ID: 1083656802

View in Genome Browser
Species Human (GRCh38)
Location 11:64234012-64234034
Sequence CCGAAGTGTGGTTCCTGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083656802_1083656819 27 Left 1083656802 11:64234012-64234034 CCTGTCCAGGAACCACACTTCGG 0: 1
1: 0
2: 3
3: 21
4: 132
Right 1083656819 11:64234062-64234084 CTCTCCTCCAGGGCCAACAGAGG 0: 1
1: 0
2: 2
3: 32
4: 249
1083656802_1083656813 16 Left 1083656802 11:64234012-64234034 CCTGTCCAGGAACCACACTTCGG 0: 1
1: 0
2: 3
3: 21
4: 132
Right 1083656813 11:64234051-64234073 ACCCAGGTGCCCTCTCCTCCAGG 0: 1
1: 0
2: 4
3: 53
4: 396
1083656802_1083656815 17 Left 1083656802 11:64234012-64234034 CCTGTCCAGGAACCACACTTCGG 0: 1
1: 0
2: 3
3: 21
4: 132
Right 1083656815 11:64234052-64234074 CCCAGGTGCCCTCTCCTCCAGGG 0: 1
1: 0
2: 8
3: 42
4: 410
1083656802_1083656807 0 Left 1083656802 11:64234012-64234034 CCTGTCCAGGAACCACACTTCGG 0: 1
1: 0
2: 3
3: 21
4: 132
Right 1083656807 11:64234035-64234057 GATCCCTATCCCAACCACCCAGG 0: 1
1: 0
2: 0
3: 7
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083656802 Original CRISPR CCGAAGTGTGGTTCCTGGAC AGG (reversed) Intronic