic
946018536 2:216623043-216623065 AAGAGATATCAAGGCACAGAAGG - Intergenic
946682827 2:222235272-222235294 AGCAGTGAACAAGGCAGAGAAGG - Intronic
946895051 2:224315309-224315331 AAAAGTGAACAAAGAACAGATGG - Intergenic
947532803 2:230923522-230923544 AAGAAGGAACAGGACACAGAGGG + Intronic
949077049 2:242066871-242066893 AAAACTGAAAAGGGCAAAGAAGG - Intergenic
1169244984 20:4018104-4018126 AAGTGGGTACAGGGCACAGGTGG - Intergenic
1169608511 20:7351427-7351449 GAAAGTGAACAGGACAGAGATGG - Intergenic
1170200145 20:13733720-13733742 AAGACTGAAAAGGAAACAGAAGG - Exonic
1170271923 20:14537071-14537093 GAGAGTGAACAGAAAACAGAAGG - Intronic
1170684084 20:18553321-18553343 AGGAGTGAGCAGGCTACAGAAGG + Intronic
1171148310 20:22804892-22804914 AGAAGTTAACAGGGCAGAGAAGG + Intergenic
1172053683 20:32139238-32139260 AGGAGAGGTCAGGGCACAGATGG - Intronic
1172389579 20:34558088-34558110 AATAAGGAAAAGGGCACAGATGG - Intronic
1172987085 20:39000332-39000354 AAGAGTAAACAGTTCACAGAAGG - Intronic
1173586824 20:44188641-44188663 AAGAGAGAACTAAGCACAGAAGG + Intergenic
1174443961 20:50578018-50578040 AAAAGTGAACAAGGAACAGCAGG - Intronic
1174980264 20:55386437-55386459 AACAGTGAACAAGGCAAACAAGG + Intergenic
1176028110 20:62996527-62996549 AGGAGGGGACAGGGGACAGATGG - Intergenic
1176989639 21:15479949-15479971 AATTGTGAACAAGGCACAGTGGG + Intergenic
1177126349 21:17198035-17198057 AAGAGGGAACAGTGGGCAGATGG - Intergenic
1177331259 21:19666529-19666551 CAGAGTGTACAGGGAAGAGAAGG + Intergenic
1179035178 21:37753257-37753279 GTGAGTGGACAGGGCCCAGATGG + Intronic
1180880059 22:19197290-19197312 GAGAGTGGAGGGGGCACAGAAGG - Intronic
1180907053 22:19421649-19421671 AAGAGTTAAGAGAGAACAGAAGG - Intronic
1181395363 22:22617610-22617632 AAGAGTGACCAGGGAAAACAAGG + Intergenic
1183470185 22:38001130-38001152 AAGAGGCCACAGGGCAAAGAAGG - Intronic
1184179796 22:42812964-42812986 AAGAGAGATCAGGACACTGAAGG + Intronic
1184908580 22:47509686-47509708 AAGAGTCACCAGGGCGCACAAGG - Intergenic
949258551 3:2079538-2079560 AAGGGTGAGGAGGGCAGAGAAGG - Intergenic
949568245 3:5265512-5265534 CAGAGTGCACAGTGCATAGAAGG - Intergenic
949842291 3:8332941-8332963 AAGAGTTAACTGGGCAAATAAGG + Intergenic
950352106 3:12365318-12365340 ATGAGTAAACAAGCCACAGATGG - Intronic
950427868 3:12934417-12934439 AAGAGAGAACAGGGGGCAGACGG + Intronic
950791049 3:15472642-15472664 AAGAGAGAAAAGGGCATACATGG - Intronic
951067675 3:18286404-18286426 AAGGGTAAACAGAGCATAGAAGG + Intronic
952658199 3:35813169-35813191 AAGAGTAATCAGGGCCCTGATGG - Intergenic
952951830 3:38532032-38532054 AAGAGTTAGCAGGGCACTGTAGG - Intronic
953346238 3:42178282-42178304 AAGGGTGAGCGGGTCACAGAGGG - Intronic
953438278 3:42897010-42897032 AAGAGAGAACAGAGGAGAGAAGG - Intronic
954792870 3:53145863-53145885 CAGAGTGAGCAGGGCCCAGATGG - Intergenic
955134382 3:56201374-56201396 AAGAGTGAACTGACCCCAGAAGG - Intronic
955828824 3:62979933-62979955 AAGAGAGAAGAGGGGAGAGACGG - Intergenic
955994672 3:64667658-64667680 GAGAATGAAAAGGACACAGAAGG - Intronic
956310957 3:67879831-67879853 AAGTGTCAACAGGCCACAGGAGG - Intergenic
956497563 3:69844671-69844693 AAGAGTGAACAGGCAACTTATGG + Intronic
957933669 3:86914666-86914688 AGGAGTGCACTGGGCACTGAGGG + Intergenic
958263126 3:91405643-91405665 AAGAATGCACAGAGCAAAGATGG + Intergenic
960040711 3:113147810-113147832 GAGAGAGAACAGGGCCCAGAAGG + Intergenic
960438564 3:117657902-117657924 AAGAGAGAACAGGAGACAGCTGG - Intergenic
960535992 3:118815145-118815167 AAGAGGGAACAGGAGAGAGAAGG + Intergenic
960982735 3:123246439-123246461 AAGAATGAAGAGGGCACACGTGG + Intronic
961221810 3:125207038-125207060 AAGAGAGGAGAGGACACAGAAGG + Intronic
961850539 3:129812871-129812893 AAGAGTAAACAGCCTACAGAAGG + Intronic
962387707 3:134946036-134946058 AAGAGTGTTCAGGGGACACATGG + Intronic
962825505 3:139096733-139096755 AAGAGGGAAAAGGCCAGAGAAGG - Intronic
962850346 3:139303729-139303751 AAGAGAGAAGGGGGCAGAGAGGG + Intronic
963248598 3:143084734-143084756 AGGAATGAACTGGACACAGATGG - Intergenic
963262138 3:143203536-143203558 AGAAGCAAACAGGGCACAGAGGG + Intergenic
963844302 3:150140078-150140100 AAGAGGGACCAGAGCACATATGG + Intergenic
965764279 3:172113771-172113793 AAGAGGGAAAAAGGGACAGAAGG - Intronic
965776235 3:172234315-172234337 AGGACTGAACAGGACACACAAGG - Intronic
966713663 3:182994223-182994245 CAGAGTGAACAGACAACAGAAGG - Intergenic
967386626 3:188917997-188918019 GAGAGTGAACAGGTCAGAGGTGG - Intergenic
967618607 3:191604187-191604209 AAGAATGTACAGGGCCCACATGG + Intergenic
968268750 3:197383193-197383215 AAGAGTCAAAAGGGAACAGAAGG - Intergenic
968443461 4:636275-636297 ACGAGTGAGCAGGGAGCAGAGGG + Intronic
968591414 4:1461514-1461536 GAGGGTGAACAGGGAACAGAGGG + Intergenic
968736170 4:2297609-2297631 AAGACTGATCATGGCAAAGATGG + Intronic
969633325 4:8351110-8351132 AAGGGTGGGGAGGGCACAGAGGG + Intergenic
970799959 4:19961204-19961226 AAGAATGACCAGGGAACAAAAGG - Intergenic
972280495 4:37597551-37597573 AAGAGTTCACAGGCCACAGAAGG + Intronic
973571395 4:52243267-52243289 AAGAAAGAACAGGGCAGTGAAGG + Intergenic
973727124 4:53787921-53787943 AAGAGAGGACAGGTCAGAGAAGG + Intronic
977452422 4:97215698-97215720 AAGATTGGACAAGGCACAGTAGG + Intronic
979724828 4:123948331-123948353 AAGATTGTAGTGGGCACAGAGGG - Intergenic
980626041 4:135375839-135375861 AAGAGTGAACAGGCAACTTACGG - Intergenic
981051133 4:140310654-140310676 AAAAGTGAACAGGGCTGAGAGGG - Intronic
982161978 4:152579429-152579451 AGCACTGAACAGGGCCCAGAGGG + Intergenic
983412322 4:167417042-167417064 AAGAGTGAAGAGGGGAGAGTAGG - Intergenic
983647413 4:170005816-170005838 AGGATTAAAAAGGGCACAGAAGG + Exonic
984179564 4:176464958-176464980 AAGAGGGAACAGAGAAAAGAGGG - Intergenic
986206096 5:5626644-5626666 AAATTTGAACAGGGCACAGCAGG - Intergenic
986273205 5:6251981-6252003 AAGTGTGACCAGGGCACTGTGGG - Intergenic
986713823 5:10508002-10508024 AGCATGGAACAGGGCACAGAGGG - Intronic
987066681 5:14296730-14296752 AATACTGAACAGGGTCCAGATGG - Intronic
987463964 5:18250501-18250523 AAAAGTGCACAGAGCACAGCGGG + Intergenic
988235795 5:28542296-28542318 AAGAGGTCACAAGGCACAGAGGG + Intergenic
988622058 5:32833134-32833156 TAGAATGAGCAGTGCACAGAGGG + Intergenic
989478007 5:41896431-41896453 AAGAGGGAACAGAGGCCAGAAGG + Intergenic
990118633 5:52421530-52421552 AAGAGTTCACAGGGCACTGTAGG + Intergenic
991468210 5:66937208-66937230 TACAGTGAACAGGACACACATGG + Intronic
992083712 5:73259346-73259368 AAGACTGAGTAGGGGACAGAGGG + Intergenic
992389086 5:76313926-76313948 AAGAATCAACAGGCCAGAGATGG - Intronic
994098143 5:95866017-95866039 AAGAGAGAAGAGGACAGAGAAGG - Intergenic
994194585 5:96908056-96908078 AAGAGGGAACAGAGACCAGAAGG - Intronic
997383822 5:133456913-133456935 AAAAGTCAGCAGGGCACAAATGG - Intronic
998888944 5:146725855-146725877 AACAGTGAACAGGACAGACATGG - Intronic
999145851 5:149393244-149393266 AAGAGTAAAAACGGCAGAGAAGG - Intronic
999708752 5:154297539-154297561 AAGATTGATCAGCTCACAGATGG + Intronic
1000466276 5:161581462-161581484 AATGGTGAACTGGGCACAGTGGG - Intronic
1000645790 5:163758747-163758769 AAATCTGAACAGGGCACAGCAGG - Intergenic
1001195454 5:169669444-169669466 CAGAGAGCACAGGGCACAGGAGG - Intronic
1001648650 5:173299994-173300016 TAGAATGAAGCGGGCACAGAGGG + Intergenic
1002201596 5:177531707-177531729 AGGAGGGAACAGGGCAGAGCTGG + Intronic
1002985768 6:2189582-2189604 CAGAGTGAGCAGAGCACAGAGGG - Intronic
1003182198 6:3801522-3801544 CAGAATGACCAGGGCAGAGAGGG + Intergenic
1003336211 6:5175443-5175465 AAGAGGGAATAGGACACAGGTGG + Intronic
1004354599 6:14920231-14920253 AAGAGGGACAAGGGGACAGAGGG - Intergenic
1005143682 6:22663378-22663400 AAGAGAGAACAGAGAACAGTGGG - Intergenic
1005201239 6:23347171-23347193 AAGTTTGCACAGTGCACAGAGGG + Intergenic
1005348650 6:24913300-24913322 AGGAATGAAGAGGGCACAGTGGG + Intronic
1005869425 6:29963269-29963291 CAGAGTGAACAGGCCACCTATGG + Intergenic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1006510713 6:34519654-34519676 ATGAGTGCCCAGTGCACAGAAGG - Intronic
1006610095 6:35289434-35289456 TACAGTGAGCAGGGGACAGAGGG - Intronic
1007096487 6:39216372-39216394 AAGACTGAACAGTGCAGAGCTGG + Intronic
1007514605 6:42401107-42401129 AGGAGGGCACAGGCCACAGAGGG + Intronic
1007599047 6:43070555-43070577 AAGAGAGAACAAAGCAGAGATGG - Intronic
1007831453 6:44641934-44641956 AAGGTGGAACAGGGCACAGTGGG + Intergenic
1008992282 6:57617245-57617267 AAGAATGCACAGAGCAAAGATGG - Intronic
1009180905 6:60516357-60516379 AAGAATGCACAGAGCAAAGATGG - Intergenic
1010618400 6:78042380-78042402 AAGAGTTTAGAGGGCTCAGAAGG - Intergenic
1011596793 6:89024294-89024316 AAGAGTTAACTGGGCAAAGAGGG + Intergenic
1012318109 6:97805834-97805856 AAAAGTAAACATGGCACAGTAGG - Intergenic
1012790765 6:103692446-103692468 AATAGTGCACAGGCCACACAAGG + Intergenic
1013460013 6:110365712-110365734 ATGAGGGAACAAAGCACAGAGGG - Intergenic
1014659769 6:124155481-124155503 AAGAATGAACAGGCCAATGAAGG + Intronic
1014769990 6:125449820-125449842 AGGAGTCAGCAGGGCACAGGAGG - Intergenic
1016709836 6:147156882-147156904 AAGAGTGAGAAGGACTCAGAGGG - Intergenic
1016783742 6:147988156-147988178 AAGAGTAAGCAGGAAACAGAGGG + Intergenic
1017008282 6:150043930-150043952 GTGTGTGAACTGGGCACAGATGG + Intergenic
1017164847 6:151398186-151398208 AAGAATGTACATGTCACAGAAGG - Intergenic
1018575879 6:165259570-165259592 AAGAGTGTGGAGGGCTCAGAAGG - Intergenic
1018609541 6:165634316-165634338 TTGAGAGAACAGGGCACAGCTGG + Intronic
1019212418 6:170417367-170417389 AGGAAGGAACAGGGCCCAGACGG - Intergenic
1019619176 7:1981366-1981388 AAGGAAGAGCAGGGCACAGACGG + Intronic
1019804208 7:3111018-3111040 CAGAGTGAAAAGAGCCCAGATGG + Intergenic
1021287311 7:18796403-18796425 AAGAATGAACCAGGCACAGGGGG + Intronic
1022483669 7:30760925-30760947 AAGAGTGAATAGTTCACTGATGG + Intronic
1023089183 7:36601800-36601822 AAGAGAGAACCAAGCACAGAGGG + Intronic
1024048611 7:45602038-45602060 AAGAGTGATCAGGGCTTTGAGGG + Intronic
1024241665 7:47440493-47440515 AAGAGGGAAGAGGGCAGAAATGG + Intronic
1026774853 7:73225099-73225121 AAGAGTGGACGGGGGACACAAGG + Intergenic
1027015708 7:74778470-74778492 AAGAGTGGACGGGGGACACAAGG + Intronic
1027072320 7:75167467-75167489 AAGAGTGGACGGGGGACACAAGG - Intergenic
1030114847 7:106055348-106055370 AAGAATGAGGAGGGAACAGATGG - Intergenic
1033911613 7:146269897-146269919 AAGAGTGAAAAAGGCAATGATGG - Intronic
1035076395 7:156180453-156180475 AAGAATGGTCAGGGCAGAGAGGG - Intergenic
1035205819 7:157293173-157293195 AAGCGTGAAAAGTGCACACAGGG + Intergenic
1035535599 8:388755-388777 AAAACTGAAAAGGGCAAAGAAGG - Intergenic
1036502661 8:9328058-9328080 AAGAGTGGACTGAGCTCAGAAGG + Intergenic
1036671377 8:10790726-10790748 AAGAATGAAGAGGGCAAGGAGGG - Intronic
1038285516 8:26203292-26203314 AAGACTGTACAGGGCACAACTGG - Intergenic
1038950409 8:32408293-32408315 CTGAGGGAACAGGGCAAAGAGGG - Intronic
1039719890 8:40151884-40151906 CAGAGTGAGCAGGGCAGAGTGGG - Intergenic
1041104918 8:54432557-54432579 AAGAATGAACTGGCCACAGATGG + Intergenic
1042323575 8:67504463-67504485 AAGAGAAAACAGGCCCCAGATGG - Intronic
1042626539 8:70764222-70764244 CAGAGTAAAGAGGGCAGAGAAGG - Intronic
1043127892 8:76423245-76423267 AAGACTGAGCAGGGGACATAAGG - Intergenic
1045546007 8:103129080-103129102 AAGAGATAAGAGAGCACAGAAGG - Intergenic
1047288338 8:123507334-123507356 AAGAGTGCCCAGCACACAGAAGG + Intronic
1047289496 8:123516966-123516988 AGGAGTGAAAATGGCACAAAGGG + Intronic
1049044551 8:140139143-140139165 AAGAGTCCAATGGGCACAGAAGG + Intronic
1050751996 9:8949942-8949964 AAGAATGAAGAAGGCACAGAAGG + Intronic
1050947640 9:11546356-11546378 AATATTTAACAGGGCACAGATGG + Intergenic
1051038384 9:12776385-12776407 AAGTGTTAACAGCGCACAGCAGG - Intronic
1052245991 9:26335815-26335837 AAGGGTCAATAGGGCTCAGAGGG + Intergenic
1053010151 9:34628274-34628296 AAGAGTGAGCAGATCAGAGAGGG + Intergenic
1055687922 9:78797759-78797781 AAGAGACAAAAGGGCAGAGAAGG + Intergenic
1055930868 9:81558784-81558806 AAGAGTGGAAAGGACACAGATGG - Intergenic
1058006840 9:99925047-99925069 AAGAGGGAAAAGAGAACAGATGG - Intronic
1058446898 9:105062720-105062742 CAGAGAGAAGAGGACACAGAAGG + Intergenic
1059267071 9:113044539-113044561 AGAAGTGAACAGGGAATAGATGG + Intronic
1059457597 9:114409427-114409449 ATGAGTGAGCAGAGCAAAGAAGG + Intronic
1060991094 9:127849602-127849624 AAGACAGAGCAGGGCATAGATGG + Intronic
1061599029 9:131654113-131654135 AAGACTGGACGGGGCAGAGATGG + Intronic
1062168683 9:135122247-135122269 AAGAGTGAACCGGTCAGGGAAGG + Intergenic
1062293466 9:135809871-135809893 AGGAGGGAACATGGTACAGAAGG - Exonic
1185776458 X:2806522-2806544 AACAGTAAACAGGGGCCAGATGG + Intronic
1186885291 X:13907109-13907131 AAGAGTTGACAGAGCACAAAAGG - Intronic
1187242548 X:17527083-17527105 CAGGGTGAACTGGTCACAGAAGG - Intronic
1187539510 X:20178206-20178228 AAGAGTGACAAGGGAACAGTAGG + Intronic
1188600785 X:31960843-31960865 AAGAGTCATCAGAGAACAGATGG + Intronic
1189051315 X:37648660-37648682 CAGAGTGAACAGGTGACATACGG + Intronic
1189059388 X:37736808-37736830 AAGAGCTAACAGGGTACAGCAGG + Intronic
1189245810 X:39562421-39562443 AAGAGTTGACTGGGTACAGAAGG + Intergenic
1189877995 X:45456668-45456690 GAGAGTGATCAGAGCACAGAAGG - Intergenic
1190446728 X:50533216-50533238 AAGAGTGTACAGGAAAAAGAGGG + Intergenic
1192593713 X:72384455-72384477 AAAAGTTAACCAGGCACAGAAGG - Intronic
1193468321 X:81872470-81872492 AAAACTGGACAGGGCACAGGTGG + Intergenic
1195351005 X:103997050-103997072 TGGACTGAACAGGGCAAAGATGG + Intergenic
1195355471 X:104035532-104035554 CAGAGTGAACAGGCAACATACGG - Intergenic
1195381873 X:104278830-104278852 AACAGTGAACAAGACACAGGAGG - Intergenic
1197452553 X:126637990-126638012 AAAAGTGAACTAGGCACATAGGG + Intergenic
1198304394 X:135366289-135366311 GAATGTGGACAGGGCACAGAGGG - Intergenic
1199293459 X:146131048-146131070 AAGGGTGAAGAGGGAACAAAAGG + Intergenic
1199545267 X:149002172-149002194 AAGACAGACCAGGGCACAGGAGG + Intergenic
1199593530 X:149489128-149489150 AAGAGGAAACTGGGCACCGAGGG + Intronic
1200122139 X:153796166-153796188 AAGAGCGAACTGGGGACAGGTGG - Intronic
1201665437 Y:16448176-16448198 AAGACTTAAGAGGGGACAGATGG + Intergenic