ID: 1083656813

View in Genome Browser
Species Human (GRCh38)
Location 11:64234051-64234073
Sequence ACCCAGGTGCCCTCTCCTCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 0, 2: 4, 3: 53, 4: 396}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083656802_1083656813 16 Left 1083656802 11:64234012-64234034 CCTGTCCAGGAACCACACTTCGG 0: 1
1: 0
2: 3
3: 21
4: 132
Right 1083656813 11:64234051-64234073 ACCCAGGTGCCCTCTCCTCCAGG 0: 1
1: 0
2: 4
3: 53
4: 396
1083656800_1083656813 23 Left 1083656800 11:64234005-64234027 CCTGCTCCCTGTCCAGGAACCAC 0: 1
1: 0
2: 2
3: 26
4: 251
Right 1083656813 11:64234051-64234073 ACCCAGGTGCCCTCTCCTCCAGG 0: 1
1: 0
2: 4
3: 53
4: 396
1083656805_1083656813 11 Left 1083656805 11:64234017-64234039 CCAGGAACCACACTTCGGGATCC 0: 1
1: 1
2: 4
3: 30
4: 263
Right 1083656813 11:64234051-64234073 ACCCAGGTGCCCTCTCCTCCAGG 0: 1
1: 0
2: 4
3: 53
4: 396
1083656806_1083656813 4 Left 1083656806 11:64234024-64234046 CCACACTTCGGGATCCCTATCCC 0: 1
1: 0
2: 1
3: 8
4: 95
Right 1083656813 11:64234051-64234073 ACCCAGGTGCCCTCTCCTCCAGG 0: 1
1: 0
2: 4
3: 53
4: 396
1083656801_1083656813 17 Left 1083656801 11:64234011-64234033 CCCTGTCCAGGAACCACACTTCG 0: 1
1: 0
2: 1
3: 12
4: 116
Right 1083656813 11:64234051-64234073 ACCCAGGTGCCCTCTCCTCCAGG 0: 1
1: 0
2: 4
3: 53
4: 396
1083656808_1083656813 -10 Left 1083656808 11:64234038-64234060 CCCTATCCCAACCACCCAGGTGC 0: 1
1: 0
2: 0
3: 15
4: 177
Right 1083656813 11:64234051-64234073 ACCCAGGTGCCCTCTCCTCCAGG 0: 1
1: 0
2: 4
3: 53
4: 396
1083656799_1083656813 24 Left 1083656799 11:64234004-64234026 CCCTGCTCCCTGTCCAGGAACCA 0: 1
1: 0
2: 1
3: 18
4: 330
Right 1083656813 11:64234051-64234073 ACCCAGGTGCCCTCTCCTCCAGG 0: 1
1: 0
2: 4
3: 53
4: 396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083656813 Original CRISPR ACCCAGGTGCCCTCTCCTCC AGG Exonic