ID: 1083655163

View in Genome Browser
Species Human (GRCh38)
Location 11:64225999-64226021
Sequence CCCTCTCTGCAGCAGGGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 335}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083655163_1083655176 28 Left 1083655163 11:64225999-64226021 CCAAGTCCCTGCTGCAGAGAGGG 0: 1
1: 0
2: 3
3: 32
4: 335
Right 1083655176 11:64226050-64226072 CCAAGGTCACACGGTCAGCCAGG 0: 1
1: 1
2: 10
3: 49
4: 422
1083655163_1083655173 19 Left 1083655163 11:64225999-64226021 CCAAGTCCCTGCTGCAGAGAGGG 0: 1
1: 0
2: 3
3: 32
4: 335
Right 1083655173 11:64226041-64226063 CAGACTTGCCCAAGGTCACACGG 0: 1
1: 9
2: 83
3: 364
4: 1153
1083655163_1083655171 11 Left 1083655163 11:64225999-64226021 CCAAGTCCCTGCTGCAGAGAGGG 0: 1
1: 0
2: 3
3: 32
4: 335
Right 1083655171 11:64226033-64226055 CAGCAGGCCAGACTTGCCCAAGG 0: 1
1: 0
2: 4
3: 30
4: 282
1083655163_1083655168 -5 Left 1083655163 11:64225999-64226021 CCAAGTCCCTGCTGCAGAGAGGG 0: 1
1: 0
2: 3
3: 32
4: 335
Right 1083655168 11:64226017-64226039 GAGGGAAACTAAGGCCCAGCAGG 0: 1
1: 0
2: 6
3: 64
4: 478

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083655163 Original CRISPR CCCTCTCTGCAGCAGGGACT TGG (reversed) Intronic
900339565 1:2181558-2181580 CCATCTCTGCAGCTGGCACGTGG - Intronic
900458708 1:2789976-2789998 CCCTGCCAGCAGCAGGCACTCGG + Intronic
900607525 1:3530531-3530553 CTCTCTCTGCAGCTGGGATCTGG - Intronic
900649271 1:3723060-3723082 ACCTCTCTGCACCTGGCACTGGG + Intronic
900965342 1:5953503-5953525 TCCTCTCTCCAGCAGGAACACGG + Intronic
901290031 1:8116864-8116886 CCCTTTCTGCCCCAGGGTCTTGG + Intergenic
902608583 1:17583317-17583339 CTCACCCAGCAGCAGGGACTGGG + Intronic
903184242 1:21620348-21620370 TCATCTCTGCAGCTGGGACTTGG - Intronic
904206167 1:28856679-28856701 CCCCTTCTGCACCAGGGCCTGGG - Intronic
904321074 1:29698193-29698215 CCCTCCCTGCGGCTGGGTCTGGG - Intergenic
904465594 1:30705410-30705432 CCTGTTCTGCAGCTGGGACTTGG + Intergenic
904474844 1:30758011-30758033 CCTTCTCTGCACCAGGGCCAGGG + Intergenic
904670627 1:32162390-32162412 CCTACTCTTCAGCAGCGACTCGG + Exonic
905010612 1:34744649-34744671 CCCTCTCTCCAGCAGGTGCGGGG + Intronic
905308597 1:37034790-37034812 CCCTCGCAGTAGAAGGGACTGGG - Intergenic
906250612 1:44308129-44308151 GCCTCTCTGGAGCAGGGTGTGGG - Intronic
907496875 1:54851297-54851319 GCTGCTCTGCAGCAGGGGCTGGG - Exonic
909495919 1:76278591-76278613 CATTCTCTGCATCAGGGATTTGG - Intronic
910760339 1:90726282-90726304 ACCTCTCTGAAGCATGAACTTGG - Intergenic
911317707 1:96375467-96375489 CCATCTTTGAAGCAGAGACTAGG + Intergenic
912383076 1:109257974-109257996 CCCCCACAGCAGCAGGGAGTTGG - Intronic
912471797 1:109911477-109911499 CCCACTCCTCAGCAGGGCCTTGG - Intronic
912801579 1:112722914-112722936 CCCTCCCTGCAGCAGGGAGGAGG + Intronic
914196748 1:145451725-145451747 CTGTGTCTGCAGCAGGGCCTGGG - Intergenic
915051929 1:153084295-153084317 CTCTCACTGCAGCAGTGACAGGG - Intergenic
915722476 1:157994601-157994623 TCCAGACTGCAGCAGGGACTGGG + Intronic
916726259 1:167526553-167526575 CCTTCTAGGCAACAGGGACTCGG + Intergenic
917931443 1:179825397-179825419 CCTGCTCTGGAACAGGGACTTGG + Intergenic
918983812 1:191596777-191596799 CCATGCCTGCAGCAGAGACTTGG + Intergenic
919990827 1:202708005-202708027 CCCTTTCTGGAGCTGGGTCTGGG - Intronic
921291116 1:213658468-213658490 GCCTCTCTTCAGCAAGCACTTGG - Intergenic
923439903 1:234007402-234007424 CCTTCTCCGCAGGAGGAACTTGG - Intronic
923590441 1:235313441-235313463 TCCTCTCTGGAGTAGAGACTCGG + Intronic
1063168461 10:3484897-3484919 CCTTCTCAGAGGCAGGGACTTGG - Intergenic
1063411639 10:5840850-5840872 CACTTTCTGCAGCAGGACCTGGG - Intronic
1063821953 10:9846325-9846347 CTCTCTCTGCAGCAGAGAGAGGG - Intergenic
1064381199 10:14843240-14843262 GCCTCTTTCCACCAGGGACTGGG - Intronic
1064699758 10:18006917-18006939 GGGTCTCTGCAGCAGTGACTGGG + Intronic
1065650945 10:27890590-27890612 CCCTCTGTGGAGTAGGGAATGGG + Intronic
1066335049 10:34467885-34467907 CCTTCTCTGCAGAAGAGCCTGGG - Intronic
1066604408 10:37146084-37146106 ACCACTGTGCAGCAGGGGCTTGG - Intronic
1068468218 10:57424167-57424189 CTCTCTCTGGAGCACGGATTAGG + Intergenic
1068721905 10:60254928-60254950 CCCTCCCAGCACCAGGTACTGGG + Intronic
1068851847 10:61751257-61751279 CCCACTCTGCTGCAAGCACTGGG + Intronic
1069637635 10:69935433-69935455 CCCTCTCCACAGCAGTCACTGGG + Intronic
1070144101 10:73761152-73761174 CCTTCTGTGGAGCAGTGACTGGG + Intronic
1070441209 10:76445346-76445368 CCCTCTTTGCTTCAGGGTCTTGG + Intronic
1070782181 10:79143994-79144016 CCAACTCTGCATCGGGGACTAGG + Intronic
1071703618 10:87971961-87971983 CCATATATACAGCAGGGACTTGG - Intergenic
1073603813 10:104873081-104873103 CCCTTTCTGCAGCAGAGAGCTGG + Intronic
1074148828 10:110740462-110740484 CTCCCTCTGCAGCAGGGCCTTGG - Intronic
1075259417 10:120949716-120949738 TCATCTCCGCAGCAGGGACGAGG + Intergenic
1075424176 10:122328567-122328589 CCCTCTGTCCAGCTGGGACAGGG + Intronic
1075552200 10:123400871-123400893 CCCCCTCTGGGGCAGGGACTGGG + Intergenic
1076178261 10:128385388-128385410 CCCCCTCTCCAGCAGCGCCTTGG - Intergenic
1076209039 10:128625930-128625952 GTCTCTCTGCAGCAGGGAGTAGG + Intergenic
1076242866 10:128923058-128923080 CCATCTCTTCAGCAGGCAGTGGG + Intergenic
1076276049 10:129199750-129199772 CCTTCTCTGAAGGAGGGAGTGGG - Intergenic
1076586193 10:131549273-131549295 CCTTCTGTGCAGCAGGTCCTGGG - Intergenic
1076844292 10:133061468-133061490 CCGTCTCTGCAGCCGGCACCCGG - Intergenic
1077046704 11:549887-549909 CCCTGCCTTCTGCAGGGACTTGG + Exonic
1077187195 11:1240677-1240699 CCGTTTCTGCATGAGGGACTGGG - Intronic
1077486902 11:2843047-2843069 CCCACACTGCTGCAGGGCCTTGG - Intronic
1079251288 11:18790105-18790127 CCCTCTCTGCACCAGGCATCAGG + Intronic
1082963508 11:58941709-58941731 GCCTCTCTGCTTCAGGCACTTGG - Intronic
1083655163 11:64225999-64226021 CCCTCTCTGCAGCAGGGACTTGG - Intronic
1083763588 11:64831822-64831844 CACTGTCAGCAGCAGGGAGTAGG + Intronic
1085055003 11:73398293-73398315 GCCTGTCTGCAGCAGGCACAGGG + Intergenic
1086416403 11:86592836-86592858 CCCTTTCTGAAGGAGTGACTAGG - Intronic
1086701195 11:89901848-89901870 CCCTGACTGCAGCAGGTGCTGGG + Intergenic
1086704972 11:89942679-89942701 CCCTGACTGCAGCAGGTGCTGGG - Intergenic
1087137462 11:94735184-94735206 CCACCTCTGCAGCAGAGGCTGGG + Intronic
1088215834 11:107508090-107508112 AGCTCTATGAAGCAGGGACTGGG + Intronic
1089326444 11:117660665-117660687 CCCTCTCGGCAGCTGGGTCCCGG - Intronic
1089785294 11:120903230-120903252 TCCCCTCTGCAGCCGGGCCTTGG + Intronic
1090094366 11:123729173-123729195 TCCTCTCTGCAGGAAGGTCTGGG + Exonic
1091398172 12:166882-166904 CCCACTCTGCAGCTGAGGCTCGG + Intronic
1091744230 12:2981080-2981102 CCCACTCTGCATCAGGCACTGGG - Intronic
1095096012 12:38149693-38149715 CCCTGACTCCACCAGGGACTTGG - Intergenic
1095165048 12:38962319-38962341 CCCTCTCTGCACAACGGCCTGGG + Intergenic
1096467036 12:51852275-51852297 CCCTCTATGCAGCTCAGACTTGG + Intergenic
1096560748 12:52434170-52434192 CCCGCTCTGCAGCAGGGAGTGGG - Exonic
1096629203 12:52914847-52914869 CCCTTCCTGCAGCAGGGAGATGG - Intronic
1096803940 12:54128746-54128768 CCCTCTCAGCAGTAGGCACAAGG - Intergenic
1097279781 12:57837782-57837804 CCCTCTCTGCACCAGCAACTGGG + Intronic
1098148984 12:67526890-67526912 TCCTCACTGCAGCGGGGAATTGG - Intergenic
1098633067 12:72748325-72748347 CCTACTCTTCAGCAGAGACTGGG + Intergenic
1099091238 12:78311842-78311864 CCCTCTATGCACCAGGAAATGGG + Intergenic
1103560466 12:121790763-121790785 TCCCCGCTGCAGCAGGGTCTGGG + Intronic
1104049148 12:125184845-125184867 CCCTCTTGGCAGCCGGGAGTGGG + Intergenic
1104722801 12:131054771-131054793 CCCTCGCTGCTGCAGCGTCTGGG + Intronic
1104755074 12:131264185-131264207 CTCTCCCTGCAGCAGGGAGGGGG + Intergenic
1104773484 12:131379208-131379230 CCCTGTCTGCAGCTGGGATCTGG - Intergenic
1106131795 13:26946895-26946917 TCCTCTGAGCAGCAGGGTCTGGG + Intergenic
1107565026 13:41593549-41593571 CCCTCCCTGCACCAGTGATTGGG + Intronic
1113442305 13:110338660-110338682 CCATCTCTGCAGCTGGGAAAAGG + Intronic
1113740769 13:112710985-112711007 CGCTGTTTGAAGCAGGGACTCGG + Intronic
1113977953 13:114245468-114245490 CACTCTGAGCAGCAGGGATTCGG - Intronic
1115754483 14:36518561-36518583 CCCTCTCTCCAGCGGAGTCTGGG - Intronic
1116937562 14:50757862-50757884 CCCTTGCTGAAGCAGGGACAGGG + Exonic
1120717942 14:87860320-87860342 TCCTCCCTGCAAAAGGGACTTGG - Intronic
1121007573 14:90500145-90500167 CTTTCTCTGCACCAGGCACTGGG - Intergenic
1122232935 14:100316134-100316156 CCCTCTCCAGAGCAGGGCCTGGG - Intergenic
1122891841 14:104735643-104735665 GTCCCTCTGCAGCACGGACTGGG - Intronic
1123466313 15:20518778-20518800 GCCGCTCTGCAGCATGGCCTGGG - Intergenic
1123651801 15:22482260-22482282 GCCGCTCTGCAGCATGGCCTGGG + Intergenic
1123742220 15:23291119-23291141 GCCGCTCTGCAGCATGGCCTGGG + Intergenic
1123744774 15:23311425-23311447 GCCGCTCTGCAGCATGGCCTGGG - Intergenic
1123761104 15:23433366-23433388 GCCGCTCTGCAGCATGGCCTGGG - Intergenic
1123768300 15:23503614-23503636 AGCTCTCTGCAGCAGAGAGTGGG + Intergenic
1124268185 15:28256156-28256178 GCCACTCTGCAGCACGGCCTGGG + Exonic
1124277040 15:28334756-28334778 GCCGCTCTGCAGCATGGCCTGGG - Intergenic
1124305660 15:28576850-28576872 GCCGCTCTGCAGCATGGCCTGGG + Intergenic
1125201236 15:37101915-37101937 CACTCTCTGGGCCAGGGACTGGG - Intergenic
1125381710 15:39092935-39092957 CCCTGTCTGCAGCAGTGGTTTGG + Intergenic
1126696618 15:51331264-51331286 GCCTCTCTGCAGGAAGGCCTCGG - Intronic
1126974660 15:54161915-54161937 CCCTCTCTGTAGCCCAGACTGGG - Intronic
1128511506 15:68316448-68316470 CCTTCTCTGCAGGAGTGGCTGGG + Intronic
1128729134 15:70008958-70008980 CCTTCTTTGCACCAGGGCCTGGG + Intergenic
1128778423 15:70341695-70341717 CCCTCCATGCAGCAGGGGCATGG - Intergenic
1129516152 15:76158982-76159004 CCCTCCCTGCTGAAGGCACTGGG + Intronic
1129932568 15:79424531-79424553 CTCACGCTGCAGCAGGGATTTGG - Intronic
1130739352 15:86581850-86581872 CCCTCTCTTCATCAAGGACATGG + Intronic
1130948294 15:88565991-88566013 CTGACTCTGCAGCAGGCACTGGG + Intergenic
1132007393 15:98241203-98241225 ACCTCTCTGCAGGAGAGGCTGGG - Intergenic
1132520293 16:384155-384177 CCCAGCCTGGAGCAGGGACTGGG - Intronic
1132691318 16:1183075-1183097 CACCCCCAGCAGCAGGGACTGGG + Intronic
1132802956 16:1763166-1763188 CCCTCCCTGCAGCGGGGAGCTGG + Intronic
1132828559 16:1916814-1916836 TCCTCCCTGCAGCAGGGATTAGG + Intronic
1132829578 16:1920749-1920771 CCCTCCCTCCATCAGGCACTCGG + Intergenic
1132933798 16:2471309-2471331 CCCTCGCTGCAGCCGGGAGGAGG + Intergenic
1133056040 16:3145906-3145928 CCCTCTCTGCAGCCGGCCCCCGG + Exonic
1133738552 16:8633777-8633799 CCTTCTCTGCATGAGGCACTGGG - Intronic
1133926058 16:10193426-10193448 CTCACTCTGCAACAGGTACTAGG + Intergenic
1134303507 16:13012306-13012328 CCCTCTCTGCAGAAGTGACCTGG + Intronic
1135068876 16:19335035-19335057 ACCTCACTGCAGGAGAGACTGGG + Intergenic
1136138885 16:28276192-28276214 CCCACTCTGTAGCAAGGTCTGGG - Intergenic
1137037726 16:35580475-35580497 CTCTCACTGCAGCAGTGACATGG - Intergenic
1138039870 16:53651518-53651540 CCCCCTTTGCTGCAGGCACTGGG + Intronic
1138443706 16:57050259-57050281 CCCTTTCTGCCCCAGGGACTGGG - Intronic
1138920450 16:61522171-61522193 GCCTCTCTGAGGCAGGAACTTGG + Intergenic
1140629197 16:76831592-76831614 CAATCTCTGAAGCAGGGGCTGGG + Intergenic
1141390976 16:83663255-83663277 CACTGTTTTCAGCAGGGACTGGG + Intronic
1142016771 16:87753031-87753053 CCTTCCCTGGAGCAGGGACAAGG + Intronic
1143101161 17:4505600-4505622 CCCTATCTGCAGAAGAGACAGGG - Intronic
1143106373 17:4532478-4532500 CTCCTTCTGCAGCAGGGACGAGG + Intronic
1143269914 17:5667895-5667917 CCCTCTCTGGGGCAGGGACCTGG - Intergenic
1143965137 17:10751601-10751623 TCCTCTCAGCAGCAGGGAGCAGG + Intergenic
1145322723 17:21775834-21775856 CTCAATCTGCAGCAGGGACAGGG + Intergenic
1145796814 17:27660430-27660452 CCCTCTCAGCAGGAAGGACAGGG + Intergenic
1145811206 17:27765418-27765440 CCCTCTCAGCAGGAAGGACAGGG + Intronic
1145910276 17:28538245-28538267 CCCTTCCTGCACCCGGGACTGGG - Exonic
1146275184 17:31511935-31511957 CCCTGTCCCCAGCAGGGAGTGGG - Intronic
1146369858 17:32258917-32258939 CCCTCACTGGAGCAGGTGCTGGG + Intergenic
1146845520 17:36179393-36179415 CCATCTCTGCAGCAGGGTGGGGG - Intronic
1146873736 17:36391234-36391256 CCATCTCTGCAGCAGGGTGGGGG - Intronic
1146881094 17:36442324-36442346 CCATCTCTGCAGCAGGGTGGGGG - Intergenic
1147065653 17:37921637-37921659 CCATCTCTGCAGCAGGGTGGGGG + Intergenic
1148149161 17:45385798-45385820 ACCTCTCTGCAGCCTGGAATTGG - Intergenic
1148772462 17:50075348-50075370 GCCTCTCTCCAGAAGGGCCTCGG + Intronic
1149129490 17:53280848-53280870 CACTGCCTGCAGCAGGGATTAGG + Intergenic
1150470265 17:65431290-65431312 CCTCCTCTGCAGCAGGGGCATGG + Intergenic
1150611810 17:66739441-66739463 CCTGCTCTGCACCAGGCACTGGG + Intronic
1151448005 17:74179785-74179807 GCCACTCTGCTGCAGAGACTCGG + Intergenic
1151678095 17:75610225-75610247 CCGCCTCTGGAGCAGGGGCTGGG - Intergenic
1151977907 17:77492754-77492776 CCCACCCTTCAGCAGGAACTGGG - Intronic
1152270782 17:79323620-79323642 GCCTCCCTGCAGCGGGGGCTCGG + Intronic
1152318639 17:79595584-79595606 CACTCCCTGCAGCAGGGGATTGG - Intergenic
1152430654 17:80246738-80246760 CCCTCTGTGGGGCTGGGACTGGG + Intronic
1152727802 17:81956276-81956298 CCCTCCCTGCTGCAGGGTCCTGG - Intronic
1153773465 18:8433478-8433500 ACCTCTTTGCAGGAGGCACTTGG - Intergenic
1154477749 18:14781023-14781045 ACCACTGTGCAGCAGGGGCTTGG - Intronic
1157447176 18:47754551-47754573 CCCTTTCTGGAGCAGGGAAGGGG - Intergenic
1157553570 18:48597956-48597978 CTCTGCCTGCAGCAGGGCCTAGG + Intronic
1157603919 18:48913776-48913798 CTCTCTCTGCCACAGGGACCTGG - Intergenic
1158412589 18:57221318-57221340 CCCTCTCTGATGCAGGGACTTGG - Intergenic
1159016285 18:63104123-63104145 CCCTCTCTGCTGCAGGGTGGAGG + Intergenic
1160232127 18:77056509-77056531 CCCTGCCTCCCGCAGGGACTGGG - Intronic
1160307098 18:77750114-77750136 GCCTGTCTGCATCATGGACTGGG - Intergenic
1163385947 19:17000668-17000690 CCCTCCCTGCAGCCTGGAATCGG + Intronic
1163900688 19:20096902-20096924 CCCTACCTTCAGCAGGCACTTGG + Intronic
1165112317 19:33509585-33509607 CCCTGGCTGCCACAGGGACTGGG - Intronic
1165170506 19:33888645-33888667 GCCACTCTGCAGATGGGACTGGG - Intergenic
1165223823 19:34339890-34339912 GCTTCTCTGCAGCAGGGACATGG - Exonic
1165282266 19:34807469-34807491 ACCTCTGTGCAGTAGGGACAAGG + Intergenic
1165905561 19:39192527-39192549 CCCTCTCTCCAGCAGGGGGATGG - Intergenic
1167009712 19:46799265-46799287 GCCTCTCACTAGCAGGGACTTGG - Intergenic
1167853872 19:52222202-52222224 CCCTATCTTCTGCAGAGACTTGG - Exonic
926225684 2:10965362-10965384 CCCTCCCTGCACCAGGCATTGGG + Intergenic
926735427 2:16070093-16070115 CCCTCCCTGCAGCACCCACTCGG + Intergenic
928103756 2:28454250-28454272 AGCTCTCAGCAGCAGGGGCTGGG - Intergenic
929279591 2:40063526-40063548 CCATTTAGGCAGCAGGGACTGGG + Intergenic
929593343 2:43160817-43160839 CCCTATCTGCAGCCTGCACTAGG - Intergenic
931409831 2:62018900-62018922 CCCTCTTGGCAGCAGAGACCAGG - Intronic
934218933 2:90063588-90063610 ACCTCTCAGCAGAAGAGACTGGG - Intergenic
934744703 2:96751490-96751512 CAGTTTCTGCTGCAGGGACTTGG - Intergenic
935326958 2:101946200-101946222 CCATCTCTGAAGCAGGAAGTGGG + Intergenic
936398790 2:112150210-112150232 CCATCTCTGAAGGAGGGGCTGGG + Intronic
937949364 2:127371925-127371947 CCCAGTTTGCAGCAGGGCCTGGG - Intronic
939471804 2:142631632-142631654 CCCTCTCTGCAGCAGTAGATTGG - Intergenic
939471889 2:142633125-142633147 CCCTCTCTGCAGCAGTAGATTGG + Intergenic
942281923 2:174374019-174374041 GCCCCTCTGCAACAGGGGCTTGG + Intronic
944114225 2:196170894-196170916 CCCACGCCGCAGCTGGGACTCGG + Intronic
944535699 2:200707470-200707492 TCCTCTCTGCATCAGGGGGTGGG + Intergenic
944609802 2:201391029-201391051 CCCTCTCAGCAGGTAGGACTAGG - Intronic
945967254 2:216201712-216201734 CCCTTTCTGCAGAAGAGATTCGG + Intronic
947478090 2:230469813-230469835 CCCTCTCTGAGGCTGGGGCTGGG - Intronic
947820249 2:233064122-233064144 CCCTCTCTGCAGGAGCAGCTGGG + Intronic
947857957 2:233337169-233337191 TCCTCTCTTCACCAGGTACTTGG + Intronic
948075738 2:235164037-235164059 CCCTCACTCCAGCATGGCCTTGG + Intergenic
948398390 2:237664066-237664088 GTCTCTCTGCAGCATGGACATGG - Intronic
1171385610 20:24767679-24767701 GCTTGGCTGCAGCAGGGACTGGG - Intergenic
1172025046 20:31942857-31942879 CCCTCTTCCCAGCAGGGAGTTGG + Intronic
1172173515 20:32958924-32958946 TCCTCTCAGGATCAGGGACTTGG - Intronic
1173716209 20:45208873-45208895 CCCTCTCCTCACCAGGGAATGGG - Intronic
1175215588 20:57390372-57390394 CCACCTCTGAAGCCGGGACTAGG - Intergenic
1175245454 20:57579404-57579426 CCGTCTCCACAGCAGGGGCTGGG + Intergenic
1175400435 20:58697058-58697080 CCTCTTCTGTAGCAGGGACTGGG + Intronic
1175773871 20:61641090-61641112 CCCTCTCAGCTGCAGGCGCTGGG + Intronic
1175882726 20:62270182-62270204 CCTCGTCTGCACCAGGGACTAGG - Intronic
1175998290 20:62821050-62821072 CCCTCTGTGAAGTGGGGACTTGG + Intronic
1176103801 20:63376418-63376440 CTTCCTCTGCAGCAGGGACTGGG - Intronic
1176285497 21:5016923-5016945 TCCTCTCAGCAGCAGGCACTGGG + Intergenic
1179608018 21:42530820-42530842 CATTCTCTGCAGCAGGTACGTGG - Intronic
1179713284 21:43275103-43275125 CCATCACTGCTGCAGGGCCTGGG - Intergenic
1179871684 21:44246552-44246574 TCCTCTCAGCAGCAGGCACTGGG - Exonic
1179955301 21:44735029-44735051 CCCTCCCTGCAGCCGGGGCCTGG - Intergenic
1179983951 21:44910886-44910908 CACCCCCTGCAGCAGGGACAGGG - Intronic
1180170982 21:46058065-46058087 GCCTCTCTTCAGCAGGGAGACGG + Intergenic
1181601577 22:23955366-23955388 CCCTCTCCCCATCAGGCACTGGG - Intergenic
1181606923 22:23985932-23985954 CCCTCTCCCCATCAGGCACTGGG + Intergenic
1182879837 22:33723944-33723966 CCATTTCTGAAGCAGGGAATTGG - Intronic
1183784700 22:40022662-40022684 CTCTCTCTGCAGCAGTCTCTGGG + Intronic
1183796862 22:40126185-40126207 GCCTCTGTGCAGCAGGAACAGGG - Intronic
1183799210 22:40147528-40147550 CCCTCTTAGAAGCAGGGATTGGG - Intronic
1183976086 22:41513131-41513153 CCCTCTCTGCAGCAGGGTTAGGG + Intronic
1184608112 22:45585976-45585998 CCCTCCCTGCAGCAGCTCCTGGG + Intronic
1184903815 22:47465197-47465219 CCCTCACTGCTGCAGGTTCTGGG - Intronic
1185145580 22:49133826-49133848 CCCTCTCTGCAGGCTGGACTAGG + Intergenic
1185269759 22:49923894-49923916 TCCTCCCTGCTGCTGGGACTGGG - Intronic
1185333727 22:50262468-50262490 CACTCTCTCCAGCAGGGATGGGG + Intergenic
1185388287 22:50546558-50546580 CCGGCGCTGCAGCAGGGACAGGG - Intergenic
950046610 3:9952050-9952072 ATCTCTCTGCCGCAGGGACTGGG + Intronic
951870479 3:27356124-27356146 CCATCTTGGAAGCAGGGACTGGG + Intronic
953025762 3:39144004-39144026 CCCTCCCTGCAGCAGCCACAGGG + Exonic
953269433 3:41425590-41425612 ACCTCTCAGCAGAAGAGACTGGG + Intronic
954441821 3:50526268-50526290 CCCTCCCCGCAGCAGGGTCAGGG + Intergenic
955867356 3:63399212-63399234 CCCTCAATGCAGCAGGCACTGGG - Intronic
955995090 3:64672238-64672260 CCTTTTCTTCAGCAGGGAATGGG + Intronic
956674889 3:71724833-71724855 CTCTCCCTGCAGCAGGGACGCGG + Intronic
957823413 3:85408673-85408695 CTCTCTCTGCAGCGGGGGTTAGG + Intronic
961123889 3:124398682-124398704 CCCACTCTGCCACAGGGACTCGG + Exonic
962185842 3:133258567-133258589 CCCTCTGAGCTGCAGGGACAGGG - Intronic
962835589 3:139185749-139185771 CCGGCTCTGCAGCTGAGACTGGG - Intronic
965427063 3:168539485-168539507 CCCTCTTTGCAACAGTCACTTGG - Intergenic
967038199 3:185663996-185664018 CCCTCTGGGCACCAGGGACATGG + Intronic
967438380 3:189477785-189477807 CCCTCTCTGCGGCAGGGCCAAGG - Intergenic
968135020 3:196214931-196214953 CCCACTGGGCAGCAGAGACTGGG - Intronic
968703713 4:2068791-2068813 CCCTCAGTGGAGCAGGGCCTGGG + Exonic
968953585 4:3707115-3707137 CCCTTTCTGAAGGAGGGACGTGG - Intergenic
969265806 4:6063503-6063525 CCCTCCCTCCAGCCGGCACTTGG + Intronic
969385756 4:6846248-6846270 ACAGCTCTGGAGCAGGGACTGGG - Intronic
969598755 4:8163476-8163498 CTCTCTCTTCAGCAGGGCCTGGG - Intergenic
969626633 4:8308987-8309009 CCATCTGTGCAGCAGGGAGGTGG + Intergenic
969671150 4:8591058-8591080 CCCGCTCTGCAGCAAGTGCTGGG + Intronic
969710598 4:8840909-8840931 CCCTCTCTCCAGGAAGCACTGGG - Intergenic
970583639 4:17495036-17495058 CCCTCCCTGCCGCAGTCACTGGG - Intronic
971502358 4:27330891-27330913 CTCTACCAGCAGCAGGGACTGGG + Intergenic
973109476 4:46379080-46379102 CCCATTCTGCAGCAAGGAGTGGG + Intronic
973919731 4:55673106-55673128 CCCTCCCTGCCTCAGGGCCTGGG + Intergenic
975936615 4:79589062-79589084 CCCTGGCTTGAGCAGGGACTGGG + Intergenic
980472739 4:133269234-133269256 CCCTCTCTGCACTTGGGAGTTGG + Intergenic
981320812 4:143388994-143389016 CCTTCTCTGCAGAGTGGACTGGG - Intronic
984274852 4:177597323-177597345 TCGACTCTGGAGCAGGGACTCGG - Intergenic
985868165 5:2532812-2532834 CCCTCTCTGCAGCCTGAAGTAGG + Intergenic
986704269 5:10442145-10442167 CGCTCTCCGCAGAAGGGACCAGG - Exonic
987060691 5:14240604-14240626 CCCTTTCAGCTGCAGGGAGTGGG + Intronic
990936177 5:61152127-61152149 ACCTCTCTGCAACAGTGTCTAGG + Intronic
991012800 5:61901388-61901410 CCTTCTCTGCATCAGGGAAATGG + Intergenic
992597536 5:78360979-78361001 TCGTGTCTGCAGCCGGGACTGGG + Intronic
998420118 5:141977097-141977119 GCCTCTCTTGAGAAGGGACTGGG + Intronic
998465772 5:142342562-142342584 GCCTCTCATCAGCAGTGACTTGG - Intergenic
998527685 5:142857528-142857550 CCCTTGCTGCAGGAGGGACGAGG - Intronic
999450065 5:151671423-151671445 CCCTCTTTCCTGCTGGGACTAGG + Intronic
1000837629 5:166176154-166176176 AACTCTCTGAAGCTGGGACTTGG - Intergenic
1001601889 5:172934357-172934379 CCCTCCCTCCCTCAGGGACTTGG - Intronic
1001644442 5:173269723-173269745 CCCTCAATGCACCAGGGGCTGGG - Intergenic
1001749888 5:174120805-174120827 GCCTCTCTGCAGCATGCATTTGG - Intronic
1002108878 5:176894584-176894606 AACTGTCTGCAGCAGGGTCTGGG + Intronic
1002578852 5:180195047-180195069 TGTTCTCTGCAGCAGGCACTGGG - Intronic
1002621642 5:180492606-180492628 CCCTCTCCCCAGCACGGCCTTGG - Intergenic
1004173176 6:13315091-13315113 CCCTGTCTGCAGTAGAGGCTGGG - Intronic
1005690235 6:28297659-28297681 CCCTCTCTGCAGCTGGGCTTTGG + Intronic
1005759255 6:28952513-28952535 CTCTTTTTGCAGCACGGACTGGG + Intergenic
1006255638 6:32830086-32830108 CCACCTGTGCAGCAGGGACAGGG + Exonic
1006471882 6:34234257-34234279 CCTACTCTGTAGCAGGAACTGGG - Intergenic
1007780971 6:44254564-44254586 CCAGCTCTGCAGCAGGGGATTGG - Exonic
1008879968 6:56371904-56371926 AGCTCTGTGGAGCAGGGACTTGG - Intronic
1009715304 6:67385219-67385241 CCCTATCAGCAGCAGAGAGTGGG + Intergenic
1009871085 6:69452464-69452486 CCCAGTCTGCAGCAGGAGCTGGG + Intergenic
1010414858 6:75601779-75601801 CCCCCTCAGCAGCCCGGACTCGG - Intronic
1011394293 6:86890286-86890308 CTCTCTAAGCAGGAGGGACTGGG + Intergenic
1012840299 6:104321126-104321148 CCCAGACAGCAGCAGGGACTTGG + Intergenic
1013150887 6:107445453-107445475 CCAACACTGCAGCAGGAACTGGG + Intronic
1014865366 6:126522099-126522121 CCCTCTCAGCATCAGTGGCTTGG - Intergenic
1015376155 6:132512875-132512897 TGCGCTCTGCAGCAGGCACTCGG - Intronic
1015656096 6:135520894-135520916 CTCTCTCAGCAGCTGGGACCCGG + Intergenic
1017774837 6:157672776-157672798 CTCGCTCTGCAGCAGGGGCGTGG - Exonic
1017995464 6:159528130-159528152 CCCTCTCTGTAGCAGGGGACAGG - Intergenic
1018057980 6:160068833-160068855 TACTCTCTGCAGCATGGACGTGG + Intronic
1018340846 6:162849420-162849442 CTTTCTCAGCAGCAGGCACTGGG - Intronic
1019033604 6:169034882-169034904 TCCTGTCTGCTGCTGGGACTGGG + Intergenic
1019565981 7:1679344-1679366 CCCTCCCTGCAGGAGGCTCTGGG + Intergenic
1019995390 7:4721142-4721164 CCCTCTGTGCATCAGGGCCCTGG + Intronic
1020257752 7:6511335-6511357 CTCTCTGGGCAGCAGTGACTTGG - Intronic
1022477578 7:30721884-30721906 CCATCTCTGCAGTTGGGGCTGGG + Intronic
1022844692 7:34198125-34198147 CCCACTCTCCAGAAGGGAGTGGG - Intergenic
1023055101 7:36284671-36284693 CCCTCTCCGCTGCAGGGAGCTGG + Exonic
1023494897 7:40784591-40784613 TCTTTTCTGTAGCAGGGACTGGG + Intronic
1024527368 7:50360213-50360235 GCCTCCCTGAAGCAGGGCCTGGG + Intronic
1024979420 7:55145058-55145080 CTCACCCTGCAGCAGGCACTAGG - Intronic
1029508960 7:100981353-100981375 CACTCGCTGCAGGAGGGACAAGG - Intronic
1030153063 7:106425641-106425663 CCCTCCCTGCAGCCAGGCCTGGG - Intergenic
1031965539 7:128025648-128025670 CCTCCTCTGTAGCAGGCACTTGG - Intronic
1032128159 7:129209488-129209510 TGCTGTCTGCAGCAGGGACCTGG - Intronic
1032564931 7:132931880-132931902 CCCACTGTGCAGCAGGCAGTGGG + Intronic
1033235257 7:139633233-139633255 CCCTTTCTGCAGCCTGGAGTGGG + Intronic
1033635611 7:143209127-143209149 CCCTCTCTCCAGCAAGGCCTGGG + Intergenic
1034733099 7:153405019-153405041 CCCACACTGTATCAGGGACTCGG - Intergenic
1035373395 7:158393038-158393060 CCTTCTCTGCAGCAGGCACAGGG - Intronic
1037884633 8:22589584-22589606 CCCACCCTGCAGCATGGACTCGG + Exonic
1037948488 8:23004088-23004110 CCCTCTCTGGAGAGGGGACAGGG + Intronic
1038411550 8:27363107-27363129 CCCTCATTGGAGTAGGGACTAGG + Intronic
1042403106 8:68372388-68372410 TCTTCTCAGCAGGAGGGACTGGG - Intronic
1043121194 8:76326712-76326734 CCCTCTCCTCACCAGAGACTAGG + Intergenic
1047071463 8:121348801-121348823 CTCTCTCTGCAGCTGGCACGTGG - Intergenic
1047529864 8:125664928-125664950 CCCTCTCCCCAGCTGTGACTGGG - Intergenic
1047952044 8:129943151-129943173 GCCCCTCCGGAGCAGGGACTTGG - Intronic
1048002381 8:130389568-130389590 CCCTCTCTGGGGAAGGAACTGGG - Intronic
1049428634 8:142549153-142549175 CCCTCTGGGAAGCAGGGCCTGGG - Intergenic
1049563796 8:143326926-143326948 TCCTCTCAGAAGCAGGGACTGGG - Intronic
1049775447 8:144401789-144401811 CCCTCTCTGCAGCAGGGAGAAGG + Intronic
1049924312 9:394068-394090 ACCTCACTGCAGCAGGGATGAGG + Intronic
1050210680 9:3252248-3252270 CCTACTCTGCGGCAGGGTCTTGG + Intronic
1050625600 9:7500785-7500807 CCTTCTCTGCTGCAGAGACCCGG - Intergenic
1052988068 9:34502345-34502367 CCCCCTCTGCTGCAGCTACTGGG + Intronic
1056896179 9:90552787-90552809 CCCTCTAGGCACCTGGGACTTGG - Intergenic
1057051026 9:91924291-91924313 CTCTCTCCACCGCAGGGACTAGG - Intronic
1059142956 9:111871190-111871212 CCCTCTATGAAGCAGGGAATGGG + Intergenic
1059222967 9:112643281-112643303 CCCTCTCTGTGCCAGGCACTGGG - Intronic
1059330008 9:113528928-113528950 CCCTCTGGGCATCAGGTACTGGG - Intronic
1059438240 9:114289062-114289084 CCCTCCCTGCAGGAGGGTCTGGG + Intronic
1061055789 9:128222324-128222346 GCCTCACTGCAGCAGGGCCTTGG - Exonic
1061072981 9:128323073-128323095 CCCTTTCTGCAGCGGGGAGGTGG - Exonic
1061087194 9:128405983-128406005 CCTTCTCAGCAGCAGGAGCTGGG + Intergenic
1062065214 9:134523084-134523106 CCCTCTCTGCAGCGTGGCCAGGG + Intergenic
1062267481 9:135693922-135693944 GCCTCTGTGCAGCGGGGACAGGG - Intronic
1062315897 9:135966894-135966916 GCCCCTCTGCAGCATGGTCTTGG - Intergenic
1062635404 9:137487912-137487934 CCCTCACTGCAGCTGAGCCTTGG + Intronic
1062697984 9:137885109-137885131 CTGTGTCTGCAGCAGGGCCTGGG + Intronic
1186668587 X:11745366-11745388 CCTTTTCTGCAGCAGTGTCTGGG + Intergenic
1187011901 X:15288016-15288038 GCCTCGCTGCAGCATGGAGTGGG + Exonic
1188055122 X:25531731-25531753 CCCTCTCTCCACCTTGGACTTGG + Intergenic
1189288706 X:39870302-39870324 CTCCCTCTCCTGCAGGGACTAGG - Intergenic
1193580786 X:83260215-83260237 CACTCGCTGCAGCAGGGGCAAGG - Intergenic
1194756043 X:97741204-97741226 CCCTCTCTGGAGAAGGGGCTGGG + Intergenic
1195272942 X:103251029-103251051 TCCAGTCTGCAGCAGGTACTAGG - Intergenic
1195544662 X:106101069-106101091 CCCCCTCTGCAGGAGTCACTGGG + Intergenic
1197764856 X:130053483-130053505 CCCTCTCTGAAACAGGATCTTGG + Intronic
1200252096 X:154559200-154559222 CCCGCTCTGCTGCTGGGAGTCGG - Intronic
1200265672 X:154645216-154645238 CCCGCTCTGCTGCTGGGAGTCGG + Intergenic