ID: 1083656809

View in Genome Browser
Species Human (GRCh38)
Location 11:64234039-64234061
Sequence GGCACCTGGGTGGTTGGGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 288}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083656809_1083656819 0 Left 1083656809 11:64234039-64234061 CCTATCCCAACCACCCAGGTGCC 0: 1
1: 0
2: 3
3: 21
4: 288
Right 1083656819 11:64234062-64234084 CTCTCCTCCAGGGCCAACAGAGG 0: 1
1: 0
2: 2
3: 32
4: 249
1083656809_1083656824 25 Left 1083656809 11:64234039-64234061 CCTATCCCAACCACCCAGGTGCC 0: 1
1: 0
2: 3
3: 21
4: 288
Right 1083656824 11:64234087-64234109 TCCTTCAGCAGGAGCGACAACGG 0: 1
1: 0
2: 1
3: 4
4: 97
1083656809_1083656815 -10 Left 1083656809 11:64234039-64234061 CCTATCCCAACCACCCAGGTGCC 0: 1
1: 0
2: 3
3: 21
4: 288
Right 1083656815 11:64234052-64234074 CCCAGGTGCCCTCTCCTCCAGGG 0: 1
1: 0
2: 8
3: 42
4: 410
1083656809_1083656826 30 Left 1083656809 11:64234039-64234061 CCTATCCCAACCACCCAGGTGCC 0: 1
1: 0
2: 3
3: 21
4: 288
Right 1083656826 11:64234092-64234114 CAGCAGGAGCGACAACGGCTAGG 0: 1
1: 0
2: 0
3: 8
4: 131
1083656809_1083656823 14 Left 1083656809 11:64234039-64234061 CCTATCCCAACCACCCAGGTGCC 0: 1
1: 0
2: 3
3: 21
4: 288
Right 1083656823 11:64234076-64234098 CAACAGAGGCATCCTTCAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083656809 Original CRISPR GGCACCTGGGTGGTTGGGAT AGG (reversed) Intronic