ID: 1083653630

View in Genome Browser
Species Human (GRCh38)
Location 11:64218828-64218850
Sequence TGGAACATGGGGAAGCAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 237}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083653630_1083653643 20 Left 1083653630 11:64218828-64218850 CCTGACTGCTTCCCCATGTTCCA 0: 1
1: 0
2: 0
3: 17
4: 237
Right 1083653643 11:64218871-64218893 TTGGGGGGGCCTTAGACTGAGGG 0: 1
1: 0
2: 0
3: 8
4: 189
1083653630_1083653637 3 Left 1083653630 11:64218828-64218850 CCTGACTGCTTCCCCATGTTCCA 0: 1
1: 0
2: 0
3: 17
4: 237
Right 1083653637 11:64218854-64218876 TGTCATCTCCATTGAACTTGGGG 0: 1
1: 0
2: 3
3: 16
4: 156
1083653630_1083653636 2 Left 1083653630 11:64218828-64218850 CCTGACTGCTTCCCCATGTTCCA 0: 1
1: 0
2: 0
3: 17
4: 237
Right 1083653636 11:64218853-64218875 CTGTCATCTCCATTGAACTTGGG 0: 1
1: 0
2: 0
3: 18
4: 179
1083653630_1083653639 5 Left 1083653630 11:64218828-64218850 CCTGACTGCTTCCCCATGTTCCA 0: 1
1: 0
2: 0
3: 17
4: 237
Right 1083653639 11:64218856-64218878 TCATCTCCATTGAACTTGGGGGG 0: 1
1: 0
2: 0
3: 10
4: 140
1083653630_1083653642 19 Left 1083653630 11:64218828-64218850 CCTGACTGCTTCCCCATGTTCCA 0: 1
1: 0
2: 0
3: 17
4: 237
Right 1083653642 11:64218870-64218892 CTTGGGGGGGCCTTAGACTGAGG 0: 1
1: 0
2: 0
3: 9
4: 101
1083653630_1083653640 6 Left 1083653630 11:64218828-64218850 CCTGACTGCTTCCCCATGTTCCA 0: 1
1: 0
2: 0
3: 17
4: 237
Right 1083653640 11:64218857-64218879 CATCTCCATTGAACTTGGGGGGG 0: 1
1: 0
2: 0
3: 7
4: 90
1083653630_1083653638 4 Left 1083653630 11:64218828-64218850 CCTGACTGCTTCCCCATGTTCCA 0: 1
1: 0
2: 0
3: 17
4: 237
Right 1083653638 11:64218855-64218877 GTCATCTCCATTGAACTTGGGGG 0: 1
1: 0
2: 1
3: 13
4: 130
1083653630_1083653635 1 Left 1083653630 11:64218828-64218850 CCTGACTGCTTCCCCATGTTCCA 0: 1
1: 0
2: 0
3: 17
4: 237
Right 1083653635 11:64218852-64218874 TCTGTCATCTCCATTGAACTTGG 0: 1
1: 0
2: 2
3: 19
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083653630 Original CRISPR TGGAACATGGGGAAGCAGTC AGG (reversed) Intronic
900381174 1:2384870-2384892 TGGCACATGGAGAAGCTGCCAGG + Intronic
900503643 1:3018560-3018582 TGGAGGCTGGGGAAGCAGCCGGG + Intergenic
900652196 1:3735196-3735218 TGGAACATGGGGGAAGAGTGGGG - Exonic
902828343 1:18992953-18992975 TGGAAGAGGGGAAAGCAGTTTGG - Intergenic
903187730 1:21638787-21638809 TGGAAAAGGGTAAAGCAGTCAGG - Intronic
903421485 1:23220452-23220474 TGGGAGGTGGGCAAGCAGTCAGG + Intergenic
904600238 1:31668909-31668931 TGGGGCAGGGGGAAGGAGTCAGG - Intronic
907110155 1:51919861-51919883 TGTAACAGGGAGAAGCAGACTGG + Exonic
908903862 1:68985778-68985800 AGGAACCTAGAGAAGCAGTCTGG - Intergenic
909493103 1:76247531-76247553 TGGAATCTAGAGAAGCAGTCTGG + Intronic
910591474 1:88931406-88931428 TGGAGCATGGGCTAGCAGGCCGG - Intergenic
910630062 1:89344930-89344952 AGGAACATGAGCAGGCAGTCAGG - Intergenic
911414269 1:97551029-97551051 TGGAACACAGGCAAGCAGTGTGG - Intronic
911525493 1:98979982-98980004 TGGATTATGGGCAGGCAGTCAGG - Intronic
912354467 1:109043206-109043228 GGGAAAATGGGGTAACAGTCTGG + Intergenic
912474643 1:109927860-109927882 TAGAAGATGGGGCAGCAGGCTGG + Intronic
912487546 1:110041080-110041102 TGAAACATTAGGAAGCTGTCAGG - Intronic
912518204 1:110228790-110228812 GGGAGCAGGGGGGAGCAGTCAGG + Intronic
912913641 1:113789288-113789310 CTGAACATGTGGAAGCAGACAGG + Intronic
913468578 1:119168768-119168790 TGGAGCATGGGCTAGCAGGCTGG + Intergenic
914831684 1:151175093-151175115 TGGAAGCTGGGGAAGCAGAAAGG - Intronic
915074957 1:153300264-153300286 TGGGACATGGATAAGCAGTGGGG - Intronic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
919869073 1:201806870-201806892 TGGAACATAGGAAGGCCGTCAGG - Intronic
920041878 1:203103354-203103376 GGGAAGATGGGGAAGGAGGCAGG - Intronic
920175912 1:204101784-204101806 TGGAAAATTGGGAAGCAGCTGGG - Intronic
921279423 1:213551000-213551022 TGAAACTTGGGGTAGCAGTCAGG + Intergenic
922684023 1:227625420-227625442 TGGAGCATGGGCTAGCAGGCCGG + Intronic
922827042 1:228529116-228529138 TGGTGCATGTGGAAGCAGTGTGG - Intergenic
923655434 1:235911934-235911956 TGGAAGATGTGGAAGTAATCGGG - Intergenic
924637361 1:245800790-245800812 AGGAACTTGGGGAAGGATTCGGG + Intronic
1064364930 10:14699161-14699183 TGGAACAGGGAGAAACAGTATGG + Intronic
1066058096 10:31699858-31699880 GGGAACCTGGGGAAGGAGTGGGG + Intergenic
1067743390 10:48913938-48913960 TGGAACTTGGAGATGGAGTCAGG + Exonic
1071821553 10:89285810-89285832 AGGAACATGGGGAAGGGGTGGGG - Intronic
1071978034 10:90975122-90975144 TGGAAGAAGGGGAGTCAGTCAGG + Intergenic
1072317820 10:94220938-94220960 TGGAACAAGGGGAAGCTGGAGGG - Intronic
1072463808 10:95644812-95644834 TGGAACATGGGTATGAAGGCTGG + Intronic
1074280260 10:112044850-112044872 GACAACATGGGGAAGAAGTCCGG - Intergenic
1074500682 10:114021298-114021320 TGGAAAAGGGGGAAGCGGCCAGG - Intergenic
1074681524 10:115912060-115912082 TGGGACATCGGGAAGCATTTGGG + Intronic
1075438126 10:122460225-122460247 TGGGGCATGGGAAAGCTGTCGGG - Intergenic
1078095674 11:8295228-8295250 GAGAGCATGGGGAAGCAGCCGGG + Intergenic
1079625057 11:22607184-22607206 TGGAATTTGAGGAAGAAGTCTGG + Intergenic
1080041841 11:27767503-27767525 TGGAGAAGGGTGAAGCAGTCAGG - Intergenic
1082074793 11:47967791-47967813 TGGACCCTGGGGAATCAGCCTGG - Intergenic
1083310325 11:61780560-61780582 TGGAACATGGGGTAGGAGGAAGG + Intronic
1083653630 11:64218828-64218850 TGGAACATGGGGAAGCAGTCAGG - Intronic
1083709260 11:64538105-64538127 TGGCACATGGGGAAGCTGTAGGG + Intergenic
1085283838 11:75347292-75347314 TGGAACATGGGGAAGTCCTGTGG - Intronic
1085323970 11:75592626-75592648 TGGAACAGGGGACAGCAGTCAGG - Intronic
1086237141 11:84645105-84645127 TGGATAAAGAGGAAGCAGTCAGG + Intronic
1088170879 11:106995161-106995183 TGTAAAATGGGGAAGCTTTCTGG + Intronic
1090722734 11:129491412-129491434 TGAAACATGGAGAATCAGTATGG + Intergenic
1092255788 12:6926262-6926284 TGGGTCACAGGGAAGCAGTCGGG - Intronic
1094641086 12:32276184-32276206 TGGAGCATGGGCTAGCAGGCCGG - Intronic
1094806886 12:34102468-34102490 TGGAACATGGGCTAGCAGGCTGG - Intergenic
1095139176 12:38641052-38641074 TGGAGCATGGGCTAGCAGGCTGG - Intergenic
1095284111 12:40388638-40388660 TGGAGCATGGGCTAGCAGGCTGG - Intergenic
1097841846 12:64329107-64329129 TGGAAGGTGGGAAAGAAGTCTGG - Intronic
1098814235 12:75137366-75137388 TGGAACTTTGGGAAGAAGCCAGG - Intronic
1098995283 12:77112170-77112192 AGGAACATGAGGAAACATTCTGG - Intergenic
1099605638 12:84798179-84798201 TGGAGCATGGGCTAGCAGGCCGG - Intergenic
1100231933 12:92617742-92617764 TGGAAGATGGGGATGCTGTTTGG + Intergenic
1101685637 12:107017342-107017364 TGCAACATGGGGAAGGAGCATGG - Intronic
1106718418 13:32415225-32415247 TGGAACATGGAGGTGCAGCCTGG - Intronic
1107980263 13:45728205-45728227 TGGAACATGGAGGAGCAGCAAGG + Intergenic
1108862172 13:54874768-54874790 TGTAAAATGGGGATGCTGTCAGG + Intergenic
1109036593 13:57270133-57270155 TTAAAAATGGGGAAGCAGTAGGG + Intergenic
1110047304 13:70846251-70846273 GGGAACAGGGGGAAGCAGGAGGG - Intergenic
1111687331 13:91517612-91517634 TGGAAAATGTGGAAGCAATTTGG - Intronic
1113285138 13:108838073-108838095 TGGCACATGGGTAAGCACACAGG + Intronic
1118698307 14:68407847-68407869 TGGAGCAGGGGGAAGAAGTCTGG + Intronic
1119150696 14:72356973-72356995 TTGAAAATGTGGAAGCAGCCAGG + Intronic
1120220184 14:81722927-81722949 GGGAACAAGGGGTAGCAGTTGGG - Intergenic
1120508454 14:85382377-85382399 GGTAACATGAGGAAGCAGGCTGG + Intergenic
1124551168 15:30682596-30682618 AGGACCATGGGGCAGAAGTCAGG - Intronic
1124680076 15:31723058-31723080 AGGACCATGGGGCAGAAGTCAGG + Intronic
1127073536 15:55305350-55305372 TGGAGCATGGGCTAGCAGGCTGG + Intronic
1128813569 15:70588856-70588878 TGGAACATGGGCGAGATGTCTGG + Intergenic
1129695399 15:77738146-77738168 AGGAGCTGGGGGAAGCAGTCAGG - Intronic
1129996800 15:80013787-80013809 TAAAAAATGGGGAAGCAGGCTGG - Intergenic
1130904362 15:88229376-88229398 TGTAACATGGAGAAGCAGATTGG - Intronic
1131420608 15:92301710-92301732 TGGAGCATGGGCTAGCAGGCTGG - Intergenic
1133975389 16:10596580-10596602 TTGGAGATGGGGAAACAGTCTGG + Intergenic
1134858081 16:17537300-17537322 TGAAACCTGGGGGAGCAGTTAGG - Intergenic
1135304691 16:21357881-21357903 TGGAGCAGGGAGAGGCAGTCTGG + Intergenic
1135718029 16:24789893-24789915 TGGTACCTGGGGAAGCCTTCAGG + Exonic
1136301434 16:29337008-29337030 TGGAGCAGGGAGAGGCAGTCTGG + Intergenic
1137857075 16:51805483-51805505 TGGCACAAGGGGCAGCAGTGAGG - Intergenic
1139001776 16:62519577-62519599 AGGCACATGGGGAAGCAGTGGGG + Intergenic
1140692700 16:77499509-77499531 CGGAAAATGGGCATGCAGTCTGG + Intergenic
1141637123 16:85320104-85320126 GGCAACAAGGAGAAGCAGTCGGG + Intergenic
1146297335 17:31660082-31660104 TGGAATCTGGGGAAACAGGCAGG + Intergenic
1146769077 17:35552102-35552124 TGGAGCATGGGCTAGCAGGCCGG - Intronic
1147328868 17:39684619-39684641 TGGTACATGGGGGAGGAGGCTGG + Exonic
1148522825 17:48298080-48298102 TGGAACATCTGGAAAGAGTCTGG - Intronic
1149881179 17:60292635-60292657 TAGAACATGGTGTAGCAGTGAGG - Intronic
1152922575 17:83073265-83073287 TGGAGCCTGGGGACGCAGTGGGG + Intergenic
1153401980 18:4691559-4691581 TGGAGCATGGGCTAGCAGGCCGG - Intergenic
1154208180 18:12355479-12355501 TGGAAAATGGGCAAGTAGTTTGG + Intronic
1156272186 18:35545772-35545794 TGGGACATGGGACAGCAGTGTGG - Intergenic
1158247984 18:55453145-55453167 TGGGTTATGGGGAAGCAGTGTGG + Intronic
1158949699 18:62482607-62482629 TGGAGCATGGGCTAGCAGGCTGG - Intergenic
1160976343 19:1794548-1794570 TGGACCAGGGGGAGGCAGCCTGG + Intronic
1164949173 19:32322044-32322066 AGGAACATGTGGATGCAGTGTGG + Intergenic
1165547851 19:36556678-36556700 TGGCAGATGGGGCAGCAGCCAGG - Intronic
1165786693 19:38465997-38466019 TGGGACAAGGGTCAGCAGTCAGG + Intronic
1166024754 19:40072162-40072184 TGGAGCATGGGCTAGCAGGCCGG - Intronic
1166211308 19:41308336-41308358 TGGGCCATGGGGATGCAATCTGG - Intronic
1168129666 19:54310228-54310250 TGGAACATGGGGAAGATGCTGGG - Intronic
1168434224 19:56304584-56304606 TGGAAGATGGGGAAGAAGGTGGG + Intronic
1168502862 19:56908167-56908189 GGGAACATGGGGAAGCACCAGGG - Intergenic
1168722257 19:58560619-58560641 AGGAACAAAGGGAAGCAGTGGGG - Intergenic
925929188 2:8693886-8693908 TGGAGCCTGGGGTACCAGTCAGG - Intergenic
926134322 2:10325921-10325943 TGGGAAATGAGGAAGCAGTTGGG + Intronic
928251938 2:29688769-29688791 TTGAAGTTGGGGAAACAGTCAGG - Intronic
929060454 2:37918999-37919021 TGGTACATGGGATAGAAGTCAGG + Intergenic
929558107 2:42937945-42937967 AGAAACATGGGAAAGAAGTCAGG - Intergenic
932300184 2:70661480-70661502 TGGAGCCTGGGGTAGCAGTTAGG + Exonic
933806136 2:85999033-85999055 TTTAACATGGGGAAGGAGACAGG + Intergenic
934476172 2:94594982-94595004 GGGAGCCTGGGGAAGCAGTGAGG + Intronic
935290827 2:101609647-101609669 AGGAGCATGGGTAATCAGTCTGG + Intergenic
936572528 2:113628457-113628479 TGGCACTGAGGGAAGCAGTCTGG + Intronic
937491691 2:122375641-122375663 TGGAAGATGTTGAAGCATTCAGG + Intergenic
938260392 2:129891726-129891748 TGGAGCAGGGGCATGCAGTCTGG - Intergenic
939385058 2:141485504-141485526 TGGAAAATGGGGAGGCAGACAGG + Intronic
939493232 2:142900827-142900849 TGGAGCATGGGCTAGCAGGCTGG + Intronic
940211732 2:151261972-151261994 TGCAACTTGTGGAAGCACTCTGG + Intergenic
940911640 2:159214931-159214953 TGGAACATTCGGAATCAGCCAGG + Intronic
945908505 2:215620598-215620620 TGGAACATGGGGAAGTTGGGTGG - Intergenic
948348939 2:237322584-237322606 TGGAACTTGGGGGAGTAGTCAGG - Intergenic
1168740970 20:191162-191184 TGGAGCATGGGCTAGCAGGCCGG + Intergenic
1169268243 20:4180712-4180734 TCAAAGATGGAGAAGCAGTCAGG - Intronic
1169378754 20:5088461-5088483 TGGGCAATGGGGAAGCAATCAGG + Intronic
1172615063 20:36277915-36277937 TGGAACAAGGGGAACGAGCCAGG - Intergenic
1177762134 21:25414068-25414090 TGGTACATGGGGAAGATGTGGGG - Intergenic
1177896618 21:26861105-26861127 TGGAGCATGGGCTAGCAGGCTGG - Intergenic
1178123531 21:29493546-29493568 TTGAAAATTGGGAAGCAGCCCGG - Intronic
1178189991 21:30269069-30269091 TGGGACAAAGGGAAGAAGTCAGG - Intergenic
1181054384 22:20253161-20253183 TGGAAGAGGGGGCAGCAGCCAGG + Intronic
1183713615 22:39520945-39520967 GGGCTCCTGGGGAAGCAGTCCGG - Exonic
1185427661 22:50782422-50782444 TGGCACTGAGGGAAGCAGTCTGG - Intronic
949431864 3:3985429-3985451 AGGAGCATGGGGAAGGAGTATGG - Intronic
950730635 3:14953570-14953592 AGGAACATGGGTGGGCAGTCAGG - Intronic
951992656 3:28692865-28692887 TGGCTCATTGGGAAGCAGTATGG + Intergenic
953074083 3:39551628-39551650 AGGAACATAGAGAGGCAGTCTGG - Intergenic
953749912 3:45601194-45601216 TGGAAGATGGAGAAGGAATCAGG + Intronic
954680617 3:52344110-52344132 TGCACCATGGGGCAGCAGGCGGG + Intronic
955022452 3:55134218-55134240 GGGAAACTGGGGAAGCAGGCAGG - Intergenic
955498675 3:59562814-59562836 TGGAACATGGGGAGGTGGCCAGG - Intergenic
955917805 3:63924343-63924365 TGGAGCATGGTGGAGCAGTCTGG + Intronic
956172989 3:66447342-66447364 AGGGACATGGGGAGGCAGTGTGG - Intronic
956224870 3:66946236-66946258 TGGAAGAGAGGGAAGCAGTGAGG - Intergenic
962626993 3:137235648-137235670 GAGAACATGGGGAAGGAGTTGGG + Intergenic
963129925 3:141848572-141848594 TGGGACATGGGGAAGCCTTCAGG + Intergenic
963609928 3:147454020-147454042 TGGAAGCAGGGGAAGCAGTTGGG + Intronic
964415864 3:156446805-156446827 TGAAACATGGGGGACCAGTTAGG - Intronic
964953860 3:162327873-162327895 TGGAGCATGGGCTAGCAGGCCGG - Intergenic
965293160 3:166909600-166909622 TGGAATCTAGAGAAGCAGTCTGG + Intergenic
968663881 4:1810343-1810365 TGGGACAGGGGGAGGCAGCCAGG - Intergenic
968844030 4:3029809-3029831 AGGAGCATGGGGAAGGAGGCAGG - Intronic
969641191 4:8399638-8399660 TGGAACATGGCGAAACTGTGGGG + Exonic
971813482 4:31458668-31458690 TGGAACATCAGGAAGTAGTGGGG - Intergenic
972598681 4:40552667-40552689 GGGAACCTGGGGAAGGACTCTGG - Intronic
972770049 4:42189332-42189354 AGCTAAATGGGGAAGCAGTCGGG + Intergenic
972980386 4:44692504-44692526 TGAAACATGGGGAAGCAGGAGGG + Intronic
974520683 4:62976836-62976858 TGGAGCATGGGCTAGCAGGCTGG - Intergenic
976669525 4:87636608-87636630 TGGAATCTGGAGAGGCAGTCTGG - Intergenic
977681197 4:99800460-99800482 TGGGACTTGGAGAAGCTGTCAGG - Intergenic
979602626 4:122603293-122603315 TGGAACATAGGGCAGTTGTCAGG - Intergenic
979865385 4:125746262-125746284 TGAAACATTGGGAAACTGTCAGG + Intergenic
980106400 4:128592492-128592514 AGGCACATGTGGAAGCAGCCTGG + Intergenic
981048144 4:140284625-140284647 TGAAGCCTGGGGAAGCAGGCTGG + Intronic
982024919 4:151242502-151242524 TGGATCATGGGACTGCAGTCAGG - Intronic
982085318 4:151829724-151829746 TGGTACATGTGGAAGCAGAGAGG - Intergenic
986732427 5:10645202-10645224 TGGCACAAGGGGAGGCAGTGAGG + Intronic
988929976 5:36028078-36028100 TGGAAAATGGGCAAGGAGCCAGG - Intergenic
989940797 5:50147336-50147358 TGGAGCATGGGGGAGCGATCTGG + Intergenic
990319545 5:54616330-54616352 TGGAAAATAGGGAAGCAGTATGG - Intergenic
990345737 5:54869275-54869297 AGGACCAGGGGGGAGCAGTCAGG - Intergenic
990758246 5:59100092-59100114 TGGAACCATGGGAAGCAGTTTGG - Intronic
991629876 5:68645758-68645780 TGGACCATGGGGAAGGACACAGG - Intergenic
992279062 5:75154635-75154657 TGGAAGGTGGGAAAGCAGGCAGG + Intronic
992673072 5:79078907-79078929 GGGAACATCAGAAAGCAGTCTGG - Intronic
993435910 5:87893932-87893954 AAGAAGATGGGGAAGCAGTTAGG - Intergenic
993581411 5:89666226-89666248 TGGTGCATGAGGAAGCAGTGGGG - Intergenic
996242542 5:121221349-121221371 AGGAACCTAGAGAAGCAGTCTGG - Intergenic
996519734 5:124413555-124413577 TGGAGCATGGAGAAGAAGGCAGG + Intergenic
997855459 5:137368748-137368770 TGGGAGATGTGGAAGCAGTGGGG - Intronic
1000902064 5:166923221-166923243 TTGAAAACGGGGAAGCAGGCCGG + Intergenic
1001398889 5:171435158-171435180 AGGAAGGTGGGAAAGCAGTCAGG + Intronic
1002100337 5:176854541-176854563 TGGACCCTGGGGAAGCAGAGGGG - Intronic
1005378296 6:25207656-25207678 AGGAATCTAGGGAAGCAGTCTGG - Intergenic
1007790593 6:44306158-44306180 AGGAACATTGGGAAGAGGTCAGG + Intronic
1008221296 6:48856727-48856749 TGGATCATGGGGAAGATGACAGG - Intergenic
1008253453 6:49268771-49268793 AGGAACGTGTGGAAGCAGACAGG - Intergenic
1010370679 6:75103476-75103498 CAGAACATGGGGAAGCAGAGGGG - Intronic
1011209958 6:84944818-84944840 CGGAACATGGGCTAGCAGACTGG - Intergenic
1013253046 6:108354047-108354069 TGGGAGATGGGGAAGCAGGGAGG + Intronic
1013796825 6:113897424-113897446 TGGAGCATGGGCTAGCAGGCCGG + Intergenic
1015444621 6:133288579-133288601 TGGGCCATGGGGGAGAAGTCTGG + Intronic
1016014903 6:139173573-139173595 TTTAACATGGGGAAGCACCCTGG + Intronic
1017228325 6:152045142-152045164 TGGTACATGGAGAAGCAGAAGGG + Intronic
1018176715 6:161183848-161183870 GGGGACATGGGGAAGCAGGGAGG + Intronic
1019215178 6:170438802-170438824 TGGAGGCTGGGGAAGCAGGCTGG + Intergenic
1019534568 7:1522120-1522142 TGGAAGATGGGAAGGCAGCCTGG + Intergenic
1019843388 7:3472856-3472878 GAGAACATGGGGTAACAGTCAGG + Intronic
1021109491 7:16677539-16677561 TGGAGCATGGGCTAGCAGGCCGG + Intronic
1023648398 7:42343164-42343186 TGGGAAGTGGGGAAGCAGCCTGG + Intergenic
1023720750 7:43091362-43091384 TGGAAGATGGGGAATCAGGCTGG - Intergenic
1024055279 7:45656575-45656597 TGGAGGTTGGGGAAGCAGTGGGG + Intronic
1025012183 7:55406380-55406402 CAGAAGATGGGGGAGCAGTCAGG + Intronic
1026407132 7:70078002-70078024 TGGTACATGGGCAAGTGGTCAGG + Intronic
1030147476 7:106371286-106371308 TGGAGCATGGGGAAGTGGGCAGG - Intergenic
1030350351 7:108478130-108478152 AGGAAAATGGAAAAGCAGTCAGG + Intronic
1030684671 7:112472440-112472462 TCTAACATGTGGAAGCACTCTGG - Intronic
1031603320 7:123740019-123740041 TGGAATATGAGGGAGCAGTAAGG - Intronic
1033428131 7:141263936-141263958 TGGCACATAGGGAAGAATTCAGG + Intronic
1035709771 8:1703901-1703923 TGGAACATGGCGGACCAGGCAGG - Exonic
1035971724 8:4256778-4256800 TGCAACAGGGCCAAGCAGTCAGG + Intronic
1036528372 8:9556341-9556363 AGGAAGATGAGGAAGAAGTCGGG - Exonic
1037411893 8:18606675-18606697 TGGAACAAGGGGAACCAGTAAGG + Intronic
1037721754 8:21450305-21450327 TGGAACATAGGGAAGTTCTCTGG - Intergenic
1037743282 8:21624003-21624025 TGGATCATGGGGAATCAGACAGG + Intergenic
1040103547 8:43525719-43525741 TGGAAAGTGGGGAAGGAGTGAGG + Intergenic
1042056327 8:64767866-64767888 TGGAGCATGGGCTAGCAGGCTGG - Intronic
1042364697 8:67923139-67923161 TGGATCATGGGCTAGCAGGCCGG - Intergenic
1042910617 8:73822111-73822133 TGGAGCATGGGCTAGCAGGCCGG - Intronic
1045746208 8:105425325-105425347 GGTAAAATGGGGAAGCTGTCAGG + Intronic
1047058415 8:121193818-121193840 GGAAACATGGGGAAGCCATCAGG + Intergenic
1048491362 8:134896725-134896747 TGGTAGAAGGGGAAGCAGGCAGG + Intergenic
1050755203 9:8994007-8994029 TGGTACATGTGGAAGGATTCAGG + Intronic
1050891429 9:10829503-10829525 GGGAACAGTGGGAAGCAGTTTGG - Intergenic
1056318360 9:85413795-85413817 TGGAAGATGGGGAAGCAGCAGGG - Intergenic
1057854731 9:98593713-98593735 TTGCACATGGGGGAGCTGTCGGG - Intronic
1059282850 9:113149609-113149631 TGGGCCATGGGGAAGCACTGGGG - Intergenic
1059409655 9:114124080-114124102 TGGAAGAAGGAGAAGCAGTCAGG - Intergenic
1060742605 9:126109435-126109457 TGGGACCTGGAGAAGCAGACAGG + Intergenic
1061119915 9:128636091-128636113 TGGAACTCGGGGGAGGAGTCTGG - Intronic
1061141544 9:128770583-128770605 AGGACCATGGGGAAGGAGTTGGG - Intronic
1185914452 X:4019867-4019889 TGGAAACTGTGAAAGCAGTCGGG + Intergenic
1189081325 X:37975639-37975661 TAGAAGCTGTGGAAGCAGTCAGG + Intronic
1189946916 X:46189075-46189097 TGGAGCATGGGCTAGCAGGCCGG - Intergenic
1190446713 X:50533033-50533055 TGGAACATGGGGAAGAGTTGGGG + Intergenic
1190566482 X:51735006-51735028 TTGAAAATGGTGAAGCAGTATGG + Intergenic
1190712739 X:53081741-53081763 TGGAAAAAGGGGCAGCAGTGGGG + Intergenic
1193307126 X:79962603-79962625 TGGAGCATGGGCTAGCAGGCTGG - Intergenic
1195291883 X:103437689-103437711 TGGAGCATTGGGATGCAGCCTGG - Intergenic
1197279533 X:124518780-124518802 TTGAACCCGGGGAAGGAGTCTGG + Intronic
1197936313 X:131743330-131743352 GGGAACCTGGGGAGGAAGTCAGG - Intergenic
1197936962 X:131749540-131749562 GGGAACCTGGGTAGGCAGTCAGG - Intergenic
1199757112 X:150874866-150874888 AGGAACAGGTGGAATCAGTCTGG - Intronic
1200110636 X:153739009-153739031 TGGCACCTGGGGAGGCAGTGGGG + Intronic
1201741887 Y:17332914-17332936 TGGAACTTGGGGAACAAGTGGGG + Intergenic