ID: 1083655867

View in Genome Browser
Species Human (GRCh38)
Location 11:64229369-64229391
Sequence CTGGGTCTTGGGAAGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 596
Summary {0: 1, 1: 0, 2: 3, 3: 63, 4: 529}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083655858_1083655867 4 Left 1083655858 11:64229342-64229364 CCAGTGAGTAGGCTCGGGTACAT 0: 1
1: 0
2: 0
3: 3
4: 29
Right 1083655867 11:64229369-64229391 CTGGGTCTTGGGAAGGTGGGTGG 0: 1
1: 0
2: 3
3: 63
4: 529
1083655854_1083655867 17 Left 1083655854 11:64229329-64229351 CCGAGTTCTATGTCCAGTGAGTA 0: 1
1: 0
2: 1
3: 5
4: 124
Right 1083655867 11:64229369-64229391 CTGGGTCTTGGGAAGGTGGGTGG 0: 1
1: 0
2: 3
3: 63
4: 529
1083655852_1083655867 28 Left 1083655852 11:64229318-64229340 CCGAGCCAGTGCCGAGTTCTATG 0: 1
1: 0
2: 2
3: 5
4: 90
Right 1083655867 11:64229369-64229391 CTGGGTCTTGGGAAGGTGGGTGG 0: 1
1: 0
2: 3
3: 63
4: 529
1083655853_1083655867 23 Left 1083655853 11:64229323-64229345 CCAGTGCCGAGTTCTATGTCCAG 0: 1
1: 0
2: 1
3: 10
4: 97
Right 1083655867 11:64229369-64229391 CTGGGTCTTGGGAAGGTGGGTGG 0: 1
1: 0
2: 3
3: 63
4: 529

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083655867 Original CRISPR CTGGGTCTTGGGAAGGTGGG TGG Intronic
900372088 1:2336639-2336661 CTGGGTGTTGAGGTGGTGGGTGG + Intronic
900537327 1:3185395-3185417 CTGGGTCTTGGGGAGGCTGGTGG - Intronic
900594040 1:3472375-3472397 CTGGGTCATGGGGAGGTGAGGGG + Intronic
900637475 1:3672984-3673006 CTGGGTATGAGGAGGGTGGGTGG - Intronic
901081124 1:6584819-6584841 CTTGGCCTCTGGAAGGTGGGAGG + Intronic
901516353 1:9749409-9749431 CTGGCTTTGGTGAAGGTGGGAGG - Intronic
902266161 1:15266751-15266773 AGGGGTCAGGGGAAGGTGGGGGG - Intronic
902332380 1:15736889-15736911 CTGGGTCATGGGATGGTGGAGGG - Intronic
902411252 1:16212729-16212751 CCGGTTCTGGGGAAGGGGGGCGG - Intergenic
903280851 1:22249033-22249055 CTGGGTGTGGGGCAGGGGGGAGG + Intergenic
903567427 1:24278710-24278732 CTGGGTCCTGGCAGAGTGGGTGG + Intergenic
903813777 1:26049767-26049789 CTGAGTCTGGAGATGGTGGGAGG - Intergenic
904435431 1:30491914-30491936 CTGGGTCTGGGGAAGGAAGCTGG - Intergenic
904471940 1:30741548-30741570 CTGGGTGCTGAGAGGGTGGGAGG - Intronic
904562870 1:31410480-31410502 CTTGGTCTTGGGCAGGCAGGAGG + Intronic
904790397 1:33016026-33016048 CTGGGTTATGGGCAGGAGGGAGG + Intronic
905500814 1:38434720-38434742 CTGGGTCTTAGGGAGGGGGATGG + Intergenic
905970558 1:42138693-42138715 CTGGGTATGGGGAGAGTGGGAGG - Intergenic
906624481 1:47313968-47313990 CGGGGCCCTGGGAAGGTTGGTGG - Intronic
906662174 1:47590719-47590741 CTGGTACATGGGAAGGTGGGAGG + Intergenic
907300632 1:53484460-53484482 CTGGGTCTGGGGGACATGGGAGG + Intergenic
911088708 1:94000968-94000990 CCAGGGCTGGGGAAGGTGGGTGG - Intronic
911174868 1:94808559-94808581 CAGGGTCTTAGGTAAGTGGGTGG - Intergenic
912329397 1:108803920-108803942 TTAGCTCTTGGGAAGGTGGAGGG + Intronic
912345148 1:108956855-108956877 CTGGGTCTTGGGAATGAGCTGGG + Intronic
912449503 1:109760502-109760524 CTGGGCCCTGGGCAGGGGGGTGG - Intronic
912666011 1:111580328-111580350 ATGGAGCATGGGAAGGTGGGAGG + Intronic
913346560 1:117816375-117816397 CCTGGTCTTGGCAAGGTGTGTGG + Intergenic
914469222 1:147959542-147959564 GTGGGTGCTGGGAGGGTGGGTGG - Intronic
914919307 1:151837012-151837034 CCGGCTCCTGGGAAGGTGGAGGG + Intergenic
915080773 1:153350176-153350198 AAGGGTCTTGAGATGGTGGGAGG - Intergenic
915399278 1:155610642-155610664 CTGGAGCTCGGTAAGGTGGGAGG - Intronic
915930926 1:160060638-160060660 CTGGGGCCTGGGAGGGTGGATGG - Intronic
916440734 1:164821956-164821978 CTGGGGCCTGGGAACCTGGGAGG + Intronic
916713316 1:167431108-167431130 CAGGGGCATGGGAAGGTGGGCGG - Exonic
917835870 1:178941323-178941345 ATGGGTTTAGGGAAGGTAGGAGG - Intergenic
918093532 1:181316956-181316978 CTGGGCCTTGTAAAGATGGGTGG + Intergenic
919922334 1:202174080-202174102 CTGGGGCTGGGGAGGATGGGTGG + Intergenic
921281383 1:213571432-213571454 CTGGGTCTTGGGAAGCAGAGAGG + Intergenic
921518101 1:216122616-216122638 GTGGGTCTTGGGAAGGTGCTAGG + Intronic
921814593 1:219549458-219549480 TTGGGACTTGGGGAGGTGGTTGG - Intergenic
922182244 1:223244406-223244428 CCGGGTCTAGGAAAGGTGAGAGG + Intronic
922196824 1:223365728-223365750 CAGGACCTTGGGAAGGTGGATGG - Intergenic
922324794 1:224517902-224517924 CTGGGCCTTGGGAATGATGGGGG + Intronic
922531551 1:226349085-226349107 CTGTGTGTTGGGGTGGTGGGGGG + Intergenic
922584392 1:226722734-226722756 CTGGGGCTTGGGGAGGTGTTAGG + Intronic
1062790517 10:301395-301417 TGGGGTCTGGGGAAGGTGGAGGG + Intronic
1062969754 10:1638013-1638035 ATGGGTCTTGGGTGGCTGGGAGG + Intronic
1062997192 10:1877531-1877553 CTGGGCCATGGGAGGGGGGGTGG + Intergenic
1063065643 10:2605882-2605904 CTGGGTTTTATGGAGGTGGGAGG + Intergenic
1063726961 10:8647800-8647822 CTGGGTAGTGGGAATGTGGGAGG + Intergenic
1064948408 10:20818333-20818355 CTGAGTCTTGGGGAGGTCAGAGG - Intronic
1066540550 10:36442102-36442124 ATGGGTCCAGGGAAGGGGGGGGG - Intergenic
1068656204 10:59578669-59578691 CTGGCTCTTGGTATGATGGGTGG + Intergenic
1069981341 10:72255049-72255071 CTGGGTCCTGGGAAGGGGCTTGG + Intergenic
1070283836 10:75069599-75069621 CTGGGCCTTGGGAAGGCGAGGGG + Intergenic
1070680802 10:78447787-78447809 ATGAGTCTTGGGAAGATGGCTGG + Intergenic
1070739056 10:78890420-78890442 ATAGGTGTTGGGAAGCTGGGTGG + Intergenic
1070821174 10:79355499-79355521 CAGGGTCTTAGGAAGGAGGAGGG + Intergenic
1071502088 10:86211426-86211448 CTGTGTCCTGGGAAAGTGGAGGG + Intronic
1074063540 10:109991216-109991238 TGGGGGCTTGGGGAGGTGGGTGG - Intergenic
1074397102 10:113107246-113107268 CTGGGTACTGGGTGGGTGGGTGG + Intronic
1075144504 10:119872300-119872322 CTGCGACTCGGGCAGGTGGGAGG + Intronic
1075677746 10:124307998-124308020 CTGTGTCTGGGGAAGGTGTCAGG + Intergenic
1077036727 11:498985-499007 CTGGGCCTTGGGGGGGTGCGGGG - Intronic
1077354738 11:2109887-2109909 CTGGGTCTTGGCAGCCTGGGTGG - Intergenic
1078221912 11:9358499-9358521 CTGGGTGGTGGGAATATGGGTGG - Intergenic
1079022894 11:16924030-16924052 CTGGGCTCTGGGGAGGTGGGAGG - Intronic
1080222693 11:29924369-29924391 CTGGCTCCTGGGAAAGAGGGAGG - Intergenic
1080419776 11:32099497-32099519 GTGGGTCTTTGGAGGGTGGGTGG + Intronic
1081611984 11:44568377-44568399 CAGGGTCTCAGGAAGGTGGCTGG + Intronic
1081617669 11:44600238-44600260 CTGGGTCTGGGGAAGCTGAGGGG - Intronic
1081620030 11:44613942-44613964 TTGGGGCTTGGGAAGGGGTGAGG + Intronic
1083389233 11:62335959-62335981 CTGAGGCTGGGGAAGGTGGCTGG - Intergenic
1083655867 11:64229369-64229391 CTGGGTCTTGGGAAGGTGGGTGG + Intronic
1083766835 11:64845269-64845291 CTGAGGCTTGGGAAGGAGGAAGG + Intergenic
1083842978 11:65315211-65315233 CTGGGTCTCGGGAGGGGGGCGGG - Intronic
1084043180 11:66554513-66554535 CTGGGTCGGGGGGAGGTGGGAGG - Intronic
1084538670 11:69773913-69773935 CTGGGTCTTGGAGGGGTGGCAGG - Intronic
1084805004 11:71572688-71572710 GTGGGTCTGGGGATGGTGGTGGG - Intergenic
1085048288 11:73365925-73365947 CTGTGTCTGGGGGAGGTGGTGGG - Exonic
1085254441 11:75164483-75164505 CTGGGCCTTGGGATGGTCGCGGG + Intronic
1085270373 11:75266566-75266588 CTGGTTCTTTAGGAGGTGGGGGG + Intronic
1085597081 11:77820347-77820369 CGGGGTCTTGGGCAGTGGGGAGG - Intronic
1085641833 11:78197638-78197660 CTGGCGCTAGAGAAGGTGGGAGG - Intronic
1088739035 11:112751663-112751685 CAGGGGCCTGGGAAGGTAGGGGG + Intergenic
1088905819 11:114154986-114155008 CTGGGACTTGGAAGGGTGGGTGG + Intronic
1088920433 11:114256969-114256991 CTGGGTCTTGAGGAGGAGAGGGG - Intergenic
1089309309 11:117547387-117547409 CTGGGCCTTGGGGAGGAGGATGG + Intronic
1089556876 11:119319949-119319971 CTGGGTCTTTGGAGGGGGTGCGG + Intronic
1089560723 11:119341829-119341851 CTGGGTGGAGGGAAGGAGGGCGG - Intronic
1090004217 11:122985673-122985695 CTAAGACTTGGGAAGGTGTGTGG - Intergenic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090409284 11:126496595-126496617 CAGGGTCTTGGGAGGTGGGGTGG + Intronic
1090909225 11:131104066-131104088 CTGTGTCTGTGCAAGGTGGGTGG - Intergenic
1091057378 11:132431438-132431460 CTGGGGCTAAGGAAAGTGGGTGG + Intronic
1093789917 12:23237020-23237042 CTGGGTCTGGGCCAGGTGTGTGG + Intergenic
1096073962 12:48790265-48790287 CTAGGTCTTGGGATCTTGGGTGG - Intergenic
1096106044 12:48997608-48997630 CTGGGTCTTGGAGAGGGGGCAGG - Exonic
1096429987 12:51534904-51534926 CTGGGTCTTGGCAGTGTGCGGGG + Intergenic
1096499148 12:52054908-52054930 CTGGGGCTGGGGCCGGTGGGAGG - Exonic
1096526483 12:52213078-52213100 CTGGGTCTGGAGAAGGGAGGAGG + Intergenic
1096536602 12:52279027-52279049 CTGGGGCTTGGGGTGGGGGGAGG + Intronic
1096574673 12:52545209-52545231 CTTGGGCTTGGGAAGTAGGGAGG - Intronic
1096611359 12:52804078-52804100 GAGGGTCTTGGTGAGGTGGGAGG + Intergenic
1097218304 12:57430904-57430926 AAGGGGCTTGGGAAGGAGGGGGG + Exonic
1097456220 12:59801938-59801960 GTGGGTAGTGGGAAGGTGAGCGG + Intergenic
1097969147 12:65613693-65613715 CAGGGTTTTGGGAAGATGGAAGG + Intergenic
1098386883 12:69929172-69929194 CAGTGTCTTGGGTATGTGGGTGG + Intronic
1101303636 12:103505472-103505494 CTGAGTCATGGGAACGTGGTAGG + Intergenic
1102058289 12:109913105-109913127 TTGGGTCTTGGGCAGGTGTCTGG + Intronic
1102566985 12:113803324-113803346 CTGGGTCTGGGGAAGGAGAGTGG - Intergenic
1102960106 12:117086982-117087004 CTGGGCCTTGGGAGGGAGGCAGG + Intronic
1103327408 12:120130787-120130809 CTGGCTCTGGGGAAGGGGTGGGG - Intronic
1103403291 12:120657834-120657856 CTGGGCCTTGGAGAAGTGGGAGG + Intronic
1103558078 12:121777904-121777926 CAGGGCCTTGGGAACCTGGGTGG + Exonic
1103606140 12:122087388-122087410 CTGGGGCTGGGGAGGGTGGGTGG + Intronic
1104211416 12:126692218-126692240 CTGGGTCTTCAGATGGTGGGGGG - Intergenic
1104850679 12:131872056-131872078 CTGGATGTTGGGGAGGAGGGAGG + Intergenic
1104913024 12:132249042-132249064 CTGGGTGTCTGGAAGGTGGCGGG + Intronic
1105650285 13:22370080-22370102 ATGGGTTGTGGGAGGGTGGGGGG - Intergenic
1106480390 13:30133187-30133209 CTGGCTCTGGGGAAAGAGGGTGG - Intergenic
1107086306 13:36431463-36431485 CTGGGGCTTGGGACGTTGAGGGG - Intergenic
1108426957 13:50312198-50312220 CTGGGGCTAGGGAAGGTGTCTGG + Intronic
1111082383 13:83328324-83328346 TTGGGTCTTAGGAGGGTGTGTGG - Intergenic
1111697478 13:91642830-91642852 ATGGGTCTTGGGGATGTGGGAGG + Intronic
1113598542 13:111551641-111551663 CTGGGTTCTGAGAAGGTGAGGGG - Intergenic
1113632965 13:111900369-111900391 ATGGGTCTTGTGAGGGTGGAGGG + Intergenic
1113849142 13:113408022-113408044 CTGGGTCTGGGGCTGGTGGCTGG + Intergenic
1114642373 14:24232218-24232240 CTGCGTCTTGGCAAGGCTGGAGG + Intronic
1115488290 14:33934181-33934203 CTGGGAATGGGGATGGTGGGAGG - Intronic
1115859854 14:37672215-37672237 CTGGGTCAAGGGATGGAGGGAGG - Intronic
1117474238 14:56077792-56077814 CTGGCTCTCGGCAAGGAGGGAGG + Intergenic
1117508309 14:56424233-56424255 CTGGATCAAGGGAAGGTGAGGGG + Intergenic
1117956833 14:61129670-61129692 CATGGTCTTGGGAAGGAGGTGGG - Intergenic
1118259326 14:64232976-64232998 CTGAGAGTTGGGAAGGTGGAGGG + Intronic
1118919613 14:70138120-70138142 CTTGGTCTTGAGTGGGTGGGTGG + Intronic
1119480868 14:74956816-74956838 CTGGGCCTGGGGCTGGTGGGTGG + Intergenic
1121109645 14:91303567-91303589 CAGGGCCTGGGGAAGATGGGTGG - Intronic
1121291558 14:92779934-92779956 CTCTGTGTTGGGATGGTGGGTGG - Intergenic
1121794737 14:96725514-96725536 CTGTGGGCTGGGAAGGTGGGAGG - Intergenic
1122077609 14:99246141-99246163 CTGGGTCCGAGGAAGGCGGGGGG - Intronic
1122271633 14:100570936-100570958 CTGGGTCTTGGGCCAGTGGGTGG + Intronic
1122408200 14:101512683-101512705 CTGGGCATCGGGAAGGTGTGTGG - Intergenic
1122506356 14:102234302-102234324 CTGGGTCTTTGGCAGGTTCGGGG - Intronic
1122645916 14:103193867-103193889 TTGGGTCTTGGGCAGGAGGAAGG + Intergenic
1122781634 14:104146253-104146275 CTGGGTGTTGGGATGGTGCCAGG + Intronic
1124346272 15:28923558-28923580 CTGAGTCTGGGGGAGGTGTGGGG + Intronic
1124364763 15:29063754-29063776 TCGGGTCTGGGGGAGGTGGGTGG + Intronic
1124813571 15:32966066-32966088 CTGGGCCTTGGGAAGGTTCTGGG + Intronic
1125033252 15:35093763-35093785 CTGAGTGGTGGGAGGGTGGGAGG + Intergenic
1125457982 15:39880063-39880085 CTGAGTCTTGAGAAGGTTGAAGG - Intronic
1125745330 15:41993766-41993788 CTTGCTTTTGGGAAGGTGGGAGG + Intronic
1125764416 15:42123635-42123657 CTGGGTCCTGGGATGAGGGGTGG - Intergenic
1126649592 15:50908094-50908116 CTGGGATTTGGGGAGGTGGGCGG - Intergenic
1127292961 15:57586564-57586586 CTGGGTATGGGGATGGAGGGTGG - Intergenic
1128166851 15:65473081-65473103 CTGGGAGGTGGCAAGGTGGGAGG + Intronic
1128179301 15:65587601-65587623 GTGCGTCTTGTGTAGGTGGGTGG + Intronic
1128250895 15:66163707-66163729 CTGAGTTATGGGAAGGCGGGCGG + Intronic
1128534206 15:68478550-68478572 ATGGCTCTTGGGAAGGAAGGAGG - Intergenic
1129161810 15:73751949-73751971 CTGGCTGGGGGGAAGGTGGGGGG - Intronic
1129189314 15:73928016-73928038 CTGGGTCGGGGGAAGTCGGGAGG - Intronic
1129518094 15:76169122-76169144 CTGGGCCTTGGGAAGACGGAAGG + Intronic
1129689560 15:77705565-77705587 CTTGGTCTTGGGAGGGTGCTTGG - Intronic
1129866108 15:78910019-78910041 CTCGGCCCTGTGAAGGTGGGCGG - Intergenic
1129902906 15:79165425-79165447 TTTGGTCTAGGGAAGGAGGGAGG + Intergenic
1129903374 15:79169005-79169027 CTGGCTCTTGGCAGGATGGGAGG - Intergenic
1129969689 15:79767347-79767369 CTGGTTCTTGGGGAGGTTAGAGG + Intergenic
1130401137 15:83555497-83555519 TGGGGCCTTGGGAAGCTGGGTGG - Intronic
1131422911 15:92322133-92322155 CTGGGTCTTGGGAAGGCCTTGGG + Intergenic
1132572744 16:651134-651156 CTCGGTGGTGGGAGGGTGGGTGG + Intronic
1132583822 16:697230-697252 CTGGGTGGTGGGAGGGTGGGTGG + Exonic
1132607551 16:799913-799935 CTGAACCTTGGGAGGGTGGGTGG + Intronic
1132668844 16:1094622-1094644 CTGGGGCTTGGGAGGAGGGGCGG - Intronic
1132910225 16:2306484-2306506 CTGGGTCTGTGGAAGGAGGTGGG - Intronic
1133151364 16:3834512-3834534 CAGGGTTTTGGGAAGGAGAGAGG + Intronic
1133220449 16:4317170-4317192 CTGGGGCCTGGGAAGCTGGAAGG + Intronic
1133461554 16:5990632-5990654 CGGTGTATGGGGAAGGTGGGTGG + Intergenic
1134070600 16:11257229-11257251 CCGGGGCTTGGGATGGTGGGCGG + Intronic
1135080026 16:19426333-19426355 CCGGGTCTGGGAAAGGTGGCAGG - Intronic
1136049084 16:27637933-27637955 CGGGGGCTGGGGAAGGTTGGTGG - Intronic
1136559338 16:31029617-31029639 TTGGGTCTTGGGTGTGTGGGTGG - Intergenic
1136584216 16:31173557-31173579 CTGAGTCTGGGGCAGGGGGGTGG - Intergenic
1136605221 16:31329321-31329343 CTGGGTCCTGAGAAGGAGGCTGG + Intronic
1137547409 16:49414015-49414037 TAGGGTCTTGGGGAGGTGTGAGG + Intergenic
1137614654 16:49839157-49839179 CTGGGTCCTGGGATGAGGGGAGG - Intronic
1138781428 16:59793026-59793048 CAGGCTCTTGGGAATGTGGAAGG - Intergenic
1139581600 16:67877082-67877104 CTGCCTCTTGGGGAGCTGGGTGG + Intronic
1141177448 16:81730364-81730386 CGGGATCTCGGGAAGGTGGCAGG + Intergenic
1141192988 16:81838198-81838220 CAGGTGCTTGGGAAGCTGGGAGG - Intronic
1141589211 16:85056543-85056565 CTGTGTCTTGGAAGGCTGGGTGG - Intronic
1141901077 16:86990924-86990946 ATGGCTCTTGTGAAGGTGAGGGG + Intergenic
1141920550 16:87132841-87132863 CAGGGCATTGGGAAGGCGGGTGG - Intronic
1142115347 16:88353429-88353451 GTGGGGCTGGGGAAGCTGGGTGG - Intergenic
1142284779 16:89167315-89167337 CTGAGCACTGGGAAGGTGGGGGG - Intergenic
1142347234 16:89561563-89561585 CTGGTTCTGGGGCAGGTGGCCGG + Exonic
1142510034 17:387232-387254 CTGGGTCGGGGGAAGGGGAGTGG - Intergenic
1142595546 17:1028095-1028117 CTCGGTCTTGGGGTGGGGGGAGG - Intronic
1143152600 17:4816753-4816775 CTGGGGCTTTGGCGGGTGGGAGG - Intronic
1143195236 17:5071340-5071362 CTGGGCTTTGAGAAGGTGAGCGG - Intergenic
1143247956 17:5501505-5501527 CTGGACCTTGGGATTGTGGGAGG - Intronic
1143329347 17:6121967-6121989 CAGGGAGGTGGGAAGGTGGGTGG + Exonic
1143481004 17:7227375-7227397 CTGGGTCCTGGGCAGGTGGCTGG - Intronic
1144951110 17:18993962-18993984 ATGGGACTTGGGTTGGTGGGAGG - Intronic
1145100577 17:20073232-20073254 CAGGGTCATGGCAAGGTGGTGGG + Intronic
1145902762 17:28498909-28498931 CTGGGGCTTTGGTGGGTGGGAGG - Intronic
1147239177 17:39079356-39079378 CTTGGTCCTGGGGAGCTGGGTGG - Intronic
1147583245 17:41638498-41638520 CAGGGCCCTGGGAAGGTGGAGGG - Intergenic
1147671892 17:42181143-42181165 CTGGCCCGTGGGGAGGTGGGGGG - Exonic
1147882884 17:43665339-43665361 CTGGGTCATGGTGGGGTGGGTGG + Intergenic
1147965920 17:44194146-44194168 TTGGGGCTTGGGAAGCTTGGTGG - Exonic
1148323342 17:46770401-46770423 CTGGACTTTGGGAAGGTGGAGGG - Intronic
1148479370 17:47950002-47950024 CTGGGTCTTAGGATCCTGGGAGG - Intergenic
1148669539 17:49400231-49400253 ATTGGTCTTGGGAAGGGAGGTGG + Intronic
1150125474 17:62632049-62632071 CTGGGTCCTGTGAATCTGGGTGG + Intronic
1151719338 17:75846648-75846670 CTGGGGCTTGGGGAGGGGAGGGG - Exonic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1152068996 17:78125969-78125991 CTGGGTCCTGGGAAGGGGTGAGG - Intronic
1152226045 17:79093269-79093291 CTGGGTGGTGGGAGGGTGGGAGG - Intronic
1152260063 17:79261922-79261944 CTGGGGCTTGTGGAGGGGGGAGG + Intronic
1152713275 17:81885649-81885671 CATGGTCTTGGGAGGGTTGGAGG - Intergenic
1152791404 17:82282386-82282408 CTGGGTCTGGGGCAGGGGGTAGG - Intergenic
1152799286 17:82323481-82323503 CCGGGTGTGGTGAAGGTGGGAGG + Intronic
1153415153 18:4838282-4838304 CTGGGTCTTGGGAAGTGTTGCGG - Intergenic
1154359180 18:13644911-13644933 CTGGGATTTGGCAAGGTGAGTGG + Intronic
1155226861 18:23736926-23736948 CTGGGTCTTAAGAGGGTAGGTGG - Intronic
1157335212 18:46732880-46732902 CTGGGTCTCGGGAGGGCTGGTGG + Intronic
1157387659 18:47272001-47272023 CAGCATCTTGGGAAGCTGGGCGG - Intergenic
1157482271 18:48063068-48063090 TTGGGTGGTGGGAAGGAGGGAGG - Intronic
1157506299 18:48229031-48229053 CGGGGTCATGGGAAGGGAGGCGG + Intronic
1158531757 18:58268967-58268989 CTGAGGCTTGGGAAGGGAGGAGG - Intronic
1159289465 18:66396845-66396867 CTGGGTTTGGGGAATTTGGGAGG - Intergenic
1160329425 18:77978142-77978164 CTGGGTGTGGGGAAGTAGGGAGG - Intergenic
1160534907 18:79586558-79586580 CTGGGTGGTGGGAAGGCGTGCGG + Intergenic
1161083244 19:2321875-2321897 GAGGGTCTTGGGTGGGTGGGGGG - Intronic
1161278686 19:3433617-3433639 CTGGGTCTTGGAGAGGGGAGGGG + Intronic
1161374218 19:3930985-3931007 CAGGGGCTGGGGGAGGTGGGTGG - Intergenic
1161380703 19:3963710-3963732 CACGGTCCTGGGAGGGTGGGCGG - Intronic
1161586485 19:5108469-5108491 CTGGGACTGGGTAAGGTGGGGGG + Intronic
1161845452 19:6709613-6709635 CTGGGGCTGGGGGAGGTGGGTGG - Intronic
1161846343 19:6713736-6713758 CTGGGAGTGGGGAAGGTGGGGGG - Intronic
1161846389 19:6713831-6713853 CTGGGGGTGGGGAAGGTGGGGGG - Intronic
1161984795 19:7647278-7647300 CTGGGTCTGTGTTAGGTGGGCGG + Intronic
1161989684 19:7677629-7677651 CTGGGTCATGGGCACCTGGGAGG - Exonic
1162039249 19:7959860-7959882 GTAGGTCTGGGGAAGATGGGAGG + Exonic
1162298233 19:9828043-9828065 CAGGGTCTGGGGTCGGTGGGAGG + Exonic
1162442510 19:10701689-10701711 CTGGGTCTAAGGCCGGTGGGTGG + Exonic
1162555608 19:11383922-11383944 CTGGGTCCTGGATGGGTGGGGGG - Intronic
1162685132 19:12376581-12376603 CTGGGTGGTGACAAGGTGGGAGG + Intergenic
1162771804 19:12953686-12953708 CTGGGTCTTGGGGGGCTGGCTGG + Exonic
1163115220 19:15185080-15185102 CTGGGGTTGGGGGAGGTGGGGGG - Intronic
1163799117 19:19354459-19354481 CTGGGGCTGGGGAAGAGGGGTGG - Intronic
1164566345 19:29328795-29328817 CTGGGTCCTGGGGAGGAGGGAGG - Intergenic
1164728720 19:30484759-30484781 CTGGGACTCAGGAAAGTGGGGGG + Intronic
1164857616 19:31537274-31537296 CTGGGTTATGGGAGGGTGAGAGG - Intergenic
1165382987 19:35494273-35494295 CTGGGTCTAGGGAGGGAGTGGGG + Intronic
1165476237 19:36032573-36032595 CTGGGCCTGGGGGAGGTGGCAGG - Intronic
1165548916 19:36566572-36566594 CTAGCTGTTGGGGAGGTGGGGGG + Intronic
1165829635 19:38724093-38724115 GAGGCTCTTGGGAAGATGGGGGG - Intronic
1165838779 19:38774537-38774559 GTGGGTTTTGGGGTGGTGGGTGG + Intergenic
1166288211 19:41845285-41845307 CTGGGGCACGGGAAGGGGGGAGG + Intronic
1166333825 19:42093706-42093728 CTGGGCCTGGGGAGTGTGGGTGG - Intronic
1166348125 19:42179397-42179419 CAGGGTCTTGGGAGGGTGCATGG + Intronic
1166546415 19:43636772-43636794 CTGGCTCATGGGTGGGTGGGTGG + Intronic
1166567807 19:43775774-43775796 CTGGGTCTGGGGCAAGAGGGAGG + Intronic
1166745545 19:45140311-45140333 TTGGGTCATGGGCAGGTCGGGGG + Intronic
1166763033 19:45236220-45236242 CTAGCACTTTGGAAGGTGGGCGG + Intronic
1167146255 19:47682047-47682069 CTGGGTCTTGGGCGGGAGGCGGG - Exonic
1167289197 19:48615175-48615197 CTGGCTGTTGGGAAGGAGGCAGG + Intergenic
1167290950 19:48624899-48624921 CTGGGCCTGGGGAATGTGAGGGG + Intronic
1167314510 19:48755874-48755896 CTGGGTCTAGGGGATGAGGGAGG - Exonic
1167441704 19:49512910-49512932 CTGGGTCTGAGGGAGGAGGGAGG + Intronic
1167454692 19:49591995-49592017 GAAGGCCTTGGGAAGGTGGGAGG + Intronic
1167461363 19:49626142-49626164 CAGGGGCTTGGGGAGGTGGAGGG + Exonic
1167552232 19:50169194-50169216 CTGGGCCTCGGGAGGGTGTGGGG - Intergenic
1168102753 19:54149663-54149685 CTGGGCGTTGGGGAGCTGGGAGG - Exonic
1168105763 19:54164869-54164891 GCGGGTCTTGGGATGCTGGGCGG - Intronic
1168325498 19:55536766-55536788 CTGGGTCGGAGGGAGGTGGGTGG - Intronic
925121420 2:1421524-1421546 CAGAGTCCTGGGGAGGTGGGGGG + Intronic
925303720 2:2834954-2834976 CTTGGCCTTGGGGAGGTGGGTGG + Intergenic
925388609 2:3480859-3480881 GTGGGGCTTGGGAGGGAGGGTGG - Intronic
925732675 2:6931438-6931460 CTGGGTTTTGGGAATGGGGAGGG + Intronic
925902437 2:8518134-8518156 CTGGGTCTCAGGGAGGGGGGTGG + Intergenic
926047977 2:9724246-9724268 CTGTGTCTTGGGAAGGAGCATGG - Intergenic
926743305 2:16129947-16129969 CTGAGTCTTGGGAGGGATGGCGG - Intergenic
926820751 2:16849097-16849119 GTGGGTGTTGGGCAGGTGGTGGG - Intergenic
927177672 2:20421963-20421985 CTGGGCCTGGGGATGGTGGAGGG - Intergenic
927519016 2:23688196-23688218 CTGGGTCTTGGGGATTTGTGTGG - Intronic
927991825 2:27453531-27453553 CTGGGACTTGGCATGGTAGGGGG + Intronic
928275682 2:29898149-29898171 CTGGGGCTGGGGAAGGTGGCAGG - Intronic
929485458 2:42349440-42349462 GTGGGAGTTGGGATGGTGGGAGG + Exonic
931400275 2:61925125-61925147 CTGGGTCTTTGGCAGGTTTGGGG + Intronic
931763002 2:65432862-65432884 CTTGGTGTTTGGAAGGAGGGAGG - Intergenic
932001528 2:67889414-67889436 CTGGGTCCTGGGAATTTGGATGG - Intergenic
932448520 2:71795046-71795068 GGGGGTGCTGGGAAGGTGGGGGG + Intergenic
932451305 2:71812370-71812392 ATGGGTCCTGGGCAGGTGGGAGG + Intergenic
932580783 2:72991550-72991572 CTGGGGCCTGGGAAGGGGTGAGG - Intronic
932751324 2:74373498-74373520 CTGGTTCTGGGGAAGGGGGTTGG - Intronic
932771418 2:74502813-74502835 GTGAGTCTTGGGGAGTTGGGGGG - Intronic
933272933 2:80252915-80252937 CAGGTTCTTGGGAAGGGGGATGG + Intronic
933418127 2:82013616-82013638 CTAGGGTTTGGGAAGTTGGGAGG - Intergenic
933432164 2:82196916-82196938 CTGGGTCTGTGGAGGGTGAGTGG - Intergenic
933649002 2:84833947-84833969 CTGGGTTCTGGGCTGGTGGGAGG - Intronic
935068636 2:99674589-99674611 CTGGGTCTTTAAAGGGTGGGTGG + Intronic
935589800 2:104835828-104835850 CAGGGTGTGGGGGAGGTGGGGGG + Intergenic
935593899 2:104864692-104864714 CTTGGTCTTGGGGAGGAGGTGGG + Intergenic
937045687 2:118850275-118850297 CCGGGCCTCGGGGAGGTGGGGGG - Intergenic
937463444 2:122109390-122109412 CTGGATCCTGGGAAGGTGAAGGG + Intergenic
937879638 2:126855874-126855896 CTCTGTGTAGGGAAGGTGGGAGG - Intergenic
937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG + Intronic
938079645 2:128362897-128362919 CCCTGTCTTGGGAGGGTGGGGGG + Intergenic
938660891 2:133486039-133486061 CAGGGACTTGGGGAGATGGGTGG - Intronic
938979839 2:136515762-136515784 TTTGGTCTTTGGAAGTTGGGTGG + Intergenic
939090089 2:137770116-137770138 CTGGGTCTTGGTGGGGTGTGAGG + Intergenic
939341750 2:140905220-140905242 CAGGGGCTTGGGGAGGGGGGCGG - Intronic
939649103 2:144740175-144740197 CTGGGTCCTGTCAGGGTGGGAGG - Intergenic
940437327 2:153669950-153669972 CTGGAACTTGGGGAGGGGGGAGG + Intergenic
941504647 2:166327264-166327286 CAGCTACTTGGGAAGGTGGGAGG - Intronic
942496384 2:176544518-176544540 CTGGGTCATGGGAAGGAAGAGGG - Intergenic
942858863 2:180585761-180585783 CTGGGGTTGGGGAAGGGGGGAGG - Intergenic
945263539 2:207867780-207867802 AAGGCTCTTGGGATGGTGGGAGG - Intronic
945263630 2:207868423-207868445 CTGGGTATTGGGAAGTAGTGGGG + Intronic
945449372 2:209976196-209976218 ATGGCTCTGCGGAAGGTGGGAGG + Exonic
946333145 2:219021736-219021758 CTGGGGCCAGGGGAGGTGGGAGG - Intronic
946433109 2:219635900-219635922 CTGGGGCTTGGGGAGTTGAGGGG + Intronic
947027327 2:225750992-225751014 CTGGGACTTGGAAAGGATGGAGG + Intergenic
948385453 2:237577957-237577979 CAGGTGCTTGGGAAGGAGGGTGG + Intronic
948789514 2:240370086-240370108 CTGTGTCTGGGGGAGGAGGGTGG + Intergenic
949034428 2:241810095-241810117 CTGGGGCAGGGGCAGGTGGGTGG - Intronic
949062962 2:241971836-241971858 CTGCCTCCTGGGAAGTTGGGAGG + Intergenic
949062989 2:241972155-241972177 CTGTGGCCTGGGAAGGTGGGTGG + Intergenic
1169029503 20:2396659-2396681 CTGGGGCATGGGGAGGTCGGTGG + Intronic
1169077460 20:2770037-2770059 CTGGGTAGGGGGTAGGTGGGAGG - Intergenic
1170723222 20:18902426-18902448 CAGGTTTTTGGGATGGTGGGTGG + Intergenic
1170799700 20:19580920-19580942 GTAGGTCTTGGGAGAGTGGGAGG + Intronic
1171183036 20:23105000-23105022 CGGGGTCCTGGGGAGGAGGGTGG + Intergenic
1171203075 20:23257272-23257294 CAGGGTCTGGGGGAAGTGGGAGG - Intergenic
1171244457 20:23600212-23600234 CAGTGTCTTGGGAAGTGGGGTGG - Intergenic
1172275555 20:33677082-33677104 GTGGGTGATGGGTAGGTGGGTGG - Intronic
1172280821 20:33706750-33706772 CTGGGTCCTGAAAATGTGGGTGG + Exonic
1172881720 20:38204433-38204455 CTGGGGATAGGGGAGGTGGGAGG - Intergenic
1173187940 20:40855611-40855633 CTGGGTCTTGAGACTGTGGAGGG - Intergenic
1173775755 20:45704866-45704888 CTGGGTCGGGGGAAGGTCTGTGG - Intronic
1174123587 20:48286498-48286520 CTGAGTCCTGGCAAGGTGGAAGG + Intergenic
1174178121 20:48657696-48657718 CTGGGGCGTGTGCAGGTGGGTGG - Intronic
1174387244 20:50194402-50194424 CTGGACCTAGGGAAGGAGGGAGG + Intergenic
1175936627 20:62517242-62517264 GTGGGTTTTGGGAAGTGGGGAGG + Intergenic
1175965103 20:62656482-62656504 TTGGGGCTGGGGAAGGTGAGCGG - Exonic
1176034881 20:63031379-63031401 CTGGGGCTGGGGGAGGAGGGAGG + Intergenic
1177758944 21:25380955-25380977 CTTGGTGTTGGGCAGATGGGAGG + Intergenic
1178013369 21:28313453-28313475 CTGGGGCTAGGGAAAGTGGAAGG - Intergenic
1179597677 21:42453781-42453803 CTGGGTCTAGGAAAGACGGGTGG + Intergenic
1179800990 21:43811427-43811449 CTGGGGCCTGGGCAGCTGGGGGG - Intergenic
1179902985 21:44403288-44403310 CTGGGGCTAGGGAGGGTGTGGGG + Intronic
1180996046 22:19965811-19965833 GTGGGCATTGGGAGGGTGGGAGG + Intronic
1181132595 22:20742102-20742124 CTGAGGCTTGAGAAGGTGAGGGG + Intronic
1182013900 22:27023026-27023048 CTGGGGCTAGGGAGGGAGGGAGG + Intergenic
1182124905 22:27809320-27809342 CTGGGTCTTGGCATTGGGGGTGG - Intergenic
1182277521 22:29200112-29200134 CAGGGTCTGGGGACAGTGGGAGG + Intergenic
1182326913 22:29520172-29520194 GTGGGGCATGGGAGGGTGGGAGG - Intronic
1182436557 22:30334523-30334545 CTGGGTCTGGGGCAGGGGGTGGG + Exonic
1182689716 22:32150559-32150581 CTGGATCATGTGCAGGTGGGCGG + Intronic
1182939290 22:34259431-34259453 CTGATACCTGGGAAGGTGGGTGG - Intergenic
1183749899 22:39713951-39713973 CTGGCTCTGGGGGAGGTGAGGGG + Intergenic
1184127191 22:42495963-42495985 CTGGGTGTTGTGAGAGTGGGAGG - Intergenic
1184134299 22:42537599-42537621 CTGGGTGTTGTGAGAGTGGGAGG - Intergenic
1184134579 22:42539608-42539630 CTGGGTGTTGTGAGAGTGGGAGG - Intergenic
1184169989 22:42753008-42753030 CTGGGTCCTGGGAGGGTGACAGG - Intergenic
1184413298 22:44338113-44338135 GTGGTCCTTGGGAGGGTGGGGGG - Intergenic
1185020176 22:48369890-48369912 CTGCCTCTTGGGAAGGTGGAGGG + Intergenic
1185149046 22:49153917-49153939 CAGGGTGTGGGTAAGGTGGGAGG + Intergenic
1185413258 22:50697031-50697053 CTGGCTCTTGGAAAAGCGGGTGG + Intergenic
949934602 3:9106945-9106967 CTGGGGCTTGGGAAGGTAGGTGG + Intronic
950156272 3:10723765-10723787 CTGAGTGTTGGGAAGGAGGGTGG + Intergenic
950436701 3:12984533-12984555 GTTGGTCTTGGGAGGGTGGCAGG - Intronic
950490272 3:13300469-13300491 TTGGGTCTTTGGGAGGTGGTTGG - Intergenic
951395036 3:22154373-22154395 CTGGATCCTGGGAAGGTAAGAGG - Intronic
951545237 3:23818150-23818172 CTGGGTGTTGGGGAAGTTGGTGG + Intronic
952827823 3:37538591-37538613 CAGGGCCCTGGGAAGGTGGGTGG - Intronic
953376428 3:42432065-42432087 CTTGGTCTAGGGAAGGGGGCAGG + Intergenic
953905131 3:46864838-46864860 CTGCCACTTGGGGAGGTGGGAGG + Intronic
954461363 3:50628845-50628867 CTGGGGCTTGGGAAGGTGAAAGG + Intronic
954628783 3:52037121-52037143 CTGGGCTGGGGGAAGGTGGGAGG + Intergenic
954817111 3:53291467-53291489 AAGGGTAGTGGGAAGGTGGGGGG - Intronic
955247867 3:57245119-57245141 CTGTCACTTGGGAAGGTGAGAGG + Intronic
956805638 3:72808320-72808342 GTGGGTTGTGGGAAAGTGGGTGG - Intronic
958048883 3:88319387-88319409 CTGGGTTTTGGTGATGTGGGAGG + Intergenic
958744208 3:98113471-98113493 ATGTGTCTTGGGAAGGTGGAGGG - Intergenic
958803146 3:98779402-98779424 ATGGGTGTTGGGAATGTGAGTGG + Intronic
959504220 3:107140128-107140150 CTGGGCCTTGGGTAAGTGAGGGG + Intergenic
960544621 3:118899505-118899527 TAGGGACTTGGGAAGGAGGGTGG + Intergenic
961445700 3:126980321-126980343 CTGCGTCTTGGGAAGGTCCAGGG - Intergenic
961658542 3:128456446-128456468 CTGGGACTTGGGAAGGTGCCAGG - Intergenic
961810845 3:129520928-129520950 GTGGGGCTGGGGAAGGTGGATGG - Intergenic
962853969 3:139328106-139328128 CTGCCTCGTGGGGAGGTGGGAGG + Intronic
962886221 3:139630383-139630405 CTGGGACTTGGGAGGGTGGAAGG + Intronic
963543372 3:146623848-146623870 CGGGAGATTGGGAAGGTGGGAGG - Intergenic
963799126 3:149658968-149658990 CTAGTTGGTGGGAAGGTGGGTGG - Intronic
964907352 3:161733754-161733776 CTGGGACTGGGCAAGGAGGGTGG - Intergenic
965530930 3:169769274-169769296 CTGGGGCTGGGGAGGGTGGGTGG - Intronic
966925053 3:184639302-184639324 CTAGGTCTTGGGAAGAGGTGGGG + Intronic
967672470 3:192254175-192254197 CTGGGTCTTGGGGAGAGGAGGGG - Intronic
968654890 4:1774151-1774173 CTGGCTCATGGGAAGGATGGGGG + Intergenic
968930254 4:3575207-3575229 GTGGGTGTTGGGCAGGTGGAGGG + Intergenic
969183551 4:5459516-5459538 CAGGGTTTTGGCAAGTTGGGAGG + Intronic
969414722 4:7050852-7050874 CTGCATCGTGGGATGGTGGGGGG + Intronic
969449088 4:7262838-7262860 CTGTGTCTGGTGAAGGTGGAGGG + Intronic
969457159 4:7306650-7306672 CTGGTCCTGGGGAAGGAGGGTGG + Intronic
969594802 4:8142889-8142911 TCAGGTCTGGGGAAGGTGGGAGG + Intronic
969882639 4:10187775-10187797 CCGGGTATTGGGAAGCTGAGGGG + Intergenic
973999908 4:56501709-56501731 CCAGGTCTTGGGGAGGTGGGTGG - Exonic
974784237 4:66597235-66597257 CTGGGGCTTAGGAAGCTGTGTGG - Intergenic
975563017 4:75724904-75724926 CTGGGACTTGGGAAGGGGTCCGG + Intronic
977614648 4:99074710-99074732 CTGGGACTTGGGGGGGAGGGTGG - Intronic
977951243 4:102972603-102972625 TTGGGACTTGGGTAGGTGGGAGG + Intronic
979528788 4:121745815-121745837 GTGGGTCAGGGGAAGGGGGGAGG - Intergenic
979994804 4:127418034-127418056 CTGAATCTGGGGAATGTGGGAGG - Intergenic
980534149 4:134092783-134092805 GTGGGACTTGCGATGGTGGGAGG - Intergenic
982898179 4:160961107-160961129 CTAGGTGTTGGGGAGATGGGAGG - Intergenic
983316725 4:166142271-166142293 CTCAGTCTTGGGAAGATAGGAGG + Intergenic
985559329 5:574572-574594 CTGGGGGCTGGGGAGGTGGGAGG - Intergenic
985624184 5:976468-976490 CAGGGTCTGGGGGAGGTGGATGG + Intergenic
985667011 5:1186564-1186586 CCAGGCCTTGGGGAGGTGGGAGG + Intergenic
985685488 5:1279600-1279622 CAGGGTCTGAGGAAGCTGGGAGG - Intronic
985708459 5:1414895-1414917 CTGTGTCTGGGGAAGGGGGCGGG + Intronic
985717983 5:1473392-1473414 CGGGGTTTTAGGAAGGTGCGAGG - Intronic
985848506 5:2371665-2371687 CGGGGCCTGGGGAAGGTTGGAGG - Intergenic
986139618 5:5017574-5017596 CTGCATCGTGGGAAGGAGGGTGG + Intergenic
986516937 5:8574162-8574184 CTGGGACTTGGAAAGGAGGAAGG + Intergenic
986602069 5:9482460-9482482 CTGGGTGAGTGGAAGGTGGGAGG + Intronic
986608197 5:9544580-9544602 CTGGGTCCTGGGCGAGTGGGCGG - Intronic
988166445 5:27596166-27596188 CTGGGTTTTGGGGAGGGGGGTGG + Intergenic
989082286 5:37635814-37635836 ATGTGTCATGGGAGGGTGGGAGG + Intronic
989343363 5:40402209-40402231 CAGGGTCTGAGGCAGGTGGGGGG - Intergenic
989467736 5:41776324-41776346 CTGGATCTTGGAAAACTGGGTGG + Intronic
990556644 5:56943029-56943051 CTGGGCTTTGGGAAGCTGAGTGG + Intronic
990936825 5:61160194-61160216 CTGGGGCTGGGGGAGGCGGGTGG + Exonic
992259577 5:74956346-74956368 CAGGCTCTTGGTTAGGTGGGAGG + Intergenic
992503290 5:77362701-77362723 GTGTGACTTGGGAAGGTGGCAGG - Intronic
995070088 5:107910517-107910539 CTGGGTATTGGGAATGTTTGAGG - Intronic
996581241 5:125034637-125034659 CTGGGTCATGGGAGGGGTGGGGG - Intergenic
997013353 5:129904422-129904444 CGGGGGCTCGGGAAGGAGGGAGG + Intergenic
997713417 5:136024891-136024913 GTGGGTCTTGGGAGGTTGGGAGG + Intergenic
997787608 5:136727954-136727976 TTGGGTGCTGGGAAAGTGGGAGG + Intergenic
997826628 5:137112338-137112360 CTGGGGCTTGGGAAGCGTGGTGG - Intronic
998107279 5:139476555-139476577 CTGGGGCTTGGGTAGGAAGGGGG - Intronic
998140774 5:139698156-139698178 ATGGGTCTTGGGATGGGGGTGGG + Intergenic
998148615 5:139744680-139744702 CTGGGTCTGGGGCAGGAGCGGGG - Intergenic
999499881 5:152136234-152136256 CTGTGTTTGGGGAATGTGGGTGG - Intergenic
1001311297 5:170612855-170612877 CTGGGTCTTGGGAGGGGGTGAGG - Intronic
1001317319 5:170653042-170653064 CTGGGTCGGGGGAAGGAGCGAGG + Intronic
1001663463 5:173413474-173413496 CTGGGTGAGGGGATGGTGGGGGG + Intergenic
1001766829 5:174255698-174255720 CTGGGTATTAGGAAGGGAGGAGG + Intergenic
1001809621 5:174617914-174617936 CTGGGTCTTGAGTATGTGGGTGG + Intergenic
1001928983 5:175659125-175659147 CAGGGCCTAGGGAATGTGGGGGG + Intronic
1001957294 5:175856773-175856795 CGGGTTCTCAGGAAGGTGGGGGG + Intronic
1003698821 6:8439630-8439652 CTGGCCCTTGGGAAGTTTGGTGG + Intergenic
1004339952 6:14799251-14799273 CTTGTTCTTAGGAAGGAGGGAGG + Intergenic
1004516566 6:16326718-16326740 CTCGCTCTTGGGAAGGGCGGTGG + Exonic
1006316773 6:33296118-33296140 CAGGGGCTTAGGAAGGTCGGGGG + Exonic
1006407600 6:33854386-33854408 CTGGGTCGGGGGAAGGAAGGAGG - Intergenic
1006804339 6:36778571-36778593 CTAGGTATTTGGAGGGTGGGGGG - Intronic
1007418361 6:41705263-41705285 CTGGGGTTTAGGCAGGTGGGAGG - Intronic
1007474102 6:42107473-42107495 CTGGGCCTGGGGGAGGTGGGGGG + Exonic
1007486090 6:42181724-42181746 CTGGGTGTGGGGGAGGTGTGGGG + Intergenic
1007675925 6:43594939-43594961 CTGGGGGCTGGGGAGGTGGGGGG + Intronic
1008046230 6:46854208-46854230 CTGGGTCTTGGGAGGAGGGCAGG - Intronic
1008508455 6:52253904-52253926 CAGAGTTTTGGGATGGTGGGTGG + Intergenic
1008540063 6:52538474-52538496 CTGGGTCTTGGGCGGGTATGAGG + Intronic
1008878521 6:56355698-56355720 CAGGGGCTTGGGAAGGATGGAGG + Intronic
1010154467 6:72776928-72776950 CTGAGCCTTTGGAAGATGGGTGG + Intronic
1010454544 6:76039641-76039663 CTAGGCCTTGGCCAGGTGGGTGG - Intronic
1011654823 6:89542505-89542527 CTGTGTCTCGGGAAGCGGGGGGG - Intronic
1013323915 6:109025073-109025095 CTAGGACTTGGGAAATTGGGAGG + Intronic
1014130515 6:117826441-117826463 TAGGGTCTTGGGACGGTTGGAGG + Intergenic
1015438238 6:133215970-133215992 CTGTGGGTTGGGAAGATGGGAGG - Intergenic
1015480246 6:133700638-133700660 CTGGGATTGGGGAGGGTGGGAGG - Intergenic
1015510289 6:134031497-134031519 CTGTGGCTTGAGCAGGTGGGTGG + Intronic
1015902381 6:138081388-138081410 CGGGGTCAGGGGAAGGGGGGAGG + Intergenic
1016469721 6:144362309-144362331 CTGGGTCCTGGGCAGATGGGGGG - Intronic
1017351349 6:153445754-153445776 CTGGGTCTTGAGAAGTTGAATGG + Intergenic
1017843023 6:158237466-158237488 CCAGGTCTTGGGGAGGTGGGTGG + Intronic
1018230318 6:161669211-161669233 CTGGGTGCTGGGAAGGTGCTGGG - Intronic
1018554394 6:165034967-165034989 TTTGGTCTGGGGAAGCTGGGGGG + Intergenic
1018657392 6:166051526-166051548 CTGGGGTTAGGGATGGTGGGGGG - Intergenic
1018833253 6:167462561-167462583 CTGTGTGCTGGGAAGGTGGGAGG + Intergenic
1018989253 6:168660742-168660764 TCGGGCCTTTGGAAGGTGGGAGG - Intronic
1019318002 7:400297-400319 CTAGGTGCTGGGAAGATGGGAGG - Intergenic
1019455811 7:1126927-1126949 TTGGGCCCTGGGAAGGTGCGAGG - Intronic
1019491093 7:1314014-1314036 CAGGGCCTTGGGAAGGTTGTGGG + Intergenic
1019704249 7:2490010-2490032 CAGGGTCCTGGGATGGTGGGTGG - Intergenic
1019912505 7:4109384-4109406 CTAAGTCTTGGGAGGGTGGCAGG - Intronic
1020013323 7:4817906-4817928 GGGGCTCTTGTGAAGGTGGGAGG + Intronic
1021813115 7:24423206-24423228 CTGTGTCTTGAGACGGTGAGTGG + Intergenic
1022475738 7:30708356-30708378 GTGTATCTTGGGAAGGTGGGAGG - Intronic
1022951720 7:35345614-35345636 CTTGGTGGTGGGGAGGTGGGAGG + Intergenic
1023849195 7:44140822-44140844 CCAGCTCTAGGGAAGGTGGGAGG + Intronic
1024356307 7:48416772-48416794 ATGGGTCTGGGGCAGGTGGGAGG - Intronic
1025055576 7:55762057-55762079 CAGGGCATTGGGAGGGTGGGAGG - Intergenic
1025910386 7:65824094-65824116 CAGGGCATTGGGAGGGTGGGAGG + Intergenic
1026481615 7:70784600-70784622 CTGGGTCATGGGAGGAGGGGAGG - Intronic
1027053150 7:75032215-75032237 CTGGGAGTGGGGACGGTGGGGGG + Intronic
1027969952 7:85066497-85066519 CAGGGTGTTGGGAAGGGGTGGGG + Intronic
1028651251 7:93152528-93152550 GTGGGGATTGGGAAGGGGGGGGG + Intergenic
1032156457 7:129473475-129473497 CAGCTACTTGGGAAGGTGGGAGG - Intronic
1033052234 7:138015880-138015902 CAGTGACTTGTGAAGGTGGGAGG + Intronic
1033242088 7:139688757-139688779 CTGGATTTTGGTGAGGTGGGAGG - Intronic
1033281474 7:140009576-140009598 GTGGGTGTGGGGAAGGTGTGGGG - Intronic
1033615276 7:143008174-143008196 CTGATTCTTTGGAAGGTAGGCGG + Intergenic
1034422853 7:150998456-150998478 CTGGGGCCTGGCATGGTGGGGGG - Intronic
1035108951 7:156464414-156464436 TTGTGTCCTGGGATGGTGGGAGG - Intergenic
1035170662 7:157015610-157015632 CAGGGTCCAGGGAAGCTGGGAGG - Intergenic
1035236278 7:157499573-157499595 CTGGGGCTCGGAGAGGTGGGTGG - Intergenic
1035305832 7:157930690-157930712 CTGGGTCTGGGGCAGGTAAGCGG + Intronic
1035987703 8:4453168-4453190 CTGTGTGTTGGGATGGAGGGGGG - Intronic
1036283692 8:7424139-7424161 CTGGGGCATGGAAAGGTTGGAGG + Intergenic
1037020595 8:13965769-13965791 CTTGGTTTTGGGAGGGAGGGAGG - Intergenic
1037291031 8:17349589-17349611 ATGGGATTTGGGAAGGTGGAGGG - Intronic
1037745013 8:21636280-21636302 CTGGGGCTTGGGGAGCAGGGTGG + Intergenic
1037917051 8:22779049-22779071 GTAGGTGGTGGGAAGGTGGGCGG + Intronic
1038666615 8:29543083-29543105 TAGGGTCTTGGGAAGTGGGGAGG - Intergenic
1039837656 8:41269654-41269676 CTCGGGCTTGGGAGGGTTGGAGG - Intronic
1041804639 8:61836745-61836767 CTCTGTCTAGGGAGGGTGGGGGG + Intergenic
1041839035 8:62248430-62248452 CTGGGGGTTGGGAGGGTGGTCGG - Intergenic
1042878058 8:73457892-73457914 CTGGGTCTTGTGGAGGTGAATGG + Intronic
1047175185 8:122534171-122534193 CGGGGTGTTGGGAAGGGGGATGG - Intergenic
1047753250 8:127898676-127898698 CTGCCTCCTGGGAAGGTGAGAGG - Intergenic
1048509644 8:135050601-135050623 TTGGGCCTTGGGAAGGTTGGTGG + Intergenic
1049198305 8:141327355-141327377 CTGGGTCCTGGGGATGGGGGCGG + Intergenic
1049234467 8:141505564-141505586 CTGGATCCTGGAGAGGTGGGAGG - Intergenic
1049250131 8:141583777-141583799 CTGGGTCTGGGGAGGCAGGGGGG + Intergenic
1049426828 8:142541505-142541527 CTGGGCCTTGTGTGGGTGGGGGG - Intronic
1049434315 8:142579427-142579449 GTGGGACCTGGGAAGGAGGGAGG + Intergenic
1049685475 8:143937628-143937650 CTGGCTCTTGGGCGGGTAGGTGG - Intronic
1049691107 8:143959607-143959629 CCGGGTGCTGGGCAGGTGGGAGG + Intronic
1050457253 9:5846039-5846061 CTGGGTCTGGAGAGGTTGGGTGG + Intergenic
1050568364 9:6911825-6911847 CTGGGGCTCGGGGAGGTGGCAGG + Intronic
1050816462 9:9819122-9819144 CTGGGGCTTTGGAAGGCTGGAGG + Intronic
1051174084 9:14346491-14346513 CTGGGCCTGGGGACGCTGGGCGG - Intronic
1051199160 9:14597842-14597864 CTGGGTGTTGGTAGGCTGGGTGG - Intergenic
1051363686 9:16304790-16304812 CTGCATCCTGGAAAGGTGGGGGG + Intergenic
1052552652 9:29970312-29970334 CTGTGTCTTGGAAAGGGTGGGGG + Intergenic
1052728500 9:32258852-32258874 CTGGGTATGGGGTAGGTGGGTGG - Intergenic
1055872650 9:80902085-80902107 GTGGGTCAGGGGAAGGAGGGAGG + Intergenic
1055966781 9:81873095-81873117 CTGGATCTTAGGAAGATAGGAGG + Intergenic
1056007134 9:82284882-82284904 CTGCCTCGGGGGAAGGTGGGTGG - Intergenic
1056039592 9:82649214-82649236 CTGGGAGTTGGGAATGGGGGAGG - Intergenic
1056559369 9:87716853-87716875 CAGGCTCCTGGGAAGCTGGGTGG - Intergenic
1056568767 9:87797949-87797971 CAGGCTCCTGGGAAGCTGGGTGG + Intergenic
1056860387 9:90175475-90175497 CTGGGGGTTGGGGAGATGGGTGG + Intergenic
1057793934 9:98142662-98142684 CTGAGTCTGTGGGAGGTGGGAGG - Intronic
1058261803 9:102842629-102842651 CTGAGTGTTGGAAAGGTAGGTGG + Intergenic
1059235293 9:112755520-112755542 CAGGGTCTTGAGCAGGAGGGGGG + Intronic
1059486155 9:114628468-114628490 CTGTGTTTTGGGAATGTGAGAGG + Intronic
1060116999 9:120949830-120949852 CTGGGATTTGGGTAGGTGGGAGG - Intergenic
1060205993 9:121683174-121683196 CAGGGCCTGGGGAAGCTGGGTGG - Intronic
1061371791 9:130201541-130201563 CTGGGCCTGGGGGAGGAGGGCGG + Intronic
1061421691 9:130476221-130476243 CTGGGGCCTCCGAAGGTGGGAGG + Intronic
1061864507 9:133485422-133485444 CCGTGTCTTGGGAAGGTGGGAGG + Intergenic
1062042338 9:134409832-134409854 CTGGGCCTTGTGGAGGTGGGAGG + Intronic
1062189074 9:135238050-135238072 TTGTGTCCTGGGAAGCTGGGAGG - Intergenic
1062249900 9:135588748-135588770 CTGGGGCTGGGGCTGGTGGGGGG + Intergenic
1062371131 9:136239383-136239405 CCGGTACTTTGGAAGGTGGGAGG - Intronic
1062431617 9:136529053-136529075 CTGGGTCTGGGGAGGGCGTGGGG - Intronic
1062628549 9:137453689-137453711 GAGGCTCTGGGGAAGGTGGGCGG + Intronic
1203654532 Un_KI270752v1:10101-10123 CTGGGGCTGGGGCGGGTGGGGGG + Intergenic
1186874842 X:13806935-13806957 GTTGGTTTTGGGAACGTGGGAGG + Intronic
1187305660 X:18093319-18093341 CTGGGTCCTGGGGAGTGGGGTGG + Intergenic
1187889760 X:23923320-23923342 CTGGGTCTTGGAGAGATTGGTGG + Intronic
1188007346 X:25024579-25024601 TGGGATCCTGGGAAGGTGGGGGG - Intergenic
1188024266 X:25192587-25192609 CTGGGTGTGAGGAATGTGGGTGG + Intergenic
1188144749 X:26597195-26597217 CTGGGTCTTAGGAGGGCAGGGGG + Intergenic
1188270599 X:28135408-28135430 CAGGGTTTAGGGATGGTGGGAGG - Intergenic
1189159977 X:38801499-38801521 CGGGGTCTGGGGGAGCTGGGAGG + Intronic
1190212430 X:48459198-48459220 ATGGGTCCTGGGAAGGTGGAAGG - Intronic
1190311036 X:49117205-49117227 CTTGGTCCTAGGAATGTGGGTGG - Intronic
1190879741 X:54483779-54483801 CTTGGGCTTGGGCAGCTGGGCGG - Intronic
1191786194 X:64919319-64919341 CTTGTGCTTGGGAAGGTGTGGGG - Intronic
1194024534 X:88735640-88735662 CTGTGTCTGGGGAGGGTGGGTGG + Intergenic
1194728228 X:97424342-97424364 CTGGTTCTTGGGAATGTGGGTGG + Intronic
1194964729 X:100274492-100274514 ATGGGTCTTGGGGAGAGGGGAGG + Intergenic
1195085106 X:101406438-101406460 CTGGGTGGTGGAACGGTGGGGGG + Intronic
1195672942 X:107484464-107484486 CTGGGATTTGGGGAGGAGGGAGG - Intergenic
1195688490 X:107605390-107605412 CTGTGTGTTGGGGAGGTGGGAGG - Intergenic
1195767150 X:108307826-108307848 CTTGGCCCTGGGAAGGTAGGAGG + Intronic
1196812533 X:119640144-119640166 CTGGATAGTGGGAGGGTGGGAGG - Intronic
1197543521 X:127794741-127794763 CTGGGTTTGGGGGAGGGGGGAGG + Intergenic
1197586633 X:128355943-128355965 CTGAGTCTAGGGAAGGTAGGAGG - Intergenic
1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG + Intronic
1198153051 X:133930214-133930236 CTGGGCCTGGGGCAGTTGGGGGG - Intronic
1198957288 X:142146936-142146958 CTGGGTGTTGAGTGGGTGGGAGG - Intergenic
1201148838 Y:11083485-11083507 CTGGGTCCTGAGAAGTTGGTAGG - Intergenic
1202273023 Y:23088565-23088587 CTGGGTCTTGTCCAGGTGTGTGG + Intergenic
1202293003 Y:23332117-23332139 CTGGGTCTTGTCCAGGTGTGTGG - Intergenic
1202426020 Y:24722309-24722331 CTGGGTCTTGTCCAGGTGTGTGG + Intergenic
1202444769 Y:24947777-24947799 CTGGGTCTTGTCCAGGTGTGTGG - Intergenic