ID: 1083656806

View in Genome Browser
Species Human (GRCh38)
Location 11:64234024-64234046
Sequence GGGATAGGGATCCCGAAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 95}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083656806_1083656815 5 Left 1083656806 11:64234024-64234046 CCACACTTCGGGATCCCTATCCC 0: 1
1: 0
2: 1
3: 8
4: 95
Right 1083656815 11:64234052-64234074 CCCAGGTGCCCTCTCCTCCAGGG 0: 1
1: 0
2: 8
3: 42
4: 410
1083656806_1083656819 15 Left 1083656806 11:64234024-64234046 CCACACTTCGGGATCCCTATCCC 0: 1
1: 0
2: 1
3: 8
4: 95
Right 1083656819 11:64234062-64234084 CTCTCCTCCAGGGCCAACAGAGG 0: 1
1: 0
2: 2
3: 32
4: 249
1083656806_1083656823 29 Left 1083656806 11:64234024-64234046 CCACACTTCGGGATCCCTATCCC 0: 1
1: 0
2: 1
3: 8
4: 95
Right 1083656823 11:64234076-64234098 CAACAGAGGCATCCTTCAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 170
1083656806_1083656813 4 Left 1083656806 11:64234024-64234046 CCACACTTCGGGATCCCTATCCC 0: 1
1: 0
2: 1
3: 8
4: 95
Right 1083656813 11:64234051-64234073 ACCCAGGTGCCCTCTCCTCCAGG 0: 1
1: 0
2: 4
3: 53
4: 396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083656806 Original CRISPR GGGATAGGGATCCCGAAGTG TGG (reversed) Intronic