ID: 1083656799

View in Genome Browser
Species Human (GRCh38)
Location 11:64234004-64234026
Sequence TGGTTCCTGGACAGGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 330}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083656799_1083656813 24 Left 1083656799 11:64234004-64234026 CCCTGCTCCCTGTCCAGGAACCA 0: 1
1: 0
2: 1
3: 18
4: 330
Right 1083656813 11:64234051-64234073 ACCCAGGTGCCCTCTCCTCCAGG 0: 1
1: 0
2: 4
3: 53
4: 396
1083656799_1083656807 8 Left 1083656799 11:64234004-64234026 CCCTGCTCCCTGTCCAGGAACCA 0: 1
1: 0
2: 1
3: 18
4: 330
Right 1083656807 11:64234035-64234057 GATCCCTATCCCAACCACCCAGG 0: 1
1: 0
2: 0
3: 7
4: 121
1083656799_1083656815 25 Left 1083656799 11:64234004-64234026 CCCTGCTCCCTGTCCAGGAACCA 0: 1
1: 0
2: 1
3: 18
4: 330
Right 1083656815 11:64234052-64234074 CCCAGGTGCCCTCTCCTCCAGGG 0: 1
1: 0
2: 8
3: 42
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083656799 Original CRISPR TGGTTCCTGGACAGGGAGCA GGG (reversed) Intronic