ID: 1083656800

View in Genome Browser
Species Human (GRCh38)
Location 11:64234005-64234027
Sequence GTGGTTCCTGGACAGGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 251}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083656800_1083656815 24 Left 1083656800 11:64234005-64234027 CCTGCTCCCTGTCCAGGAACCAC 0: 1
1: 0
2: 2
3: 26
4: 251
Right 1083656815 11:64234052-64234074 CCCAGGTGCCCTCTCCTCCAGGG 0: 1
1: 0
2: 8
3: 42
4: 410
1083656800_1083656813 23 Left 1083656800 11:64234005-64234027 CCTGCTCCCTGTCCAGGAACCAC 0: 1
1: 0
2: 2
3: 26
4: 251
Right 1083656813 11:64234051-64234073 ACCCAGGTGCCCTCTCCTCCAGG 0: 1
1: 0
2: 4
3: 53
4: 396
1083656800_1083656807 7 Left 1083656800 11:64234005-64234027 CCTGCTCCCTGTCCAGGAACCAC 0: 1
1: 0
2: 2
3: 26
4: 251
Right 1083656807 11:64234035-64234057 GATCCCTATCCCAACCACCCAGG 0: 1
1: 0
2: 0
3: 7
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083656800 Original CRISPR GTGGTTCCTGGACAGGGAGC AGG (reversed) Intronic