ID: 1083656805

View in Genome Browser
Species Human (GRCh38)
Location 11:64234017-64234039
Sequence GGATCCCGAAGTGTGGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 1, 2: 4, 3: 30, 4: 263}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083656805_1083656815 12 Left 1083656805 11:64234017-64234039 CCAGGAACCACACTTCGGGATCC 0: 1
1: 1
2: 4
3: 30
4: 263
Right 1083656815 11:64234052-64234074 CCCAGGTGCCCTCTCCTCCAGGG 0: 1
1: 0
2: 8
3: 42
4: 410
1083656805_1083656813 11 Left 1083656805 11:64234017-64234039 CCAGGAACCACACTTCGGGATCC 0: 1
1: 1
2: 4
3: 30
4: 263
Right 1083656813 11:64234051-64234073 ACCCAGGTGCCCTCTCCTCCAGG 0: 1
1: 0
2: 4
3: 53
4: 396
1083656805_1083656819 22 Left 1083656805 11:64234017-64234039 CCAGGAACCACACTTCGGGATCC 0: 1
1: 1
2: 4
3: 30
4: 263
Right 1083656819 11:64234062-64234084 CTCTCCTCCAGGGCCAACAGAGG 0: 1
1: 0
2: 2
3: 32
4: 249
1083656805_1083656807 -5 Left 1083656805 11:64234017-64234039 CCAGGAACCACACTTCGGGATCC 0: 1
1: 1
2: 4
3: 30
4: 263
Right 1083656807 11:64234035-64234057 GATCCCTATCCCAACCACCCAGG 0: 1
1: 0
2: 0
3: 7
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083656805 Original CRISPR GGATCCCGAAGTGTGGTTCC TGG (reversed) Intronic