ID: 1083656808

View in Genome Browser
Species Human (GRCh38)
Location 11:64234038-64234060
Sequence GCACCTGGGTGGTTGGGATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 177}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083656808_1083656824 26 Left 1083656808 11:64234038-64234060 CCCTATCCCAACCACCCAGGTGC 0: 1
1: 0
2: 0
3: 15
4: 177
Right 1083656824 11:64234087-64234109 TCCTTCAGCAGGAGCGACAACGG 0: 1
1: 0
2: 1
3: 4
4: 97
1083656808_1083656813 -10 Left 1083656808 11:64234038-64234060 CCCTATCCCAACCACCCAGGTGC 0: 1
1: 0
2: 0
3: 15
4: 177
Right 1083656813 11:64234051-64234073 ACCCAGGTGCCCTCTCCTCCAGG 0: 1
1: 0
2: 4
3: 53
4: 396
1083656808_1083656819 1 Left 1083656808 11:64234038-64234060 CCCTATCCCAACCACCCAGGTGC 0: 1
1: 0
2: 0
3: 15
4: 177
Right 1083656819 11:64234062-64234084 CTCTCCTCCAGGGCCAACAGAGG 0: 1
1: 0
2: 2
3: 32
4: 249
1083656808_1083656823 15 Left 1083656808 11:64234038-64234060 CCCTATCCCAACCACCCAGGTGC 0: 1
1: 0
2: 0
3: 15
4: 177
Right 1083656823 11:64234076-64234098 CAACAGAGGCATCCTTCAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 170
1083656808_1083656815 -9 Left 1083656808 11:64234038-64234060 CCCTATCCCAACCACCCAGGTGC 0: 1
1: 0
2: 0
3: 15
4: 177
Right 1083656815 11:64234052-64234074 CCCAGGTGCCCTCTCCTCCAGGG 0: 1
1: 0
2: 8
3: 42
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083656808 Original CRISPR GCACCTGGGTGGTTGGGATA GGG (reversed) Intronic