ID: 1083656165

View in Genome Browser
Species Human (GRCh38)
Location 11:64230714-64230736
Sequence AGACTGAAGCAGGCCCGGAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 328}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083656165_1083656173 21 Left 1083656165 11:64230714-64230736 CCTCTCCGGGCCTGCTTCAGTCT 0: 1
1: 0
2: 1
3: 28
4: 328
Right 1083656173 11:64230758-64230780 AGGCCCCTTCCCTCTGCCCCCGG 0: 1
1: 0
2: 10
3: 76
4: 653
1083656165_1083656169 -4 Left 1083656165 11:64230714-64230736 CCTCTCCGGGCCTGCTTCAGTCT 0: 1
1: 0
2: 1
3: 28
4: 328
Right 1083656169 11:64230733-64230755 GTCTTCCTTTGCAGAACAACGGG 0: 1
1: 0
2: 0
3: 7
4: 155
1083656165_1083656168 -5 Left 1083656165 11:64230714-64230736 CCTCTCCGGGCCTGCTTCAGTCT 0: 1
1: 0
2: 1
3: 28
4: 328
Right 1083656168 11:64230732-64230754 AGTCTTCCTTTGCAGAACAACGG 0: 1
1: 0
2: 2
3: 16
4: 224
1083656165_1083656174 22 Left 1083656165 11:64230714-64230736 CCTCTCCGGGCCTGCTTCAGTCT 0: 1
1: 0
2: 1
3: 28
4: 328
Right 1083656174 11:64230759-64230781 GGCCCCTTCCCTCTGCCCCCGGG 0: 1
1: 0
2: 13
3: 97
4: 711
1083656165_1083656171 1 Left 1083656165 11:64230714-64230736 CCTCTCCGGGCCTGCTTCAGTCT 0: 1
1: 0
2: 1
3: 28
4: 328
Right 1083656171 11:64230738-64230760 CCTTTGCAGAACAACGGGCCAGG 0: 1
1: 0
2: 0
3: 4
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083656165 Original CRISPR AGACTGAAGCAGGCCCGGAG AGG (reversed) Exonic
900741897 1:4335438-4335460 AGACTGAAGCAGCCCAGGCATGG - Intergenic
901240692 1:7691459-7691481 AGATTGAAGGAGGCTCAGAGAGG + Intronic
902269324 1:15291871-15291893 AGACTCAAGCAGCCTAGGAGAGG - Intronic
902570023 1:17341387-17341409 AGAATGAAACAGGCCGGGTGTGG - Intronic
902724996 1:18329590-18329612 AGACAGATGCAGCCCTGGAGAGG + Intronic
902941962 1:19806893-19806915 AGATTGAACCAGGCCAGGAGCGG + Intergenic
903517073 1:23918465-23918487 AAACAGAAGCAGGCCGGGTGCGG + Intergenic
904486808 1:30830325-30830347 AGACTGAAGCTGGTGGGGAGGGG + Intergenic
904699326 1:32349027-32349049 AAACTCAAGCAGGCCCAGGGAGG - Intergenic
905233556 1:36530286-36530308 AGACTGAGGCAGGGCGGGGGCGG - Intergenic
905884662 1:41485179-41485201 AGAGGGAGGCAGGCCCAGAGAGG - Intergenic
906640446 1:47437999-47438021 GGACTGAGGCAGGCAGGGAGGGG - Exonic
907362405 1:53929209-53929231 ACACTGAAGCAGGGAGGGAGTGG - Intronic
907513443 1:54979140-54979162 AGGTTGAAGCAGGGCCCGAGGGG + Intergenic
907684231 1:56594356-56594378 AGAGTGAAGCAGGTCTGGGGAGG + Intronic
907822549 1:57985196-57985218 ATACTAAAGCAGGCCGGGTGTGG - Intronic
908666174 1:66493671-66493693 AGTCTTAAGCAGACCCAGAGAGG + Intergenic
909725780 1:78833125-78833147 AGGCTGAGGCAGGACCCGAGAGG + Intergenic
911100995 1:94095645-94095667 AGCCTGAGGCAGGCCCAGAAAGG - Intronic
915214944 1:154333923-154333945 ATAATGAAGCAGGCCGGGCGCGG - Intronic
915641730 1:157232783-157232805 AGACAGAAGCAGGGCAGGAGAGG - Intergenic
915666950 1:157453754-157453776 AGACAGGAGCAGGGCAGGAGAGG + Intergenic
915936344 1:160092297-160092319 AGACTGTAACAGGCCCTGAGCGG + Exonic
916226001 1:162490111-162490133 AGACTGTAGGAGGGCAGGAGTGG + Intergenic
919846751 1:201647693-201647715 AGACTGAAGTAGGGCGGGACTGG + Intronic
920512951 1:206564359-206564381 AGACAGAAGGAGGGCAGGAGGGG - Intronic
920691347 1:208148798-208148820 GGCCTGAAGGAGGCCCTGAGGGG + Intronic
923661168 1:235958584-235958606 AGACACAAGCAGGGCAGGAGAGG - Intergenic
923799708 1:237195555-237195577 AGATTGAAGGAGGCCTGGTGTGG - Intronic
1063159864 10:3411421-3411443 AGACTTAAGCAGACGAGGAGGGG + Intergenic
1064330389 10:14388468-14388490 TGAATGAAACAGGCCGGGAGCGG - Intronic
1064837031 10:19544476-19544498 AGACTCAAGTAGGCCTGGTGTGG - Intronic
1066393040 10:34994169-34994191 TGACTGAAGCAGGCTGGGGGTGG - Intergenic
1066758686 10:38735831-38735853 AGACTGCAGCACGACCAGAGTGG + Intergenic
1066962961 10:42236937-42236959 AGACTGCAGCACGACCAGAGTGG - Intergenic
1067284002 10:44894438-44894460 AGACTAAAAGAGGCCCTGAGAGG + Intergenic
1067357732 10:45546489-45546511 AGAATAAAGCAGGCCAGGAGTGG + Intronic
1069844254 10:71359713-71359735 AGGAGGAAGCAGGCCCAGAGAGG + Intronic
1070370464 10:75777391-75777413 AGACTGAAGCAGCCCCCAAAAGG - Intronic
1071545625 10:86526773-86526795 AGACAGAGGCAGGCCCGGCAAGG - Intergenic
1073363758 10:102919834-102919856 ATCATGAAGCAGTCCCGGAGTGG - Exonic
1073372862 10:103006494-103006516 AATCTAAAGCAGGCCAGGAGTGG - Intronic
1073430476 10:103483448-103483470 AGAATGAAGCAGGCCAGATGTGG + Intergenic
1073575628 10:104620542-104620564 AGACTAAAGCAGGTGCGGAAGGG + Intergenic
1075067430 10:119298857-119298879 AGGCTGAAGTTGGCCAGGAGTGG - Intronic
1075680377 10:124326917-124326939 AGACTGAAGCAGCCCCTGGAAGG - Intergenic
1076400130 10:130177657-130177679 ACACTCAAGAAGGCACGGAGAGG - Intronic
1076768061 10:132647600-132647622 GGCATGACGCAGGCCCGGAGAGG + Intronic
1077457563 11:2690048-2690070 AGACAGAAGCAGGCTAGGAGAGG - Intronic
1077694930 11:4385370-4385392 GGACTGAAGAAGGGCCGCAGAGG + Exonic
1078341052 11:10498252-10498274 AGACTGAAGGAGGCACTGGGGGG + Intronic
1080016431 11:27511516-27511538 ACACTGAAGCAGGGCAGAAGTGG + Intergenic
1080855726 11:36110049-36110071 AAACTGAAGGAGGCTGGGAGAGG + Intronic
1081626543 11:44659348-44659370 AGACTGAAGAAGGAACGGAGAGG + Intergenic
1083329213 11:61889703-61889725 AGACTAGAGCAGGCCGGGAGTGG + Intronic
1083656165 11:64230714-64230736 AGACTGAAGCAGGCCCGGAGAGG - Exonic
1084272876 11:68038525-68038547 CCAGTGAAGCAGGCCCAGAGTGG + Intergenic
1084601565 11:70148885-70148907 AGGCTGAAGAAGGTCCCGAGAGG + Intronic
1085469908 11:76751025-76751047 AGCCTGAAGCAGGCCCGAGGAGG - Intergenic
1087637328 11:100716909-100716931 TGACTGAAGGAGGGCCAGAGAGG + Intronic
1088465949 11:110138847-110138869 AGAATAATGCAGGCCAGGAGTGG - Intronic
1089065240 11:115657636-115657658 AGACTTAAGCAGGCTCTCAGAGG + Intergenic
1090606662 11:128428958-128428980 AAACTGAATGAGGCCCGGGGAGG - Intergenic
1092029875 12:5275267-5275289 AGGCTGGAGCAGGGCCCGAGCGG - Intergenic
1092348845 12:7739399-7739421 AGAATGAAACAGGCCAGGCGCGG - Intronic
1092864155 12:12745249-12745271 AGACTGAAGAAGGCCGGGCGAGG + Intronic
1096059749 12:48686671-48686693 AGAGTGAAGGAGGCCCAGACGGG + Intergenic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1096503310 12:52078647-52078669 AGACTGCAGCAGGCCAAGTGGGG - Intergenic
1096613565 12:52818816-52818838 AGAATGACTCAGGCCCGGTGGGG - Intergenic
1099366836 12:81776027-81776049 AGACTTAAGCAGGCAAGTAGGGG + Intergenic
1099723051 12:86388972-86388994 AGAATGAAACTGGCCAGGAGTGG - Intronic
1100017249 12:90025481-90025503 AGAGAGAAGCAGGCCGGGAGCGG - Intergenic
1100543164 12:95577042-95577064 AAACTGAAGCAGGCCGGGCGTGG - Intergenic
1100868088 12:98879055-98879077 AGCCTGAAGCAAGCCCAGAGTGG - Intronic
1104512632 12:129394481-129394503 GAACTCACGCAGGCCCGGAGAGG - Intronic
1104667432 12:130657425-130657447 AGCCGGAAGCAGGCCCCGGGAGG + Intronic
1106997246 13:35500238-35500260 GGATTGAAGCAGGCTCCGAGTGG - Intronic
1107684815 13:42886216-42886238 AGACAGGAGCAGGCCAAGAGAGG - Intergenic
1109408715 13:61936444-61936466 AGACAGAAGCAGGGCAGGAAGGG - Intergenic
1109768405 13:66935344-66935366 AGACTGAATAAGGCCAGGAATGG - Intronic
1111417414 13:87967555-87967577 AAGATGAAGCAGGCCCGGCGCGG + Intergenic
1112325797 13:98442135-98442157 CGACTGCAGCAGCCCCGCAGAGG - Intronic
1115181164 14:30627454-30627476 AGACTGATCCAGGCCGGGCGTGG + Intronic
1115408960 14:33050982-33051004 AGACTAAAGAAGGCCGGGCGCGG + Intronic
1115547823 14:34478997-34479019 AGACAGAAGCAGGCTGGGTGCGG - Intergenic
1116550337 14:46229586-46229608 AGACGGTAGTAGGCCTGGAGAGG - Intergenic
1117158684 14:52966092-52966114 AGAATGGAGAAGGCCAGGAGCGG - Intergenic
1118358297 14:65034197-65034219 AGACTGAAGCAGGAGGGCAGAGG - Intronic
1118659032 14:67987020-67987042 AGACTGAAGGGGGCCAGGCGTGG - Intronic
1119325017 14:73754693-73754715 AGACAGAGGAAGGCCAGGAGGGG + Intronic
1120270286 14:82304195-82304217 AGACAGCAGCAGGCCCAGATAGG - Intergenic
1121005729 14:90489529-90489551 AGACTTCAGCAAGCCCTGAGGGG + Intergenic
1121652999 14:95573811-95573833 AGACATAAGCAGGGCAGGAGAGG - Intergenic
1122149722 14:99718370-99718392 AGTCGGGAGCAGGCTCGGAGGGG - Intronic
1123422896 15:20145821-20145843 AGACTGCAGCATGACCAGAGTGG - Intergenic
1123532122 15:21152361-21152383 AGACTGCAGCATGACCAGAGTGG - Intergenic
1124624808 15:31301676-31301698 GGCCTGAAGCAGGTCCCGAGGGG + Intergenic
1125885432 15:43226209-43226231 ACACAGAAGCAGACCCGAAGGGG + Intergenic
1128079943 15:64850971-64850993 AGCCTGAGGCAGGCTGGGAGAGG - Intronic
1128367065 15:67012042-67012064 AGAATGTAGCAAGCCTGGAGGGG + Intergenic
1128507633 15:68287179-68287201 AGAATGAATCAGGCCGGGTGCGG - Intronic
1129055805 15:72819388-72819410 AGACAGGAGCAGGGCAGGAGAGG + Intergenic
1130769855 15:86913571-86913593 AGGCTGAAGCAGGCAAGGCGTGG + Intronic
1134077656 16:11303322-11303344 AGACATAAGCAGGGCAGGAGAGG + Intronic
1134412845 16:14017344-14017366 AGACTGCAGCAGGCCGGGCGCGG - Intergenic
1135088740 16:19495302-19495324 ACACTGAAGTAGGCCGGGCGCGG - Intronic
1135906343 16:26515393-26515415 AGACTGAAGCAAACCAGGATGGG + Intergenic
1136567675 16:31079905-31079927 AGACTGAAGCCAGCTCTGAGCGG + Exonic
1136724131 16:32343378-32343400 AGACTGCAGCACGACCAGAGTGG - Intergenic
1136842465 16:33549422-33549444 AGACTGCAGCACGACCAGAGTGG - Intergenic
1136861850 16:33709519-33709541 AGACTGCAGCACGACCAGAGTGG + Intergenic
1136995377 16:35185417-35185439 AGACCACAGCAGGCCCTGAGTGG - Intergenic
1137259328 16:46811211-46811233 AGAGAGAAGCAGGCCAGGCGCGG + Intronic
1137848368 16:51713824-51713846 GGACTGAGGCAGGCCAGCAGGGG - Intergenic
1139332195 16:66201957-66201979 AAACTAAAGCAGGCCTGGCGTGG - Intergenic
1139593757 16:67946869-67946891 GGACTGCAGCTGGCACGGAGGGG - Intronic
1140085248 16:71790248-71790270 AGACTGAAGCAGGCCAGGCACGG + Intronic
1140105015 16:71951987-71952009 AGACTAAAGCAAGGCCAGAGTGG + Intronic
1140471252 16:75216252-75216274 GGAATGAAGCAGGCCTGGTGTGG - Intergenic
1141649750 16:85386627-85386649 AAACTGAGGGAGGCCCAGAGAGG - Intergenic
1142206501 16:88785390-88785412 CGACTGGCGCTGGCCCGGAGCGG + Intergenic
1142232861 16:88907864-88907886 AGACTCAGGCATGCCCAGAGAGG - Intronic
1203002301 16_KI270728v1_random:174387-174409 AGACTGCAGCACGACCAGAGTGG + Intergenic
1203123346 16_KI270728v1_random:1557702-1557724 AGACTGCAGCACGACCAGAGTGG + Intergenic
1203133905 16_KI270728v1_random:1710793-1710815 AGACTGCAGCACGACCAGAGTGG + Intergenic
1203152630 16_KI270728v1_random:1849719-1849741 AGACTGCAGCACGACCAGAGTGG - Intergenic
1142892162 17:2950899-2950921 AAATTGAAGCAGGCCGGGCGCGG - Intronic
1142988154 17:3710134-3710156 AGACTGCAGGAGGCCGGGCGTGG + Intergenic
1143181961 17:4988924-4988946 AGACTGAAGAAGGCCCAGTGGGG - Exonic
1144099836 17:11933668-11933690 AGCCTGAAGAAGGCCGGGCGCGG - Intronic
1144711838 17:17406303-17406325 AGACAGCACCAGGCCCGGAAGGG - Intergenic
1144793261 17:17873739-17873761 AGGGAGAAGCAGGCCTGGAGAGG - Intronic
1146930211 17:36771682-36771704 AGATGGCAGCAGGCCGGGAGAGG + Intergenic
1149995982 17:61406087-61406109 GGAAGGAAGCAGGCCCAGAGAGG - Intronic
1151375393 17:73685042-73685064 AGACTGAGGCAGCCCAAGAGGGG + Intergenic
1151716089 17:75831670-75831692 AGACAGAACCAGGCCGGGCGTGG + Intronic
1152118882 17:78406024-78406046 ATACTGAAGCCGGCCAGGCGCGG + Intronic
1152124877 17:78440547-78440569 AGAGTGAAGCAGGCCGGGGGCGG - Intronic
1152138803 17:78524426-78524448 AGCATGAATCAGGCCCGGTGTGG - Intronic
1152825227 17:82460472-82460494 AGACTGAAATAGGCCAGGCGTGG + Intronic
1154112900 18:11585602-11585624 AGACATAAGCAGGGCAGGAGAGG + Intergenic
1154466168 18:14643884-14643906 AGACTGCAGCTTGACCGGAGTGG + Intergenic
1157306019 18:46518304-46518326 AGACTGAGGCAGGTCAGGTGGGG - Intronic
1160529999 18:79557178-79557200 GGACTGAAGCAGGTCCACAGAGG + Intergenic
1161599651 19:5173802-5173824 AGACAAAAACAGGCCAGGAGCGG + Intronic
1161770623 19:6228879-6228901 AGGCTGAAGCAGGCGCCGTGGGG - Intronic
1162812610 19:13173282-13173304 AGGCTGAGGCAGGCCCTGTGTGG + Intergenic
1163219774 19:15910259-15910281 AGACTGCAACAGGCCGGGCGCGG + Intergenic
1163629487 19:18410420-18410442 AAACTGAACCAGGCCGGGCGCGG - Intergenic
1164554715 19:29242748-29242770 AGAGTGAAACAGGCCGAGAGAGG + Intergenic
1164946868 19:32302749-32302771 ATACTGAAGAAGGCCAGGTGCGG - Intergenic
1165284655 19:34831983-34832005 AGACTGAGCCAGACCCGGTGTGG + Intergenic
1165892915 19:39125673-39125695 AGGCTGGAGCGGGCCCTGAGAGG + Intergenic
1165943546 19:39427801-39427823 AAACTGAGGCAGGCACAGAGAGG + Exonic
1166824768 19:45601986-45602008 AGACTGAGGCAGCCCCCGAGGGG + Intronic
1166863402 19:45822460-45822482 AGACTGGAGCCGGGCCTGAGAGG + Intronic
1167146250 19:47682014-47682036 TGACCGAGGCAGGCACGGAGAGG - Exonic
1167259065 19:48447669-48447691 AAACTGAAGGAGGCCGGGTGTGG - Intronic
1167433074 19:49464358-49464380 AGACGGTGGCAGGCCGGGAGAGG - Intronic
1167445124 19:49533277-49533299 TGACTCAGGCAGGCCTGGAGAGG + Intronic
1167529902 19:50008693-50008715 AGGCTGCAGCAGGCACGGGGGGG + Intronic
1167621336 19:50562687-50562709 AGAGTGAGGCAGGGCAGGAGGGG - Intronic
926276002 2:11403683-11403705 GGAATGAAGCAGGCCGGGCGCGG - Intergenic
926762872 2:16294929-16294951 AGACTGAAGCAGGCATGAAATGG - Intergenic
926975736 2:18515104-18515126 AGACAGAAGCAGGCCTGGGAAGG - Intergenic
927468170 2:23352121-23352143 AGGCTGAAGAAGGTCCAGAGGGG - Intergenic
928282838 2:29964079-29964101 TGACTGAGGCAGGGCGGGAGTGG - Intergenic
929742721 2:44620976-44620998 AGCCTGGAGCAGGCCGGGTGCGG + Intronic
930014469 2:46960877-46960899 GGGCTGAAGGAGGCCCAGAGAGG - Intronic
930446514 2:51480591-51480613 AAACTGAAACAGGCCAGGCGTGG + Intergenic
932316389 2:70786756-70786778 AGGCTGAAGAAGGCCAGGACTGG - Intronic
933385913 2:81609906-81609928 AGGCAGAAGCAGGCCGGGCGCGG - Intergenic
934322009 2:91980176-91980198 AGACTGCAGCATGACCAGAGTGG + Intergenic
934460293 2:94210962-94210984 AGACTGCAGCATGACCAGAGTGG + Intergenic
934609961 2:95727795-95727817 AGCCTGAGGCAGGCATGGAGGGG - Intergenic
934918109 2:98317394-98317416 AGACTGGTTCAGGCCCTGAGGGG + Intergenic
935261520 2:101359648-101359670 AGACATGAGCAGGCCAGGAGAGG - Intronic
935872210 2:107463431-107463453 AAACAGAAGCAGGCCGGGCGCGG + Intergenic
936224459 2:110635279-110635301 AGACTGCAGCACGGCCAGAGTGG + Intergenic
937239302 2:120450094-120450116 AGGTTGAAGCAGGCCGGGAAAGG + Intergenic
938023760 2:127927096-127927118 AGCCAGAGGCAGGCCCGGAGCGG + Intergenic
938870448 2:135470393-135470415 AAACTGAAGCAGGCCAGGAGCGG + Intronic
940108747 2:150127395-150127417 AGTTTGAAGCAGGCCGGGTGGGG - Intergenic
941718219 2:168786190-168786212 AGACATCAGCAGGCCAGGAGAGG + Intergenic
942895434 2:181047751-181047773 GGTCTGGAGGAGGCCCGGAGGGG - Intronic
944892536 2:204132529-204132551 AGACAGAAGGAGGCATGGAGAGG + Intergenic
946767784 2:223056105-223056127 AGTCTGAAGGAGACCAGGAGAGG - Intronic
947503562 2:230689824-230689846 ACACTGAAACAGGCCGGGTGCGG - Intergenic
948476038 2:238220681-238220703 AGCCTGAAGGAGCCCCGCAGCGG + Intergenic
948830378 2:240595704-240595726 AGACTGAGGGAGGCAGGGAGAGG - Intronic
948953734 2:241272167-241272189 AGACTGACGCGGGCCCCGCGCGG + Intronic
1169132528 20:3173519-3173541 AGCCCGAAGCACGCCCGGCGGGG + Exonic
1170700425 20:18698687-18698709 AGACAGATGCAGGCAGGGAGCGG - Intronic
1172969881 20:38865579-38865601 AGAATGCAGCAGGCCGGGCGCGG - Intronic
1173564058 20:44026809-44026831 AGAAGGAAGGAGGCCCAGAGAGG - Intronic
1173835877 20:46125253-46125275 AGACTAAAGTAGGCCGGGCGTGG + Intronic
1174113389 20:48211333-48211355 TGAGTGAAACAGGCCAGGAGTGG - Intergenic
1174281393 20:49442065-49442087 AGCCTGAAGCAGGCTCAGAAGGG - Intronic
1174340720 20:49893377-49893399 GGAATGAAGCTGGCCTGGAGCGG + Intergenic
1176152676 20:63600425-63600447 AGACTGCAGCAGGCCGGGCGCGG + Intronic
1176521851 21:7830151-7830173 AGACAGGAGGGGGCCCGGAGCGG + Intergenic
1176808419 21:13514712-13514734 AGACTGCAGCTTGACCGGAGTGG - Intergenic
1176867273 21:14060470-14060492 AGACTGCAGCATGACCAGAGTGG - Intergenic
1177681314 21:24375289-24375311 AGAGTGAAGCAGACCCTGTGAGG + Intergenic
1178121270 21:29472841-29472863 ATACTGCAGCAGGCCAGGCGCGG - Intronic
1178479481 21:32967254-32967276 AGACATGAGCAGGCCAGGAGGGG + Intergenic
1178655871 21:34460163-34460185 AGACAGGAGGGGGCCCGGAGCGG + Intergenic
1179569836 21:42272236-42272258 AGAGTGAGGCAGGGCCAGAGAGG + Intronic
1180015805 21:45082821-45082843 AGACTGAAGGAGACCAGAAGTGG - Intronic
1180062547 21:45393096-45393118 CGCCTGCAGCAGGCCCGCAGGGG + Intergenic
1180064849 21:45407040-45407062 AAGCGGAAGCAGGCCCAGAGAGG + Intronic
1180548755 22:16526092-16526114 AGACTGCAGCATGACCAGAGTGG + Intergenic
1180754368 22:18150118-18150140 AGACCAAGGCGGGCCCGGAGCGG + Exonic
1182164120 22:28155057-28155079 AGACTGAATCAGGCTCACAGAGG - Intronic
1182279767 22:29211171-29211193 AGACCAAAGCAGGCCCAGAGGGG - Intronic
1183947913 22:41337436-41337458 TGAGTGAAGCAGGCCCAGAGTGG + Intronic
1184531904 22:45061594-45061616 AGCCAGAAGCAGGACCAGAGAGG + Intergenic
949218428 3:1600343-1600365 AGACTGAGTCAGGCGTGGAGTGG + Intergenic
949810538 3:8001923-8001945 AGGCTGGAGCAGGCCCGGGCGGG + Intergenic
950743026 3:15064865-15064887 CGACTGCAGCCGGCCCGGCGGGG + Intronic
950811662 3:15655021-15655043 AAACTGATGCAGGCCGGGCGCGG - Intergenic
950869579 3:16217042-16217064 AGACATAAGCAGGGCAGGAGAGG - Intronic
951409218 3:22341983-22342005 AGACTGAATGAGGCCGGGCGCGG + Intronic
951933868 3:28000582-28000604 AGACATAAGCAGGGCAGGAGAGG + Intergenic
952943425 3:38459912-38459934 AGCTTGAAGCAGGCCAGGGGAGG - Intronic
953892356 3:46761465-46761487 AAACTAAACCAGGCCAGGAGTGG + Intronic
954619178 3:51985996-51986018 GGATTGAAGCAGGACCTGAGGGG + Intronic
954811343 3:53250235-53250257 AAACAGAAACAGGCCCAGAGAGG + Intronic
957861611 3:85959257-85959279 AGATGGAAGCATGCCAGGAGAGG - Intronic
960285728 3:115826394-115826416 AGACAGAAACAGGCCAGGCGTGG - Intronic
960348264 3:116561729-116561751 ATACTGAAGTAGGCCTGGAGAGG + Intronic
961871056 3:129988555-129988577 AAACTGCAGCAGGCAGGGAGGGG - Intergenic
963047328 3:141112353-141112375 AGACAGAAGGAGGCCGGGCGCGG + Intronic
964255293 3:154768455-154768477 AGACTGTAGGAGGCCGGGCGCGG + Intergenic
965390198 3:168095407-168095429 ACACAAAAGCCGGCCCGGAGGGG + Exonic
967827654 3:193891294-193891316 AAATTGAAGCAGGCCGGGCGCGG + Intergenic
970458732 4:16251564-16251586 AGACTGGAGAAGGCCGGGCGCGG - Intergenic
972016382 4:34251090-34251112 AGACATAAGCAGGGCAGGAGAGG - Intergenic
972912146 4:43830781-43830803 AGACATAAGCAGGGCAGGAGAGG + Intergenic
976606692 4:86990190-86990212 AGACTGAAACTGGCCAGGTGGGG + Intronic
976709158 4:88050733-88050755 AGACTCAAGAAGGCCTGCAGTGG - Intronic
977991115 4:103443756-103443778 AAACTCAGGCAGGCCAGGAGTGG + Intergenic
980271020 4:130583665-130583687 AGACATAAGCAGGGCAGGAGAGG - Intergenic
980494651 4:133575366-133575388 GGACTGCAGCAGCCCGGGAGAGG + Intergenic
982235850 4:153250408-153250430 AGACTGAAGTAGGCCTGGTGTGG - Intronic
983627743 4:169819296-169819318 AGACTGAACGAGGCCGGGCGTGG + Intergenic
983830560 4:172321760-172321782 AGACAAAAGCAGGGCAGGAGAGG + Intronic
984974483 4:185218373-185218395 CTACAGAAGCAGGCCAGGAGTGG - Intronic
985737500 5:1593380-1593402 AGAGGGAAGTAGGCCCGGCGTGG + Intergenic
985783200 5:1881458-1881480 AGCCTGAAGGAGGCGGGGAGAGG + Intronic
986685699 5:10273739-10273761 AGACATAAGCAGGGCAGGAGAGG - Intergenic
987907154 5:24091503-24091525 AAACTGAGGCAGGCCGGGCGCGG + Intronic
987943491 5:24573409-24573431 AGACAAAAGCAGGCCGGGCGCGG + Intronic
988677030 5:33442792-33442814 AGACTGAATGAGGCCGGGCGCGG - Intronic
991573516 5:68079577-68079599 AGCCTGAAGTAGCCCCAGAGAGG + Intergenic
992702446 5:79354289-79354311 AAACTGAAACAGGCCAGGCGCGG - Intergenic
994566632 5:101455077-101455099 AAACTGAAGCAGTCCCTGAAAGG - Intergenic
996367429 5:122717893-122717915 ATATTGAAGCAGGCCTGGTGTGG - Intergenic
997368254 5:133339427-133339449 AGACTGAACCCAGCCAGGAGTGG - Intronic
997376792 5:133403272-133403294 GCTCTGAAGCAGGCTCGGAGAGG - Intronic
997392799 5:133530862-133530884 AGACTCACACAGGCCCTGAGTGG + Intronic
997822644 5:137079725-137079747 AGAGTGAAGCAGGGACGGGGAGG - Intronic
998706240 5:144764793-144764815 AGACTGAAGCAGCCAAGGATAGG - Intergenic
1001095508 5:168772720-168772742 AGAATGCAGCAGCCCCAGAGAGG - Intronic
1002653624 5:180723863-180723885 AGAATAAAGCAGGCCGGGCGCGG - Intergenic
1003955536 6:11162046-11162068 AGACTGAAGCAGGTGTGGAGAGG + Intergenic
1004084901 6:12437234-12437256 ACACTGAAGCAGCCCCAAAGAGG + Intergenic
1004474308 6:15956930-15956952 AGACTTGAGCAGGGCAGGAGAGG - Intergenic
1005753404 6:28904185-28904207 AGACTGAAGTAGGGCCGGACAGG + Exonic
1006023436 6:31131732-31131754 AGACAGAAACAGGCCTAGAGAGG - Intronic
1006456869 6:34136975-34136997 AGAAGGAAGCAGGCCCTGCGGGG - Intronic
1006735440 6:36269854-36269876 AGCCTGAAGGAGCCCAGGAGGGG + Intronic
1006788686 6:36684648-36684670 AGAAGGAAACAGGCCCAGAGAGG + Intronic
1007426284 6:41748384-41748406 AGACAGAAGCAGGGACGCAGCGG - Intronic
1007453678 6:41959675-41959697 AGACTAAATCAGGCCAGGCGCGG + Intronic
1007767610 6:44170169-44170191 AGGCTGCAGCAGGCAGGGAGTGG - Intronic
1007832097 6:44646535-44646557 AGTCTGAAGCTGCCCCGGGGGGG + Intergenic
1008293455 6:49748088-49748110 AGAGTGAAGCAGGTCAGGGGAGG + Intergenic
1009794282 6:68447270-68447292 AGACAGCAGCAGGGCAGGAGAGG + Intergenic
1011478697 6:87773073-87773095 AGACAGGAGCAGGGCAGGAGTGG + Intergenic
1014018773 6:116565033-116565055 AGAGTGAACCAGGCGCGGAGCGG + Intergenic
1017207274 6:151816964-151816986 GGACTGAAGCAATCCCAGAGAGG + Intronic
1018367629 6:163137856-163137878 AGCTTGGAGCAGGCCCTGAGTGG + Intronic
1018382691 6:163273181-163273203 AGAATGATGCAGGCCGGGCGCGG - Intronic
1019579241 7:1751813-1751835 AGACTGAAGGTGGCCGGGCGCGG + Intergenic
1019632607 7:2057949-2057971 GGAGAGAAGCAGGGCCGGAGAGG + Intronic
1019632944 7:2059303-2059325 AGAGAGAAGCAGGGCTGGAGTGG + Intronic
1019632962 7:2059380-2059402 AGAGAGAAGCAGGGCTGGAGAGG + Intronic
1020189426 7:5983940-5983962 AGAATGAAGTAGGCCAGGTGCGG - Intronic
1020268478 7:6577639-6577661 GGAGTGCAGCAGGCTCGGAGGGG - Exonic
1022103722 7:27184136-27184158 AGCCTGGAGCTGGCCCCGAGCGG + Intronic
1022124445 7:27341938-27341960 AGTGGGAAGCAGGCCTGGAGAGG - Intergenic
1024505736 7:50159639-50159661 ACACTGGAGCAGGCCAAGAGAGG - Exonic
1024961566 7:54981794-54981816 AGACTCAGGCAGGCAAGGAGTGG - Intergenic
1025036346 7:55594619-55594641 AGACTGCAGCATGTTCGGAGTGG - Intergenic
1025619768 7:63157887-63157909 AGGCTGAGGCAGGCCAGGCGTGG + Intergenic
1026626796 7:72000865-72000887 AGACATCAGCAGGGCCGGAGAGG + Intronic
1028773259 7:94651449-94651471 AGACTGAACCAGCACCGGCGAGG - Intronic
1029402867 7:100356491-100356513 AGACAGAAGCAGGCAGGGACAGG - Intronic
1029405516 7:100372381-100372403 AGACAGAAGCAGGCAGGGACGGG - Intronic
1029512659 7:101006086-101006108 AGACAGAAGGAGGCCCGGCGCGG - Intronic
1029689770 7:102173589-102173611 AGAATGAAGCAGGACCCCAGGGG - Intronic
1031313613 7:120230596-120230618 AGACTGAAAAAGGCCGGGCGCGG + Intergenic
1031923484 7:127618063-127618085 GGACTGAAGCAGGAGCAGAGTGG - Intergenic
1033269338 7:139916568-139916590 CGAGTGAAGCAGCCCCTGAGAGG - Intronic
1034338255 7:150337190-150337212 ACACTGCAGCTGGCCCGGGGTGG - Exonic
1036671371 8:10790700-10790722 AGACTGAGGCAGGCAGGTAGAGG - Intronic
1036754701 8:11464485-11464507 AGACTGAAACAGACCTTGAGGGG - Intronic
1041229820 8:55738086-55738108 AGACTGAAGTTAGCCAGGAGTGG - Intronic
1042049661 8:64689856-64689878 AAACAGAAGCAGGCCGGGCGTGG - Intronic
1044715100 8:95092871-95092893 AGGCTTCAGCAGGCCGGGAGCGG - Intronic
1044873899 8:96645485-96645507 AGGCTGGAGCAGGCCAGGGGCGG + Intronic
1045295684 8:100870152-100870174 AGACTTAAACTGGCACGGAGGGG - Intergenic
1045895213 8:107208269-107208291 AGACACAAGCAGGGCGGGAGAGG + Intergenic
1046706707 8:117461594-117461616 AGACTGAAGGAGGACCAGTGTGG - Intergenic
1048367856 8:133754028-133754050 AGGCAGAAGCAGCCCCTGAGGGG - Intergenic
1049062362 8:140286231-140286253 AGACTGAAGTAGGAGGGGAGAGG + Intronic
1049203769 8:141353990-141354012 AGACTGTAAGAGGCCGGGAGGGG - Intergenic
1049476523 8:142799540-142799562 AGACAGAAGCAGGCACAGTGAGG + Intergenic
1049755160 8:144308179-144308201 GGCCTGAAGCAGGGCCAGAGAGG - Intronic
1052271632 9:26633785-26633807 ATAATGAAGCAGGCCGGGCGCGG - Intergenic
1052999625 9:34570820-34570842 AGCCTGAAGCAGCTGCGGAGAGG + Intronic
1053425353 9:38006543-38006565 AGGCTGAGGCAGGCCTGGGGAGG + Intronic
1053690791 9:40586659-40586681 AGACTGCAGCATGACCAGAGTGG + Intergenic
1054274013 9:63050832-63050854 AGACTGCAGCATGACCAGAGTGG - Intergenic
1054302049 9:63387630-63387652 AGACTGCAGCATGACCAGAGTGG + Intergenic
1054400827 9:64714136-64714158 AGACTGCAGCATGACCAGAGTGG + Intergenic
1054434434 9:65198450-65198472 AGACTGCAGCATGACCAGAGTGG + Intergenic
1054495956 9:65823231-65823253 AGACTGCAGCATGACCAGAGTGG - Intergenic
1055067785 9:72135899-72135921 AGAATCAAGCAGGCCCCGCGTGG - Intronic
1056697690 9:88873911-88873933 AGAATGAAGCAGGGCCGGTGGGG - Intergenic
1057328064 9:94084627-94084649 CGGCTGCAGCAGGCCCGGCGGGG + Exonic
1057413923 9:94844806-94844828 AGACTGGAGCAGGCCGGATGTGG + Intronic
1057419368 9:94898326-94898348 AGAATGAAGCTGGCCAGGCGTGG + Intronic
1057601635 9:96463234-96463256 AAACTAAAGCAGGCTAGGAGTGG - Intronic
1058033446 9:100224902-100224924 AGAAAGAAGCAGGCCGGGTGCGG - Intronic
1059223909 9:112653612-112653634 AGACAGAAGCAGGCCACGTGCGG + Intronic
1060295562 9:122340771-122340793 AGGCTGAGGCAGGCCTGGTGGGG + Intergenic
1061998733 9:134205007-134205029 GGACGGAAGCAGGCCTGGGGAGG - Intergenic
1062034668 9:134377608-134377630 AGACAGAAGTGGTCCCGGAGAGG - Intronic
1062388353 9:136324149-136324171 AGGAAGAAGCAGGCCGGGAGTGG - Intergenic
1203779714 EBV:94716-94738 AGCTTGAAGCAGGCCCTCAGTGG + Intergenic
1186072813 X:5841225-5841247 AGACAGGAGCAGGGCAGGAGAGG + Intronic
1189185191 X:39048839-39048861 AGCCAGAGGAAGGCCCGGAGAGG + Intergenic
1189897177 X:45667712-45667734 TGATTGAAGCAGGCCAGGTGTGG + Intergenic
1189996522 X:46644343-46644365 AGACTGAATCTGGCCGGGTGTGG + Intronic
1190110614 X:47586685-47586707 AGCCTGAATCCTGCCCGGAGTGG + Exonic
1190766347 X:53478916-53478938 AGAATGAAGCAGGCTGGGTGTGG + Intergenic
1191104460 X:56764030-56764052 AGGCTGAAGCAGGACAAGAGAGG + Intergenic
1191108651 X:56788430-56788452 AGACTGAAGCAGGATGAGAGAGG + Intergenic
1191136064 X:57066799-57066821 AGAGTGAAGCAGGCCAGCTGGGG + Intergenic
1191648240 X:63507116-63507138 AGACTGAAGCAGACCATGAAGGG + Intergenic
1197470406 X:126861396-126861418 AGACTTGAGCAGGGCAGGAGAGG + Intergenic
1197725740 X:129775272-129775294 ACCTTGAAGCAGGCCCAGAGGGG - Intergenic
1197758825 X:130014000-130014022 AAACTGAAGGAGGCCGGGATGGG - Exonic
1201189494 Y:11435355-11435377 AGACTGCAGCACGACCAGAGTGG + Intergenic
1202584149 Y:26406616-26406638 AGACTGCAGCACGACCAGAGTGG - Intergenic